Damos las gracias a James Waters, Gable Wadsworth y Bo Broadwater para la lectura crítica del manuscrito. También agradecemos a cuatro revisores anónimos por proporcionar comentarios útiles. Reconocemos el apoyo financiero del Instituto de Tecnología de Georgia, el premio a la Trayectoria Fondo Burroughs Wellcome en la interfaz de la Ciencia y la concesión de la red de investigación de estudiantes de la NSF Física de Sistemas Vivos.

1. Preparación de la muestra de ADN bicatenario <ol><li> Diseñar ADNs curvas a nivel mundial mediante la repetición de una secuencia de 10-mer. Por ejemplo, 5&#39;-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCC X) 7 - TTTCATTCGAGCTCGTTGTTG-3 &#39;es un ADN curvada 186-pb donde X es una base adicional al azar y la secuencia que flanquea la secuencia de 10-mer repitiendo son secuencias adaptadoras. NOTA: En este ejemplo se seleccionaron dos 10-meros con preferencias opuestas a la formación de nucleosomas en base a un estudio a gran escala de ocupación nucleosoma por Kaplan et al 15.. Desde la repetición helicoidal de ADN de doble cadena es cerca de 10 pb, cualquier desviación neta del eje helicoidal de la 10-mer se acumulan para producir una forma como un arco circular (Figura 3A). Desde el período helicoidal está más cerca de 10,5 pb, una base extra se inserta después de cada dos repeticiones para mantener la estructura curvada como plana como sea posible. Estas secuencias más cortas de 200 pb se pueden pedir a companies que el servicio de síntesis de genes oferta. Es conveniente para flanquear estas secuencias con secuencias adaptadoras comunes para las etapas subsiguientes. El procedimiento se esquematiza en la Figura 3B. </li><li> Lleve a cabo PCR con cebador 1 (GTGCCAGCAACAGATAGC) y cebador 2 (/ 5Cy3/TAAATTCCTACAACAACGAGCTCGAATG). NOTA: Cebador 2 se etiqueta con el Cy3 donante de FRET en el extremo 5 &#39;. Una receta típica PCR y protocolo de ciclos se presentan en las tablas 1 y 2. </li><li> Lleve a cabo PCR con Primer 3 (/ 5BioTEG/GAAACATAG/iCy5/GAATTTACCGTGCCAGCAACAGATAGC) y Primer 4 (CAACAACGAGCTCGAATG). NOTA: Cebador 3 está etiquetado con el aceptor Cy5 FRET a través de la columna vertebral y la biotina-enlazador en el extremo 5 &#39;. Receta PCR y protocolo de ciclos son como anteriormente. </li><li> Purificar los productos de PCR utilizando un kit de limpieza de PCR. </li><li> Mezclar el producto marcado con Cy3 y el producto marcado con Cy5 en un tampón para el intercambio de cadenas (100 mM NaCl, 10 mM de Tris-HCl, pH 7,0, EDTA 1 mM) a concentraciones finales de 0,4 y# 181; M y 0,1 M, respectivamente. NOTA: El exceso de Cy3-ADN aumenta la concentración del dúplex que lleva tanto Cy3 y Cy5 como resultado de la línea de cambio. </li><li> Tipo de hebras por incubación a 98,5 ° C durante 2 min, enfriar gradualmente a 5 ° C con velocidad de rampa de 0,1 º C / seg, e incubando a 5 &#160; ° C durante 2 horas. </li></ol> 2. Electroforesis en gel para detectar ADN de doble cadena Curvatura <ol><li> Verter el gel de poliacrilamida 16,17 mezclando soluciones de acrilamida y bis-acrilamida en relación 29.2:0.8, 5% (w / v) en 1X Tris / borato / EDTA (TBE) tampón a pH 8,0. Nota: 10 ml de solución de gel contiene: 1,217 ml de 40% de acrilamida, 0,667 ml de 2% de bis-acrilamida, 1 ml de TBE 10X, 100 persulfato L de amonio (APS) 10%, 10 L de TEMED, y el resto es dH 2 O. Solidificación completa del gel tarda unos 30 min. </li><li> Cargar el gel de poliacrilamida con muestras de ADN y la escalera de ADN en tampón de carga 1X (5% de glicerol, 0,03% (w / v) de bromofenol BLue) y ejecutar el gel a 5-8 V / cm a 4 ° C durante 45 min o hasta que el frente del colorante se acerca el final del gel. </li><li> Tinción del gel usando tampón TBE 1X que contiene 0,5 g / ml de bromuro de etidio durante 30 min. Identificar las bandas de ADN bajo iluminación UV. Comparar posiciones de las bandas con el marcador de tamaño (100 pb escalera de ADN) para calcular los tamaños aparentes de las moléculas de ADN. NOTA: Curved ADN generalmente se mueven más lento que los ADN rectas. </li></ol> 3. De flujo Preparación de células <ol><li> Perforar 6-7 pares de agujeros a lo largo de dos bordes opuestos de una lámina de vidrio (3&#39;&#39; x 1&#39;&#39;) usando un taladro y brocas de diamante. Después de la perforación, frote la diapositiva de agua que fluye para quitar polvo de vidrio visible. NOTA: Los agujeros sirven como entradas de perfusión y puntos de venta. Durante la perforación, el enfriamiento de la diapositiva con agua es importante para prevenir el agrietamiento. </li><li> Colocar los portaobjetos