Les auteurs remercient Peter Rubenstein pour des discussions utiles et des conseils techniques et David Pellman pour le clone de PB1996 originale. Ce travail a été soutenu par une subvention de la Mars of Dimes et le financement de la tour pour les enfants.

1. Clonage dans le PB1996 plasmide <ol><li> Conception et de commande des amorces d&#39;ADN à partir d&#39;une société de fabrication d&#39;oligonucléotides qui flanquent la séquence cible et contient des sites de restriction uniques dans le plasmide parent sélectionné. REMARQUE: Dans ce cas, les amorces ont été conçues pour amplifier les 400 paires de bases à l&#39;extrémité 5 &#39;de la séquence AIP1. Le site de restriction XhoI a été incorporé dans l&#39;amorce d&#39;environ 20 pb avant que la séquence AIP1 et Xmal était inclus d&#39;environ 20 pb après la séquence AIP1 cible. Le plasmide utilisé pour le clonage était PB1996, qui contient un mot-clé pour 3XGFP fluorescence, un gène URA pour la sélection des souches de levure, et un gène de résistance à l&#39;ampicilline pour la sélection bactérienne. </li><li> Purifier l&#39;ADN génomique à partir d&#39;une souche haploïde de levure Ura-. Remarque: Se référer à la Figure 1 pour un diagramme de processus de clonage. </li><li> Exécuter une réaction de PCR standard en utilisant les deux amorces et l&#39;ADN génomique de levure pour amplifier le gène Aip1p avec les sites de restriction de part end. Digérer le produit de PCR et le plasmide d&#39;PB1996 avec les enzymes de restriction dans des réactions séparées par fabricant protocoles recommandés. Dans ce cas Xmal et Xhol ont été utilisés avec le tampon d&#39;accompagnement à 37 ° C pendant 1 heure. </li><li> Exécuter un gel à 0,8% d&#39;agarose à une électrophorèse pour séparer les fragments d&#39;ADN digérés. Dans un puits, charger une faible échelle de masse de l&#39;ADN et, dans des puits séparés, charger la totalité de la réaction de chaque digestion. Exécuter le gel à 100 V pendant environ 1 heure, jusqu&#39;à ce que le front de colorant se trouve près de l&#39;extrémité du gel. Visualiser le gel sous une lumière UV et on purifie le segment qui correspond au segment de protéine et le plasmide coupé. </li><li> Ligaturer le segment AIP1 et PB1996 digéré le plasmide. Transformer le produit dans des cellules DH5a en utilisant les protocoles du fabricant (10 d&#39;ADN ul avec 100 cellules de pi pendant 30 minutes sur la glace, le choc thermique à 42 ° C pendant 2 min, grandir en milieu SOC pendant 2 heures à 37 ° C) et la plaque sur des plaques de culture qui comprend l&#39;antibiotique de sélection, dans ce cas, LB +plaques d&#39;amplis. Sélectionner et développer une colonie en culture liquide. Purifier le plasmide nouvellement conçu. </li></ol> 2. Mutant Generation levure de souche <ol><li> Utilisation d&#39;une souche de levure haploïde dans lequel l&#39;allèle de l&#39;actine a été supprimée pour construire une souche de levure mutante. Remarque: Dans ce cas, la souche mère était un don généreux de M. Peter Rubenstein (Université de l&#39;Iowa) et la construction a été décrite par Cook et al 20 Cette souche dépourvue du gène de l&#39;actine chromosomique et contient un plasmide codant levure de type sauvage. actine et de l&#39;uracile. </li><li> Utilisez le pRS plasmide codant levure de type sauvage actine avec un Trp + sélection comme le plasmide de base pour la mutagenèse 21. </li><li> Effectuer une mutagenèse dirigée sur le plasmide pRS de concevoir la mutation faux-sens dans l&#39;actine. <ol><li> Pour la mutation R256H dans actine, faire l&#39;amorce 5 &#39;ggtaacgaaagattccatgccccagaagc 3&#39; pour changer la Arg 256 à son 256. Exécuter une mutagenèse normeRéaction de PCR avec le plasmide de l&#39;étape 2.2. </li><li> Transformer le plasmide d&#39;actine mutant de la PCR dans des cellules DH5a. Isoler l&#39;ADN plasmidique et le séquençage du gène de l&#39;actine pour vérifier la mutation. </li></ol></li><li> Transformer la levure mutante plasmide codant l&#39;actine dans la souche de levure haploïde dans l&#39;étape 2.1. </li><li> Culture des cellules transformées sur TRP-plaques pour sélectionner la levure contenant le Trp + contenant le plasmide mutant de levure actine. </li><li> Sélectionner les cellules manquant du plasmide d&#39;origine qui code type sauvage actine et l&#39;uracile (décrit à la section 2.1) par sous-culture de cellules par le TRP-plaques sur des plaques qui contiennent 5-fluoro-acide (5-FOA). 5-FOA est converti en une forme toxique, le 5-fluorouracile, en voix contre des souches exprimant le gène URA3 fonctionnel. Les cellules qui se développent après la sélection pas à pas ne contiendront que le plasmide d&#39;actine mutante. </li><li> Purifier l&#39;ADN plasmidique à partir de la nouvelle souche de levure. Séquencer le plasmide pour assurer le gène de l&#39;actine mutante est présente. Utilisez ce sformer dans d&#39;autres études. Ce processus est schématisé sur la figure 2. </li></ol> 3. Transformer le plasmide dans des cellules de levure <ol><li> Digérer le plasmide Aip1p-GFP avec une enzyme de restriction pour permettre l&#39;intégration dans le chromosome de la levure. NOTE: Le site de restriction doit être à l&#39;extérieur du bloc de séquence qui contient le marqueur fluorescent, un gène d&#39;intérêt et le marqueur de sélection. Dans ce