DNAzyme 10-23 - Based Nanomachines for Nucleic Acid Recognition

Summary

The DNAzyme-based nanomachines can be used for highly selective and sensitive detection of nucleic acids. This article describes a detailed protocol for the design of DNAzyme-based nanomachines with a 10-23 core using free software and their application in the detection of an Epstein-Barr virus fragment as an example.

Abstract

DNAzyme-based nanomachines (DNM) for the detection of DNA and RNA sequences (analytes) are multifunctional structures made of oligonucleotides. Their functions include tight analyte binding, highly selective analyte recognition, fluorescent signal amplification by multiple catalytic cleavages of a fluorogenic reporter substrate, and fluorogenic substrate attraction for an increase in sensor response. Functional units are attached to a common DNA scaffold for their cooperative action. The RNA-cleaving 10-23 DNMs feature improved sensitivity in comparison with non-catalytic hybridization probes. The stability of the DNM and the increased chances of substrate recognition are provided by a double-stranded DNA fragment, a tile. DNM can differentiate two analytes with a single nucleotide difference in a folded RNA and a double-stranded DNA and detect analytes at concentrations ~1000 times lower than other protein-free hybridization probes. This article presents the concept behind the diagnostic potential of DNA-nanomachine activity and overviews DNM design, assembly, and application in nucleic acid detection assays.

Introduction

One of the earliest methods for nucleic acid detection is complementary binding of selective oligonucleotides to the analyzed RNA or DNA sequences. This method employs nucleic acid fragments (probes) that can form Watson-Crick base pairs with a targeted DNA or RNA analyte¹. The complex is then differentiated from the analyte and the unbound probe by a variety of techniques. Certain methods, such as Northern blotting, in situ hybridization, or qPCR, are based on the phenomenon of complementary binding². The most common hybridization probes have two significant drawbacks: low sensitivity (they ....

Protocol

1. DNM design

1. Select a unique region within the genome of interest.
   NOTE: This work uses a region of the Epstein-Barr virus (EBV) genome in positions 13972-14154 (OR652423.1).
2. Create a primer set for the amplification of the selected fragment, for example, via Primer3 tool embedded in Ugene²⁶.
3. Open the UNAFold web tool²⁷ (see Table of Materials) and insert the selected region. Change the .......

Discussion

The design of DNA machines is straightforward but requires some experience in designing hybridization probes or functional DNA nanostructures. It is appropriate to keep the analyte fragment as short as possible to diminish the number of possible secondary structures and simplify DNM invasion to the secondary structure. The CG content should preferably be below 60% to avoid stable intramolecular structures. Successful assembly of the DNM is achieved at slow cooling rates. In some cases, DNMs can be spontaneously asse.......

Materials

Name	Company	Catalog Number	Comments
1.5 mL tube	Biofil	CFT011015
100 bp+ DNA Ladder	Evrogen	NL002
100-1000 µL pipette	Kirgen	KG-Pro1000
10-100 µL pipette	Kirgen	KG-Pro100
1-10 µL pipette	Kirgen	KG-Pro10
20-200 µL pipette	Kirgen	KG-Pro200
2-20 µL pipette	Kirgen	KG-Pro20
4x Gel Loading Dye	Evrogen	PB020
Acrylamide 4K	AppliChem	A1090,0500
Ammonium persulfate	Carl Roth	2809447
Biorender	Biorender		https://www.biorender.com
Bisacrylamide	Molekula	22797959
Boric Acid	TechSnab	H-0202
ChemiDoc imaging system	BioRad	12003153
Costar 96-Well Black Polystyrene Plate	Corning	COS3915
DinaMelt	RNA Institute		http://www.unafold.org/Dinamelt/applications/two-state-melting-hybridization.php
EDTA	Amresco	Am-O105
Ethidium bromide	BioLabMix	EtBr-10
HEPES	Amresco	Am-O485
Magnesium chloride	AppliChem	131396
Mini Protean Tetra Cell	BioRad	1658001EDU
pipette 10 µL tips	Kirgen	KG1111-L
pipette 1000 µL tips	Kirgen	KG1636
pipette 200 µL tips	Kirgen	KG1212-L
Pixelmator Pro	Pixelmator Team		https://www.pixelmator.com/pro/
Potassium chloride	Carl Roth	1782751
PowerPac Basic Power Supply	BioRad	1645050
RNAse/DNAse free water	Invitrogen	10977049
Sealing film for PCR plates	Sovtech	P-502
Sodium chloride	Vekton	HCh (0,1)
Spark multimode microplate reader	Tecan	Spark- 10M
T100 amplificator	BioRad	10014822
TEMED	Molekula	68604730
Tris(hydroxymethyl)aminomethane	Amresco	Am-O497
UNAFold	RNA Institute		http://www.unafold.org/mfold/applications/dna-folding-form.php
Water bath	LOIP	LB-140
Oligos used
Analyte:	Evrogen		direct order, standard desalting purification
GAGCACTTGGTCAGGCACACGG ACAGGGTCAGCGGAGGACGCG TGGCACAGCAGCCCGGGGTAG GTCCCCTGGACCTGCCGCTGG CGGACTACGCCTTCGTTGC
Tile-Arm3:	Evrogen		direct order, standard desalting purification
CCG GGCTGCTGTGCCATTTT TTGCTGACTACTGTCACCTCT CTGCTAGTCT
Dzb-Tile: AGACTAGCAGAGAGGTGACAG TAGTCAGCTTTTTTCGCGTCCTC CGCTGACCACAACGAGAGGAA ACCTT	Evrogen		direct order, standard desalting purification
Dza: TGCCCAGGGAGGCTAGCTCT GTCCGTGTGCCTGACCA	Evrogen		direct order, standard desalting purification
F-sub oligonucleotide: AAGGTT(FAM)TCCTCrGrU CCCTGGGCA-BHQ1	DNA-Syntez		direct order, HPLC purification