È necessario avere un abbonamento a JoVE per visualizzare questo. Accedi o inizia la tua prova gratuita.
The DNAzyme-based nanomachines can be used for highly selective and sensitive detection of nucleic acids. This article describes a detailed protocol for the design of DNAzyme-based nanomachines with a 10-23 core using free software and their application in the detection of an Epstein-Barr virus fragment as an example.
DNAzyme-based nanomachines (DNM) for the detection of DNA and RNA sequences (analytes) are multifunctional structures made of oligonucleotides. Their functions include tight analyte binding, highly selective analyte recognition, fluorescent signal amplification by multiple catalytic cleavages of a fluorogenic reporter substrate, and fluorogenic substrate attraction for an increase in sensor response. Functional units are attached to a common DNA scaffold for their cooperative action. The RNA-cleaving 10-23 DNMs feature improved sensitivity in comparison with non-catalytic hybridization probes. The stability of the DNM and the increased chances of substrate recognition are provided by a double-stranded DNA fragment, a tile. DNM can differentiate two analytes with a single nucleotide difference in a folded RNA and a double-stranded DNA and detect analytes at concentrations ~1000 times lower than other protein-free hybridization probes. This article presents the concept behind the diagnostic potential of DNA-nanomachine activity and overviews DNM design, assembly, and application in nucleic acid detection assays.
One of the earliest methods for nucleic acid detection is complementary binding of selective oligonucleotides to the analyzed RNA or DNA sequences. This method employs nucleic acid fragments (probes) that can form Watson-Crick base pairs with a targeted DNA or RNA analyte1. The complex is then differentiated from the analyte and the unbound probe by a variety of techniques. Certain methods, such as Northern blotting, in situ hybridization, or qPCR, are based on the phenomenon of complementary binding2. The most common hybridization probes have two significant drawbacks: low sensitivity (they ....
1. DNM design
The aim of the first experiment was to show the assembly of the DNM before the synthetic fragment of the analyte. All the constituent DNM strands were added to the reaction buffer and assembled in the beaker. The assembled DNM complex was assessed for its correct size and homogeneity by native PAGE. Native PAGE shows the assembled DNM with the analyte in lane 1 and two DNM strands in lanes 2 and 4. If the DNA nanomachine were not assembled, 2 or 3 separate bands would be visible instead of a single low-mobility.......
The design of DNA machines is straightforward but requires some experience in designing hybridization probes or functional DNA nanostructures. It is appropriate to keep the analyte fragment as short as possible to diminish the number of possible secondary structures and simplify DNM invasion to the secondary structure. The CG content should preferably be below 60% to avoid stable intramolecular structures. Successful assembly of the DNM is achieved at slow cooling rates. In some cases, DNMs can be spontaneously asse.......
The authors would like to thank Ekaterina V. Nikitina for kindly providing gDNA of EBV. Muhannad Ateiah, Maria Y. Berezovskaya, and Maria S. Rubel thank the Ministry of Education and Science of the Russian Federation (Grant No FSER-2022-0009) and the Priority 2030 program.
....Name | Company | Catalog Number | Comments |
1.5 mL tube | Biofil | CFT011015 | |
100 bp+ DNA Ladder | Evrogen | NL002 | |
100-1000 µL pipette | Kirgen | KG-Pro1000 | |
10-100 µL pipette | Kirgen | KG-Pro100 | |
1-10 µL pipette | Kirgen | KG-Pro10 | |
20-200 µL pipette | Kirgen | KG-Pro200 | |
2-20 µL pipette | Kirgen | KG-Pro20 | |
4x Gel Loading Dye | Evrogen | PB020 | |
Acrylamide 4K | AppliChem | A1090,0500 | |
Ammonium persulfate | Carl Roth | 2809447 | |
Biorender | Biorender | https://www.biorender.com | |
Bisacrylamide | Molekula | 22797959 | |
Boric Acid | TechSnab | H-0202 | |
ChemiDoc imaging system | BioRad | 12003153 | |
Costar 96-Well Black Polystyrene Plate | Corning | COS3915 | |
DinaMelt | RNA Institute | http://www.unafold.org/Dinamelt/applications/two-state-melting-hybridization.php | |
EDTA | Amresco | Am-O105 | |
Ethidium bromide | BioLabMix | EtBr-10 | |
HEPES | Amresco | Am-O485 | |
Magnesium chloride | AppliChem | 131396 | |
Mini Protean Tetra Cell | BioRad | 1658001EDU | |
pipette 10 µL tips | Kirgen | KG1111-L | |
pipette 1000 µL tips | Kirgen | KG1636 | |
pipette 200 µL tips | Kirgen | KG1212-L | |
Pixelmator Pro | Pixelmator Team | https://www.pixelmator.com/pro/ | |
Potassium chloride | Carl Roth | 1782751 | |
PowerPac Basic Power Supply | BioRad | 1645050 | |
RNAse/DNAse free water | Invitrogen | 10977049 | |
Sealing film for PCR plates | Sovtech | P-502 | |
Sodium chloride | Vekton | HCh (0,1) | |
Spark multimode microplate reader | Tecan | Spark- 10M | |
T100 amplificator | BioRad | 10014822 | |
TEMED | Molekula | 68604730 | |
Tris(hydroxymethyl)aminomethane | Amresco | Am-O497 | |
UNAFold | RNA Institute | http://www.unafold.org/mfold/applications/dna-folding-form.php | |
Water bath | LOIP | LB-140 | |
Oligos used | |||
Analyte: | Evrogen | direct order, standard desalting purification | |
GAGCACTTGGTCAGGCACACGG ACAGGGTCAGCGGAGGACGCG TGGCACAGCAGCCCGGGGTAG GTCCCCTGGACCTGCCGCTGG CGGACTACGCCTTCGTTGC | |||
Tile-Arm3: | Evrogen | direct order, standard desalting purification | |
CCG GGCTGCTGTGCCATTTT TTGCTGACTACTGTCACCTCT CTGCTAGTCT | |||
Dzb-Tile: AGACTAGCAGAGAGGTGACAG TAGTCAGCTTTTTTCGCGTCCTC CGCTGACCACAACGAGAGGAA ACCTT | Evrogen | direct order, standard desalting purification | |
Dza: TGCCCAGGGAGGCTAGCTCT GTCCGTGTGCCTGACCA | Evrogen | direct order, standard desalting purification | |
F-sub oligonucleotide: AAGGTT(FAM)TCCTCrGrU CCCTGGGCA-BHQ1 | DNA-Syntez | direct order, HPLC purification |
This article has been published
Video Coming Soon