cas, utiliser 1 pl de l&#39;enzyme de restriction Hpal avec 8 ADN pi et 1 pi du tampon 10x accompagnant pendant 1 heure à 37 ° C. </li><li> Culture S. cerevisiae (cellules de l&#39;étape 2.5), qui sont incapables de synthétiser l&#39;uracile (Ura-déformation) pendant une nuit dans 5 ml dans des milieux YPD (1% d&#39;extrait de levure, 2% de peptone et 2% de dextrose) sur une roue à 30 ° C. Centrifuger 1 ml des cellules pendant 5 min à 1000 x g. </li><li> Assurez mélange PLAQUE. Faire 10XTE par addition de 5 ml de Tris 1 M pH 7,5 et 2 ml de 250 mM d&#39;acide éthylènediaminetétraacétique (EDTA) à 43 ml de trou DDH 2 O. Ajouter 00,204 g d&#39;acétate de lithium à 20 ml de 1XTE, puis 8 g de polyéthylène glycol (PEG) (MW ~ 3300) et stériliser par filtration. </li><li> Décanter le liquide surnageant à partir des cellules filées à l&#39;étape 3.2 et de remettre en suspension les cellules dans le liquide restant. Pour les cellules en suspension, ajouter 2 pi de ml d&#39;ADN de 10 mg / testicules de saumon transporteur. Ajouter 10 ul de l&#39;ADN de plasmide digéré de l&#39;étape 3.1 et de vortex. Ajouter 0,5 ml de la plaque et vortex. Ajouter 20 pi de 1 M DTT et vortex. </li><li> Incuber le mélange pendant 6-8 heures à 25 ° C. Choc thermique des cellules dans un bain d&#39;eau à 42 ° C pendant 10 min. Plate 100 ul de cellules à partir du fond du tube à centrifuger où ils sont installés sur une plaque-Ura. Incuber à 30 ° C pendant 2-3 jours ou jusqu&#39;à ce que les colonies forme. </li><li> Sélectionner des colonies individuelles et série sur une plaque-Ura. REMARQUE: Ces cellules contiennent le plasmide avec le gène GFP-AIP1 et Ura intégré dans le chromosome, ce qui permet à la croissance. Ces cellules seront ensuite utilisés dans microscopy. </li></ol> 4. Visualisation du Mouvement des protéines Aip1p aide de la réflexion interne totale microscopie de fluorescence <ol><li> Cultiver une culture de cellules de levure avec le Aip1p-GFP constituée en YPD nuit sur une roue à 30 ° C. Subculture 1 ml de la culture d&#39;une nuit dans 9 ml de-Ura médias. Cultiver les cellules pendant 3 à 4 h de plus un sur un agitateur à 30 ° C afin de s&#39;assurer qu&#39;elles sont en phase de croissance logarithmique. </li><li> Ajouter 3 pi de cellules sur une lame de microscope en verre et ajouter une lamelle. Laisser les cellules se déposer sur la lame pendant 5 min. Placer la lame dans le support de la plaque de platine. </li><li> Observez la protéine Aip1p-GFP avec une réflexion interne totale fluorescence (FRBR) de microscope (488 nm) en utilisant une huile à immersion 100X FRBR objectif et une caméra CCD numérique. En utilisant le logiciel SlideBook 5.0, d&#39;obtenir des images de 20 secondes à une vitesse de 5 images / s (images individuelles d&#39;images acquises sont présentés dans la figure 2A). <ol><li> Pour se concentrer sur le caunes, logiciel libre SlideBook 5.0 et cliquez sur le bouton Mise au point Fenêtre dans la barre d&#39;outils pour accéder aux commandes de discussion. Sélectionnez l&#39;onglet Champ d&#39;application et sélectionnez l&#39;objectif 100X-FRBR. Allumer la lampe et faire glisser la barre de la lampe à 15%. Changez le réglage Bin à 2 x 2. Changer le filtre à champ lumineux. </li><li> Sur le microscope, utilisez la molette de mise au point bien d&#39;amener les cellules dans le foyer comme on le voit sur l&#39;écran d&#39;ordinateur. </li><li> Utilisation des commandes dans la fenêtre Focus, éteindre la lampe, changer le filtre à vivre, et cliquez sur le bouton TIRFM. </li><li> Sur l&#39;illuminateur TIRFM attaché à l&#39;orifice latéral droit du microscope, tourner l&#39;émission laser à Sur. </li><li> Sélectionnez l&#39;onglet Stream dans la fenêtre Focus, cochez la case pour démarrer l&#39;enregistrement, puis cliquez sur le bouton de champ lumineux. </li><li> Sur l&#39;illuminateur TIRFM, tourner le micromètre pour ajuster l&#39;angle d&#39;incidence du laser. Ceci permet d&#39;optimiser l&#39;émission de fluorescence à partir des foyers AIP1-GFP et de minimiser la fluorescence de fond à partir de lacellules et toboggan. </li><li> Lorsque l&#39;image souhaitée est affichée, appuyez sur Start. Après 20 secondes, appuyez sur Stop. Enregistrer les images. Sous l&#39;onglet Fichier dans la barre de menu principal, sélectionnez Enregistrer le diaporama sous et entrez l&#39;emplacement du fichier et le nom. </li></ol></li><li> Utilisez le logiciel ImageJ pour analyser les images. Utilisez la macro plugin &quot;Tracker Manuel&quot; pour suivre le mouvement et la vitesse de la Aip1p foyers fluorescents. Modifier le paramètre intervalle de temps de 0,2 sec. <ol><li> Utilisation de la sélection de la piste de complément, sélectionnez et suivre une protéine fluorescente individu à travers quatre à huit cadres conjonctifs. Utilisez la commande de la piste de fin et la vitesse de déplacement de la protéine entre chaque image s&#39;affiche dans une fenêtre de résultats. </li><li> Déterminer le taux moyen entre chaque trame en utilisant une feuille de calcul Microsoft Excel. Utiliser les valeurs pour calculer la vitesse moyenne du mouvement Aip1p pour chaque souche de cellules d&#39;intérêt. REMARQUE: Un diagramme de dispersion de la vitesse de déplacement et la vitesse Aip1p non-linéaire moyenne est représentée dans Figure 2B. </li></ol></li></ol>