en posición vertical en un frasco de vidrio y llenarlo con agua. Déjelos en remojo durante 15 min y transferirlos a otro frasco de vidrio dedicated para la limpieza acetona. Rellenar con acetona y déjelos en remojo durante 15 min. Enjuagar los portaobjetos con etanol utilizando una botella de spray y luego con agua. Colóquelos en un recipiente de polipropileno, llenarlo de 5 M de hidróxido de potasio y déjelos en remojo durante 15 min. Por último, sonicar las diapositivas de agua durante 15 min. Limpiar los cubreobjetos (n º 1, 24 x 40 mm) utilizando el mismo protocolo. NOTA: diapositivas y cubreobjetos limpios pueden almacenarse en dH 2 O para el uso a largo plazo. </li><li> Mezclar 1 mg de biotina-PEG-silano (MW 3400) con 80 mg de mPEG-silano (MW 2000) en 340 L de solución de bicarbonato de sodio 0,1 M. Mezclar bien y centrifugar la mezcla brevemente para eliminar las burbujas. NOTA: La funcionalización de la superficie con polietilenglicol (PEG) ayuda a reducir la unión no específica de ADN a la superficie. </li><li> Ponga 80 L de la solución de PEG en cada diapositiva y bajar suavemente un cubreobjetos sobre ella. Espere 45 min. Separe el cubreobjetos de la diapositiva con pinzas, enjuáguelos con abundante cantidad de dH 2 O y dejar que tseco dobladillo al aire libre. </li><li> Coloque tiras delgadas de cinta adhesiva de doble cara en toda la diapositiva para formar canales. Alinear un cubreobjetos sobre ella y presione firmemente el cubreobjetos contra la corredera para formar canales estancos a los líquidos. Utilice 5 minutos epoxi para sellar los bordes de los canales. </li></ol> 4. Preparación de la solución de Trolox <ol><li> Ponga ~ 30 mg Trolox y 10 ml de dH2O en un matraz y usar una barra de agitación imán para agitar la solución al aire libre durante 18 horas. </li><li> Filtrar la solución usando un filtro de 0,2 micras y ajustar el pH a 7 mediante la adición de ~ 6 l de 1 M Tris base (pH 11). Nota: Trolox es un reactivo anti-parpadeo que se utiliza comúnmente en una sola molécula estudia 18. La acción antifading de Trolox proviene de su derivado oxidado que está presente en la solución de Trolox parcialmente degradada 19. Disolviendo rápidamente Trolox en metanol o una solución de Tris pH alto se debe evitar debido a la oxidación ineficiente. </li></ol> 5. Individual-molImaging ecule <ol><li> Inyectar 15 l de solución de NeutrAvidin (0,5 mg / ml) en el canal y esperar durante 2 minutos antes de enjuagar con 100 l de tampón de T50 (10 mM de Tris-HCl, NaCl 50 mM, pH 7,0). </li><li> Inyectar 50 l de muestra de ADN (50-100 pM) en el canal. Esperar 5 minutos y enjuagar el ADN no unido de distancia con 100 L de tampón de T50. NOTA: moléculas de ADN se unirán específicamente a la superficie a través de la interacción biotina-NeutrAvidin. </li><li> Llenar el canal con el buffer de imágenes que contiene un sistema de eliminación de oxígeno 20 (100 mM de PCD, 5 mM de PCA, 1 mM de Trolox, y NaCl 500 mM). </li><li> Ajuste el EMCCD en modo de transferencia de fotogramas para transmitir 2 x 2 imágenes agrupadas (256 x 256) a la computadora a 25 fotogramas por segundo. </li><li> Poner el aceite de inmersión sobre el objetivo del microscopio, y fijar la celda de flujo en la platina del microscopio utilizando clips de muestra. De grano grueso, ajuste el enfoque mirando el patrón de reflexión láser en la pared. Ajuste con precisión el enfoque utilizando la visualización en vivo de fluorescencia imlas edades en el monitor. </li><li> Comience la adquisición de datos con el láser de 532 nm en. Compruebe la vista en vivo y ajuste el enfoque si es necesario. Deje de adquisición de datos cuando la mayoría de las moléculas han photobleached. NOTA: En esta instalación, se utiliza un programa de laboratorio-escrito C para controlar el microscopio y visualizar imágenes en directo en el monitor, ya que se guardan en el disco duro. </li></ol> 6. Procesamiento de imágenes y análisis de datos NOTA: Una serie de tiempo de 256 x 256 imágenes son procesadas por un código de MATLAB para generar una sola molécula de rastros de tiempo de Cy3 y Cy5 intensidades. Para emparejar píxeles entre el canal de donante y el canal aceptor de la imagen de vista dividida, 6-7 pares de Cy3 y Cy5 manchas, cada par de la misma molécula uniformemente dispersado a través del campo de vista, son recogidos manualmente, y una transformación afín se calcula utilizando las coordenadas de estos lugares como puntos de anclaje. <ol><li> El uso de un script de MATLAB, mirar a través de todos los tiempos de una sola molécula traza tsombrero muestran múltiples