<ol>
	<li>Lehtonen, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Segregation+of+a+missense+variant+in+enteric+smooth+muscle+actin+gamma-2+with+autosomal+dominant+familial+visceral+myopathy.">Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy.</a> Gastroenterology. 143, 1482-1491 (2012).</li><li>Matsson, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-cardiac+actin+mutations+produce+atrial+septal+defects.">Alpha-cardiac actin mutations produce atrial septal defects.</a> Hum Mol Genet. 17, 256-265 (2008).</li><li>Zhu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+gamma-actin+gene+(ACTG1)+are+associated+with+dominant+progressive+deafness+(DFNA20/26).">Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26).</a> Am J Hum Genet. 73, 1082-1091 (2003).</li><li>Nowak, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+the+skeletal+muscle+alpha-actin+gene+in+patients+with+actin+myopathy+and+nemaline+myopathy.">Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy.</a> Nat Genet. 23, 208-212 (1999).</li><li>Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+mutations+in+dilated+cardiomyopathy,+a+heritable+form+of+heart+failure.">Actin mutations in dilated cardiomyopathy, a heritable form of heart failure.</a> Science. 280, 750-752 (1998).</li><li>Riviere, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+mutations+in+the+actin+genes+ACTB+and+ACTG1+cause+Baraitser-Winter+syndrome.">De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome.</a> Nat Genet. 44, 440-444 (2012).</li><li>Guo, D. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+smooth+muscle+alpha-actin+(ACTA2)+lead+to+thoracic+aortic+aneurysms+and+dissections.">Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections.</a> Nat Genet. 39, 1488-1493 (2007).</li><li>Sparrow, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle+disease+caused+by+mutations+in+the+skeletal+muscle+alpha-actin+gene+(ACTA1).">Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1).</a> Neuromuscul Disord. 13, 519-531 (2003).</li><li>Kruth, K. A., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+deafness-causing+(DFNA20/26)+actin+mutations+affect+Arp2/3-dependent+actin+regulation.">Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation.</a> J Biol Chem. 287, 27217-27226 (2012).</li><li>Amberg, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+imaging+of+the+yeast+actin+cytoskeleton+through+the+budding+cell+cycle.">Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle.</a> Mol Biol Cell. 9, 3259-3262 (1998).</li><li>Pelham, R. J., Chang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+actin+polymerization+and+actin+cables+in+actin-patch+movement+in+Schizosaccharomyces+pombe.">Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe.</a> Nat Cell Biol. 3, 235-244 (2001).</li><li>Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+mechanism+of+the+contractile+ring+for+cytokinesis+by+fission+yeast.">Assembly mechanism of the contractile ring for cytokinesis by fission yeast.</a> Science. 319, 97-100 (2008).</li><li>Bertin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+ultrastructure+of+the+septin+filament+network+in+Saccharomyces+cerevisiae.">Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae.</a> Mol Biol Cell. 23, 423-432 (2012).</li><li>Senning, E. N., Marcus, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actin+polymerization+driven+mitochondrial+transport+in+mating+S.+cerevisiae.">Actin polymerization driven mitochondrial transport in mating S. cerevisiae.</a> Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).</li><li>Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+actin+assembly+by+in+vitro+TIRF+microscopy.">Analysis of actin assembly by in vitro TIRF microscopy.</a> Methods Mol Biol. 571, 401-415 (2009).</li><li>Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanism+of+bundle+formation+by+the+bacterial+actin+ParM.">Molecular mechanism of bundle formation by the bacterial actin ParM.</a> Biochem Biophys Res Commun. 391, 1598-1603 (2010).</li><li>Trache, A., Lim, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+cell+response+to+mechanical+stimulation+studied+by+integrated+optical+and+atomic+force+microscopy.">Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy.</a> J Vis Exp. (44), (2010).</li><li>Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+cortex+organization+and+dynamics+in+microorganisms,+using+total+internal+reflection+fluorescence+microscopy.">Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy.</a> J Vis Exp. (63), e3982 (2012).</li><li>Manneville, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+TIRF+microscopy+to+visualize+actin+and+microtubules+in+migrating+cells.">Use of TIRF microscopy to visualize actin and microtubules in migrating cells.</a> Methods Enzymol. 406, 520-532 (2006).</li><li>Cook, R. K., Sheff, D. R., Rubenstein, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unusual+metabolism+of+the+yeast+actin+amino+terminus.">Unusual metabolism of the yeast actin amino terminus.</a> J Biol Chem. 266, 16825-16833 (1991).</li><li>Feng, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+probing+of+yeast+actin+subdomain+3/4+hydrophobic+loop+262-274.+Actin-actin+and+actin-myosin+interactions+in+actin+filaments.">Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments.</a> J Biol Chem. 272, 16829-16837 (1997).</li><li>Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+and+distinct+functions+for+cofilin,+coronin+and+Aip1+in+actin+dynamics+in+vivo.">Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo.</a> J Cell Sci. 123, 1329-1342 (2010).</li><li>Malloy, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+Aortic+Aneurysm+(TAAD)-causing+Mutation+in+Actin+Affects+Formin+Regulation+of+Polymerization.">Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization.</a> J Biol Chem. 287, 28398-28408 (2012).</li><li>Smyth, J. W., Shaw, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+ion+channel+dynamics+at+the+plasma+membrane.">Visualizing ion channel dynamics at the plasma membrane.</a> Heart Rhythm. 5, S7-S11 (2008).</li><li>Bhattacharya, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recruitment+of+vimentin+to+the+cell+surface+by+beta3+integrin+and+plectin+mediates+adhesion+strength.">Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength.</a> J Cell Sci. 122, 1390-1400 (2009).</li><li>Hetheridge, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+formin+FMNL3+is+a+cytoskeletal+regulator+of+angiogenesis.">The formin FMNL3 is a cytoskeletal regulator of angiogenesis.</a> J Cell Sci. 125, 1420-1428 (2012).</li><li>Bergeron, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+effects+of+thoracic+aortic+aneurysm+and+dissection+alpha-smooth+muscle+actin+mutations+on+actin+function.">Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function.</a> J Biol Chem. 286, 11356-11369 (2011).</li></ol>

Les auteurs n&#39;ont rien à révéler.

Une stratégie efficace de visualiser la dynamique du cytosquelette et l&#39;utilité dans les enquêtes sur les mutations pathogènes a été décrit ici. Avancées techniques d&#39;imagerie ont créé de nouvelles opportunités pour comprendre le mouvement intracellulaire des protéines près de la membrane cellulaire. Totale microscopie de fluorescence à réflexion interne (FRBR) est une technique sensible pour des études fonctionnelles dans les cellules vivantes. TIRF utilise un laser d&#39;excitation est incliné...

L&#39;actine est la protéine dominante comprenant du cytosquelette et participe au processus cellulaires critiques, y compris la division cellulaire, le mouvement des organites, la motilité cellulaire, la contraction, et la signalisation. Au cours de la dernière décennie, les mutations pathogènes dans actine ont été découvertes dans chacun des six isoformes d&#39;actine humaines menant à une série de troubles, de myopathies de maladie coronarienne 1-7. Les processus par lesquels les mutations conduisent à l&#39;actine maladie continuent à être élucidée. Le modèle de levure reste l&#39;étalon-or pour étudier les effets biochimiques des mutations sur la fonction de l&#39;actine en raison des avantages de la seule isoforme d&#39;actine essentiel, traçabilité génétique et grande conservation de séquence et la fonction de l&#39;actine. Des études montrent que des mutations d&#39;actine individuels conduisent à des dysfonctionnements spécifiques moléculaires avec des effets négatifs dominants 8. Par exemple, les mutations de la surdité causant à l&#39;actine γ-non-musculaires qui affectent le résidu Lys-118 modifie la réglementation parla protéine de liaison de l&#39;actine Arp2 / 3 9. Des études in vitro utilisent fréquemment des analyses des interactions protéine: protéine. Les investigations sur les effets des mutations actine sur la biologie cellulaire et, en particulier, la liaison d&#39;actine localisation de la protéine dans la cellule est limité. Études du cytosquelette de la levure in vivo reposent classiquement sur ​​des images de cellules fixes à partir d&#39;un microscope inversé à fluorescence 10. Ces expériences ont fourni des données fondamentales sur la morphologie du cytosquelette d&#39;actine. Des enquêtes ont incorporé depuis trois dimensions imagerie confocale pour visualiser le réseau du cytosquelette complexe 11, 12. Cette imagerie permet la quantification de l&#39;abondance et la position relative des patchs d&#39;actine et les filaments. La tomographie d&#39;électrons section mince a été utilisée pour l&#39;image de la morphologie des réseaux filamenteux denses par rapport aux structures sous-cellulaires conservées 13. S cellulaires Crowdedépreuve avec une petite section peuvent être examinées dans les moindres détails avec cette technique. Les études d&#39;imagerie ont été étendues à des cellules vivantes en utilisant laps de temps microscopie fluorescente. Lorsque photo blanchiment et la fluorescence de fond peuvent être modérés, laps de temps imagerie permet enquêtes à la dynamique des protéines du cytosquelette et la réponse aux conditions environnementales 11, 14. Par ailleurs, la visualisation de la dynamique des filaments d&#39;actine in vitro a été avancée par l&#39;introduction du total fluorescence à réflexion interne (FRBR) microscopie. Par rapport à la microscopie à champ large, TIRF présente l&#39;avantage d&#39;une diminution de la fluorescence d&#39;arrière-plan et de contraste amélioré pour surveiller filaments individuels 15, 16. Avec ces qualités, microscopie TIRF a été adaptée par les biologistes cellulaires pour surveiller les structures cellulaires à la membrane plasmique 17, 18. Événements cellulaires, y compris les changements dans le cytosquelette, peutêtre visualisées en temps réel avec une faible phototoxicité, contraste maximal et minimal fond floraison 19. Pour mieux comprendre l&#39;effet des mutations d&#39;actine sur le mouvement, la localisation et le chiffre d&#39;affaires de protéines du cytosquelette de la cellule, la microscopie TIRF et de protéines de marquage ont été utilisés. Ici, des méthodes pour étudier les effets d&#39;une mutation cliniquement pertinente de l&#39;actine sur la dynamique du cytosquelette dans Saccharomyces cerevisiae sont décrits. Plus précisément, la localisation et le déplacement de la protéine de liaison de l&#39;actine, Aip1p, a été visualisés et quantifiés dans des cellules exprimant la mutation R256H dans actine. Ces techniques se complètent dans les études biochimiques in vitro et permettent une meilleure compréhension des interactions et des fonctions protéiques.