transiciones entre las señales de baja y alta traste. Identificar los estados en bucle y unlooped. NOTA: La señal de FRET se define como la intensidad de Cy5 (I a) dividido por la suma de Cy3 y Cy5 intensidades (I A + Id). Estado en bucle tiene un alto valor FRET mientras que el estado unlooped tiene valor bajo FRET. El histograma de las señales de FRET de una sola molécula se distribuye bimodal porque de bucle reversible y unlooping. </li><li> Encontrar el umbral que separa las dos distribuciones mediante la determinación de la intersección entre las dos curvas gaussianas armarios. </li><li> Calcular la eficiencia de FRET como <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq7.jpg" /> y asignar los estados en bucle con altos valores de FRET y los estados unlooped con valores bajos de FRET. </li><li> El uso de un script de MATLAB, analizar el número acumulado de moléculas (N (t)) que en bucle (oalcanzado el estado alto FRET) en diferentes lapsos de tiempo desde el inicio de la adquisición de datos. NOTA: Dado que una molécula de ADN de doble cadena puede iniciar en cualquier conformación del estado unlooped en el inicio de adquisición de datos, la tasa de aumento en la población en bucle refleja la tasa de bucle medios promediados sobre conformaciones iniciales. Extraer el bucle tasa de bucle K mediante el ajuste de N (t) con una función exponencial: <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq1.jpg" /> Si aumenta bifásica, que puede ser equipado con una función doble exponencial: <img fo:content-width="2.2in" src="/files/ftp_upload/51667/eq2.jpg" /> En este caso, el bucle k se obtiene a partir de: <img fo:content-width="1.7in" src="/files/ftp_upload/51667/eq3.jpg" /> NOTA: En teoría, la probabilidad de supervivencia que un polímero no ha enrollado en el tiempo t no es un simple o doble función exponencial 12. Fitt Exponencialción se utiliza como un medio práctico para extraer el promedio de tiempo de bucle. </li></ol> 7. Determinación del factor J NOTA: El factor J representa cómo concentrada uno de los extremos de un ADN de doble cadena es alrededor del otro extremo. Se puede determinar por interpolación la concentración de un segmento extremo del ADN que produciría la misma velocidad de reacción con el otro segmento final como la tasa de bucle medido. Experimentalmente, un segmento extremo está inmovilizado sobre la superficie, y el otro segmento extremo se introduce a una cierta concentración c. Si la tasa de recocido medida entre los dos extremos es k recocido, entonces el factor de J 21 está dada por <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq4.jpg" /> . La constante de velocidad de recocido (k = k recocido recocido / C) es independiente de la concentración de la sonda. <ol><li> Caudal 20 l de 30-50 pM biotina-Cy5 oligo (Primer 3) iONT un canal recubierto de NeutrAvidin. Enjuague el canal con 100 l T50 para lavar oligos no consolidados. </li><li> Preparar el tampón de formación de imágenes tal como se describe en la parte 5 con la adición de Cy3 oligo (cebador 2) a una concentración final de 50 nM. Este flujo de buffer de imágenes en el canal. </li><li> Mientras se mantiene el láser 532 nm, gire brevemente el láser de 640 nm a identificar la ubicación de la superficie determinada Cy5 oligos. Apague el láser de 640 nm y empezar a monitorizar la señal de FRET. NOTA: Tras la hibridación de un oligo Cy3 a un Cy5 oligonucleótido unido a la superficie, Cy5 fluorescencia surgirá de FRET. </li><li> El uso de un script de MATLAB, analizar el número de moléculas que comienzan en el estado no ligado (baja intensidad de Cy5), pero más tarde se convierten en el estado (alta intensidad de Cy5) recocido como una función del tiempo a partir de los restos de intensidad Cy5. </li><li> Trace ese número de moléculas en función del tiempo de recocido. Ajuste esta curva con una sola función exponencial ( <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq5.jpg"/&gt;) Para obtener la tasa de recocido (k recocido). </li><li> Repita este experimento a diferentes concentraciones Cy3 oligo (60, 100, y 180 nm) para confirmar la linealidad entre la tasa de recocido y la concentración de reactivo. Extracto de la constante de velocidad de recocido de segundo orden (k recocido ) A partir de la pendiente. </li><li> Calcular el factor J de <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq6.jpg" /> , Donde bucle k es la tasa de bucle medido en las mismas condiciones tampón. </li></ol>

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

Los autores declaran no tener ningún conflicto de intereses.