<table border="0" cellpadding="0" cellspacing="0" width="600">
	<colgroup>
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Agarose</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">9012-36-6</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Bromophenol Blue</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">115-39-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">BSA</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B9001S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Change-IT Multiple Mutation Site Directed Mutagenesis Kit</td>
			<td style="width:103px;">USB Corporation</td>
			<td align="right" style="width:119px;">4166059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">CutSmart Buffer</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DNA, single stranded from salmon testes</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">9007-49-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EDTA pH 7.4</td>
			<td style="width:103px;">Sigma</td>
			<td align="right" style="width:119px;">93302</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethidium Bromide</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">15585-011</td>
			<td>Warning! Harmful irritation</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Fungal/Bacterial DNA Kit</td>
			<td style="width:103px;">Symo Research</td>
			<td style="width:119px;">D6005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">HpaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0105S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Lithium Acetate</td>
			<td style="width:103px;">AlfaAesar</td>
			<td style="width:119px;">6108-17-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Low DNA Mass Ladder</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10068-013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NE Buffer #4</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">B7004S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Platinum PCR SuperMix High Fidelity</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">12532-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Miniprep Kit</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right" style="width:119px;">27106</td>
			<td>Any kit will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Quick Ligation Kit</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">M2200S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium azide</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">26628-22-8</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBS</td>
			<td style="width:103px;">Invitrogen</td>
			<td style="width:119px;">10010-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PEG</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">25322-68-3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris Base Ultrapure</td>
			<td style="width:103px;">rpi</td>
			<td style="width:119px;">77-86-1</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Wizard SV Gel and PCR Clean-Up System</td>
			<td style="width:103px;">Promega</td>
			<td align="right" style="width:119px;">1/6/2015</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XhoI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0146S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">XmaI</td>
			<td style="width:103px;">NEB</td>
			<td style="width:119px;">R0180S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">YPD media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">-URA Media</td>
			<td style="width:103px;">LabExpress</td>
			<td align="right" style="width:119px;">3010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PCR Machine</td>
			<td style="width:103px;">Invitrogen</td>
			<td align="right" style="width:119px;">4359659</td>
			<td>Any PCR machine will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TIRF Microscope</td>
			<td style="width:103px;">Olympus IX81</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hamamatsu ORCA-R camera</td>
			<td style="width:103px;">Hamamatsu</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

aip1p dynamics are altered by the r256h mutation in actin

Des mutations dans actine provoquent une gamme de maladies humaines dues à des changements moléculaires spécifiques qui modifient souvent la fonction du cytosquelette. Dans cette étude, l&#39;imagerie de fluorescence protéines marquées par fluorescence interne totale (FRBR) microscopie est utilisée pour visualiser et quantifier les changements dans la dynamique du cytosquelette. microscopie TIRF et l&#39;utilisation de marqueurs fluorescents permet aussi de quantifier les changements dans la dynamique du cytosquelette causées par des mutations dans l&#39;actine. En utilisant cette technique, la quantification de la fonction du cytosquelette dans les cellules vivantes complète utilement dans des études in vitro de la fonction des protéines. A titre d&#39;exemple, des mutations faux-sens affectent le résidu R256 de l&#39;actine ont été identifiés dans les trois isoformes d&#39;actine humain suggère que cet acide aminé joue un rôle important dans les interactions régulatrices. Les effets de la mutation R256H actine du cytosquelette sur les mouvements ont été étudiés à l&#39;aide du modèle de la levure. La protéine, AIP1, qui est connu pour aider à cofilin dépolymérisation de l&#39;actine, étaitmarqués avec la protéine fluorescente verte (GFP) à l&#39;extrémité N-terminale et suivis in vivo en utilisant la microscopie TIRF. La vitesse de déplacement Aip1p à la fois de type sauvage et des souches mutantes a été quantifiée. Dans les cellules exprimant R256H actine mutant, le mouvement Aip1p est limitée et le taux de circulation est pratiquement la moitié de la vitesse mesurée dans des cellules de type sauvage (0,88 ± 0,30 um / sec dans les cellules R256H par rapport à 1,60 ± 0,42 um / sec dans les cellules de type sauvage, p &lt;0,005).

Procédé pour imager la dynamique de protéines du cytosquelette de la cellule est présentée. La protéine liant l&#39;actine, Aip1p, a été marqué à la GFP. La conception pour le plasmide codant pour le produit marqué est représenté sur la figure 1. Le plasmide a été ensuite transformé dans des cellules de levure. L&#39;expression de la fluorescence étiquetée Aip1p permis de visualiser le comportement de la protéine dans la cellule. Aip1p localise généralement à des taches d&#39;actin...

Watch this Scientific Journal Video about Aip1p Dynamics Are Altered by the R256H Mutation in Actin at JoVE.com

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

mutations qui causent des maladies dans actine peuvent altérer la fonction du cytosquelette. Dynamique du cytosquelette sont quantifiés grâce à l&#39;imagerie des protéines marquées par fluorescence à l&#39;aide totale microscopie de fluorescence interne. A titre d&#39;exemple, la protéine du cytosquelette, Aip1p, a modifié la localisation et le déplacement dans des cellules exprimant l&#39;isoforme mutante de l&#39;actine, R256H.

Aip1p Dynamics sont modifiés par la R256H Mutation dans actine

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of ...

aip1p-dynamics-are-altered-by-the-r256h-mutation-in-actin

Research

JoVE Journal

Biology

7.9K vues.  University of Iowa.  mutations qui causent des maladies dans actine peuvent altérer la fonction du cytosquelette. Dynamique du cytosquelette sont quantifiés grâce à l'imagerie des protéines marquées par fluorescence à l'aide totale microscopie de fluorescence interne. A titre d'exemple, la protéine du cytosquelette, Aip1p, a modifié la localisation et le déplacement dans des cellules exprimant l'isoforme mutante de l'actine, R256H. 

Vidéo: Aip1p Dynamics Are Altered by the R256H Mutation in Actin

Actin Co-Sedimentation Assay; for the Analysis of Protein Binding to F-Actin

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates tension and helps maintains cellular shape.  Although the actin cytoskeleton is a rigid structure, it is a dynamic structure that is constantly remodeling.  A number of proteins can bind to the actin cytoskeleton.  The binding of a particular protein to F-actin is often desired to support cell biological observations or to further understand dynamic processes due to remodeling of the actin cytoskeleton. The actin co-sedimentation assay is an in vitro assay routinely used to analyze the binding of specific proteins or protein domains with F-actin.  The basic principles of the assay involve an incubation of the protein of interest (full length or domain of) with F-actin, ultracentrifugation step to pellet F-actin and analysis of the protein co-sedimenting with F-actin.  Actin co-sedimentation assays can be designed accordingly to measure actin binding affinities and in competition assays.

Proteins bind to filamentous actin (F-actin) through distinct actin binding modules. In this video we demonstrate the procedure of actin co-sedimentation, which is an in vitro assay routinely used to analyze proteins or specific domains that bind F-actin.

Co-actine sédimentation Assay; pour l&#39;analyse des Binding Protein à F-actine

The actin cytoskeleton within the cell is a network of actin filaments that allows the movement of cells and cellular processes, and that generates ...

Recherche

Biologie

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique advantage of FSM is its ability to capture the movement and turnover kinetics (assembly/disassembly) of the F-actin network within living cells. This technique is particularly useful in deriving quantitative measurements of F-actin dynamics when paired with computer vision software (qFSM).  We describe  the selection, microinjection and visualization of fluorescent actin probes in living cells. Importantly, similar procedures are applicable to visualizing other macomolecular assemblies. FSM has been demonstrated for microtubules, intermediate filaments, and adhesion complexes.  

Live Cell Imaging of F-actin Dynamics via Fluorescent Speckle Microscopy FSM

Selection, microinjection, and imaging of fluorescently-labeled F-actin via fluorescent speckle microscopy (FSM).

Imagerie de cellules vivantes de la F-actine fluorescente Dynamics via chatoiement de microscopie (FSM)

In this protocol we describe the use of Fluorescent Speckle Microscopy (FSM) to capture high-resolution images of actin dynamics in PtK1 cells. A unique ...

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no curative treatment available. Recent advances in stem cell biology have generated new hopes for the development of effective cell based therapies to treat these diseases. Transplantation of various types of stem cells labeled with fluorescent proteins into muscles of dystrophic animal models has been used broadly in the field. A non-invasive technique with the capability to track the transplanted cell fate longitudinally can further our ability to evaluate muscle engraftment by transplanted cells more accurately and efficiently.
In the present study, we demonstrate that in vivo fluorescence imaging is a sensitive and reliable method for tracking transplanted GFP (Green Fluorescent Protein)-labeled cells in mouse skeletal muscles. Despite the concern about background due to the use of an external light necessary for excitation of fluorescent protein, we found that by using either nude mouse or eliminating hair with hair removal reagents much of this problem is eliminated. Using a CCD camera, the fluorescent signal can be detected in the tibialis anterior (TA) muscle after injection of 5 x 105 cells from either GFP transgenic mice or eGFP transduced myoblast culture. For more superficial muscles such as the extensor digitorum longus (EDL), injection of fewer cells produces a detectable signal. Signal intensity can be measured and quantified as the number of emitted photons per second in a region of interest (ROI). Since the acquired images show clear boundaries demarcating the engrafted area, the size of the ROI can be measured as well. If the legs are positioned consistently every time, the changes in total number of photons per second per muscle and the size of the ROI reflect the changes in the number of engrafted cells and the size of the engrafted area. Therefore the changes in the same muscle over time are quantifiable. In vivo fluorescent imaging technique has been used primarily to track the growth of tumorogenic cells, our study shows that it is a powerful tool that enables us to track the fate of transplanted stem cells.

Tracking Dynamics of Muscle Engraftment in Small Animals by In Vivo Fluorescent Imaging

We describe an in vivo fluorescence imaging protocol to monitor muscle regeneration by GFP-labeled myoblasts after transplantation into skeletal muscles of both healthy and dystrophic mice. This protocol can be adapted to study muscle regeneration by transplantation of other types of cells and in other muscular conditions as well.

Suivi dynamique de prise de greffe musculaire chez les petits animaux par des In Vivo Fluorescent Imaging

Muscular dystrophies are a group of degenerative muscle diseases characterized by progressive loss of contractile muscle cells. Currently, there is no ...

Photobleaching Assays (FRAP &amp; FLIP) to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with good spatial and temporal resolution. Here we describe how to perform FRAP and FLIP assays of chromatin proteins, including H1 and HP1, in mouse embryonic stem (ES) cells. In a FRAP experiment, cells are transfected, either transiently or stably, with a protein of interest fused with the green fluorescent protein (GFP) or derivatives thereof (YFP, CFP, Cherry, etc.). In the transfected, fluorescing cells, an intense focused laser beam bleaches a relatively small region of interest (ROI). The laser wavelength is selected according to the fluorescent protein used for fusion. The laser light irreversibly bleaches the fluorescent signal of molecules in the ROI and, immediately following bleaching, the recovery of the fluorescent signal in the bleached area - mediated by the replacement of the bleached molecules with the unbleached molecules - is monitored using time lapse imaging. The generated fluorescence recovery curves provide information on the protein's mobility. If the fluorescent molecules are immobile, no fluorescence recovery will be observed. In a complementary approach, Fluorescence Loss in Photobleaching (FLIP), the laser beam bleaches the same spot repeatedly and the signal intensity is measured elsewhere in the fluorescing cell. FLIP experiments therefore measure signal decay rather than fluorescence recovery and are useful to determine protein mobility as well as protein shuttling between cellular compartments. Transient binding is a common property of chromatin-associated proteins. Although the major fraction of each chromatin protein is bound to chromatin at any given moment at steady state, the binding is transient and most chromatin proteins have a high turnover on chromatin, with a residence time in the order of seconds. These properties are crucial for generating high plasticity in genome expression1. Photobleaching experiments are therefore particularly useful to determine chromatin plasticity using GFP-fusion versions of chromatin structural proteins, especially in ES cells, where the dynamic exchange of chromatin proteins (including heterochromatin protein 1 (HP1), linker histone H1 and core histones) is higher than in differentiated cells2,3.

Photobleaching Assays FRAP &amp; FLIP to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

We describe photobleaching methods including Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) to monitor chromatin protein dynamics in embryonic stem (ES) cells. Chromatin protein dynamics, which is considered to be one of the means to study chromatin plasticity, is enhanced in pluripotent cells.

Photobleaching essais (FRAP et FLIP) pour mesurer la dynamique des protéines de la chromatine dans Vivre cellules souches embryonnaires

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with ...

Study of the Actin Cytoskeleton in Live Endothelial Cells Expressing GFP-Actin

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial cells regulate permeability of the endothelium, and many studies have indicated the important contribution of the actin cytoskeleton to determining junctional integrity1-5. A cortical actin belt is thought to be important for the maintenance of stable junctions1, 2, 4, 5. In contrast, actin stress fibers are thought to generate centripetal tension within endothelial cells that weakens junctions2-5. Much of this theory has been based on studies in which endothelial cells are treated with inflammatory mediators known to increase endothelial permeability, and then fixing the cells and labeling F-actin for microscopic observation. However, these studies provide a very limited understanding of the role of the actin cytoskeleton because images of fixed cells provide only snapshots in time with no information about the dynamics of actin structures5. 
Live-cell imaging allows incorporation of the dynamic nature of the actin cytoskeleton into the studies of the mechanisms determining endothelial barrier integrity. A major advantage of this method is that the impact of various inflammatory stimuli on actin structures in endothelial cells can be assessed in the same set of living cells before and after treatment, removing potential bias that may occur when observing fixed specimens. Human umbilical vein endothelial cells (HUVEC) are transfected with a GFP-&beta;-actin plasmid and grown to confluence on glass coverslips. Time-lapse images of GFP-actin in confluent HUVEC are captured before and after the addition of inflammatory mediators that elicit time-dependent changes in endothelial barrier integrity. These studies enable visual observation of the fluid sequence of changes in the actin cytoskeleton that contribute to endothelial barrier disruption and restoration. 
Our results consistently show local, actin-rich lamellipodia formation and turnover in endothelial cells. The formation and movement of actin stress fibers can also be observed. An analysis of the frequency of formation and turnover of the local lamellipodia, before and after treatment with inflammatory stimuli can be documented by kymograph analyses. These studies provide important information on the dynamic nature of the actin cytoskeleton in endothelial cells that can used to discover previously unidentified molecular mechanisms important for the maintenance of endothelial barrier integrity.

Microscopic imaging of live endothelial cells expressing GFP-actin allows characterization of dynamic changes in cytoskeletal structures. Unlike techniques that use fixed specimens, this method provides a detailed assessment of temporal changes in the actin cytoskeleton in the same cells before, during, and after various physical, pharmacological, or inflammatory stimuli.

Étude du cytosquelette d&#39;actine dans les cellules endothéliales en direct exprimant la GFP-actine

The microvascular endothelium plays an important role as a selectively permeable barrier to fluids and solutes. The adhesive junctions between endothelial ...

Selective Capture of 5-hydroxymethylcytosine from Genomic DNA

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene expression, maintenance of genome integrity, parental imprinting, X-chromosome inactivation, regulation of development, aging, and cancer1. Recently, the presence of an oxidized 5-mC, 5-hydroxymethylcytosine (5-hmC), was discovered in mammalian cells, in particular in embryonic stem (ES) cells and neuronal cells2-4. 5-hmC is generated by oxidation of 5-mC catalyzed by TET family iron (II)/&alpha;-ketoglutarate-dependent dioxygenases2, 3. 5-hmC is proposed to be involved in the maintenance of embryonic stem (mES) cell, normal hematopoiesis and malignancies, and zygote development2, 5-10. To better understand the function of 5-hmC, a reliable and straightforward sequencing system is essential. Traditional bisulfite sequencing cannot distinguish 5-hmC from 5-mC11. To unravel the biology of 5-hmC, we have developed a highly efficient and selective chemical approach to label and capture 5-hmC, taking advantage of a bacteriophage enzyme that adds a glucose moiety to 5-hmC specifically12.
Here we describe a straightforward two-step procedure for selective chemical labeling of 5-hmC. In the first labeling step, 5-hmC in genomic DNA is labeled with a 6-azide-glucose catalyzed by &beta;-GT, a glucosyltransferase from T4 bacteriophage, in a way that transfers the 6-azide-glucose to 5-hmC from the modified cofactor, UDP-6-N3-Glc (6-N3UDPG). In the second step, biotinylation, a disulfide biotin linker is attached to the azide group by click chemistry. Both steps are highly specific and efficient, leading to complete labeling regardless of the abundance of 5-hmC in genomic regions and giving extremely low background. Following biotinylation of 5-hmC, the 5-hmC-containing DNA fragments are then selectively captured using streptavidin beads in a density-independent manner. The resulting 5-hmC-enriched DNA fragments could be used for downstream analyses, including next-generation sequencing.
Our selective labeling and capture protocol confers high sensitivity, applicable to any source of genomic DNA with variable/diverse 5-hmC abundances. Although the main purpose of this protocol is its downstream application (i.e., next-generation sequencing to map out the 5-hmC distribution in genome), it is compatible with single-molecule, real-time SMRT (DNA) sequencing, which is capable of delivering single-base resolution sequencing of 5-hmC.

Described is a two-step labeling process using &beta;-glucosyltransferase (&beta;-GT) to transfer an azide-glucose to 5-hmC, followed by click chemistry to transfer a biotin linker for easy and density-independent enrichment. This efficient and specific labeling method enables enrichment of 5-hmC with extremely low background and high-throughput epigenomic mapping via next-generation sequencing.

Capture d&#39;sélectif de 5-hydroxyméthylcytosine partir de l&#39;ADN génomique

5-methylcytosine (5-mC) constitutes ~2-8% of the total cytosines in human genomic DNA and impacts a broad range of biological functions, including gene ...

Robust 3D DNA FISH Using Directly Labeled Probes

3D DNA FISH has become a major tool for analyzing three-dimensional organization of the nucleus, and several variations of the technique have been published. In this article we describe a protocol which has been optimized for robustness, reproducibility, and ease of use. Brightly fluorescent directly labeled probes are generated by nick-translation with amino-allyldUTP followed by chemical coupling of the dye. 3D DNA FISH is performed using a freeze-thaw step for cell permeabilization and a heating step for simultaneous denaturation of probe and nuclear DNA. The protocol is applicable to a range of cell types and a variety of probes (BACs, plasmids, fosmids, or Whole Chromosome Paints) and allows for high-throughput automated imaging. With this method we routinely investigate nuclear localization of up to three chromosomal regions.

We describe a robust and versatile protocol for analyzing nuclear architecture by 3D DNA FISH using directly labeled fluorescent probes.

Robuste FISH 3D DNA Utilisation des sondes directement marquées

3D DNA FISH has become a major tool for  analyzing three-dimensional organization of the nucleus, and several variations  of the technique have been ...

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) maintain the turnover of all mature blood cell lineages. The coordination of the complex signals leading to specific HSC fates relies upon the interaction between HSCs and the intricate bone marrow microenvironment, which is still poorly understood[1-2].
We describe how by combining a newly developed specimen holder for stable animal positioning with multi-step confocal and two-photon in vivo imaging techniques, it is possible to obtain high-resolution 3D stacks containing HSPCs and their surrounding niches and to monitor them over time through multi-point time-lapse imaging. High definition imaging allows detecting ex vivo labeled hematopoietic stem and progenitor cells (HSPCs) residing within the bone marrow. Moreover, multi-point time-lapse 3D imaging, obtained with faster acquisition settings, provides accurate information about HSPC movement and the reciprocal interactions between HSPCs and stroma cells.
Tracking of HSPCs in relation to GFP positive osteoblastic cells is shown as an exemplary application of this method. This technique can be utilized to track any appropriately labeled hematopoietic or stromal cell of interest within the mouse calvarium bone marrow space.

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

The nature of the interactions between hematopoietic stem and progenitor cells (HSPCs) and bone marrow niches is poorly understood. Custom hardware modifications and a multi-step acquisition protocol allow the use of two-photon and confocal microscopy to image ex vivo labeled HSPCs homed within bone marrow areas, tracking interactions and movement.

In Vivo suivi 4-Dimensional de hématopoïétiques cellules souches et progénitrices adultes dans la voûte du crâne de souris de moelle osseuse

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

Fecal glucocorticoïdes Analyse: Surveillance surrénale non invasive en Equidés

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

High-resolution Time-lapse Imaging and Automated Analysis of Microtubule Dynamics in Living Human Umbilical Vein Endothelial Cells

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes within individual endothelial cells (ECs). These processes are critical for homeostatic maintenance such as wound healing, and are also crucial in promoting tumor growth and metastasis. EC morphology is defined by the organization of the cytoskeleton, a tightly regulated system of actin and microtubule (MT) dynamics that is known to control EC branching, polarity and directional migration, essential components of angiogenesis. To study MT dynamics, we used high-resolution fluorescence microscopy coupled with computational image analysis of fluorescently-labeled MT plus-ends to investigate MT growth dynamics and the regulation of EC branching morphology and directional migration. Time-lapse imaging of living Human Umbilical Vein Endothelial Cells (HUVECs) was performed following transfection with fluorescently-labeled MT End Binding protein 3 (EB3) and Mitotic Centromere Associated Kinesin (MCAK)-specific cDNA constructs to evaluate effects on MT dynamics. PlusTipTracker software was used to track EB3-labeled MT plus ends in order to measure MT growth speeds and MT growth lifetimes in time-lapse images. This methodology allows for the study of MT dynamics and the identification of how localized regulation of MT dynamics within sub-cellular regions contributes to the angiogenic processes of EC branching and migration.

Protocols for Human Umbilical Vein Endothelial Cell (HUVEC) culture, transient transfection of fluorescently-labeled markers of microtubule growth, live-cell imaging and automated analysis of interphase microtubule growth dynamics are detailed.

Haute résolution Time-lapse d&#39;imagerie et d&#39;analyse automatisée des microtubules Dynamics Living ombilicale humaine Cellules endothéliales de veine

The physiological process by which new vasculature forms from existing vasculature requires specific signaling events that trigger morphological changes ...