Se utilizó un ensayo simple de una sola molécula basado en FRET para estudiar la cinética de bucle de ADN de diferentes formas intrínsecas. ADNs curvados se pueden preparar mediante la repetición de una secuencia de 10-mer, en fase con el período helicoidal de 10,5 pb, y sus curvaturas pueden ser estimados utilizando la página. Estos dsDNAs están diseñados con extremos pegajosos para permitir la estabilización transitoria de bucle. Se extrajo la tasa de bucle desde el aumento exponencial en el número de molé...

La comprensión de las propiedades mecánicas de ADN de doble cadena es de importancia fundamental en las ciencias básicas y aplicaciones de ingeniería. La estructura de ADN de doble cadena es más complicado que una escalera helicoidal recto debido ángulos de balanceo, inclinación y giro entre pares de bases sucesivas pueden variar con la secuencia. Fluctuaciones térmicas pueden provocar dsDNA a someterse a diversos modos de fluctuaciones conformacionales como la flexión, torsión y estiramiento. Transiciones de fusión tales como el retorcimiento y también pueden ocurrir en condiciones extremas. Entre estos movimientos, dsDNA flexión tiene el impacto biológico más sensible 1. ADN de doble cadena de flexión está asociada con la represión de genes o la activación por la unión de dos sitios distantes cerca uno del otro. También juega un papel importante en el empaquetamiento del ADN dentro del núcleo de la célula o de una cápside viral. Deformación por flexión de ADN de doble cadena se puede visualizar experimentalmente por microscopía de alta resolución (AFM 2 y TEM 3), y la Thermodynamics y cinéticas pueden ser estudiadas mediante ensayos de bucle, que enlazan químicamente sitios yuxtapuestos del ADN de doble cadena. Uno de tales ensayos es ligasa dependiente de ciclación 4. En este ensayo, las moléculas de ADN de doble cadena con extremos &#39;pegajosos&#39; (cohesivos) se circularized o dimerizados por ADN ligasa. Mediante la comparación de las tasas de círculo y la formación de dímero, se puede obtener una concentración molar eficaz de uno de los extremos del ADN en la proximidad del otro extremo, que se conoce como el factor de J. Este factor J es dimensionalmente equivalente a la densidad de probabilidad de encontrar un extremo del ADN a una distancia corta desde el otro extremo, y por lo tanto refleja la flexibilidad del ADN. Medir el factor de J como una función de la longitud del ADN revela muchas características acerca de la mecánica de ADN incluyendo el 4,5 longitud de persistencia. La cadena de gusano-como modelo (WLC) ha sido ampliamente considerado como el modelo canónico de polímero para la mecánica dsDNA en función de su éxito en la explicaciónnando las curvas fuerza-extensión obtenidos en el ADN tirando experimentos 6 y predecir correctamente los factores de J dsDNAs más de 200 pb 7. Sin embargo, usando el ensayo de ciclación en las moléculas de ADN de doble cadena tan cortos como 100 pb, Cloutier y Widom midieron los factores J ser varios órdenes de magnitud mayor que la predicción del modelo WLC 8. Un año más tarde, Du et al. producido J factores de acuerdo con el modelo WLC usando el ensayo de ciclación con concentraciones más bajas de ligasa y atribuido el resultado anómalo del grupo Widom a concentraciones altas ligasa utilizada 9. Esta controversia es un ejemplo de la influencia inevitable de la ADN ligasa en la cinética de ciclación cuando se utiliza el ensayo convencional 9. Por otra parte, la ligasa de ADN también puede afectar a la estructura del ADN y la rigidez a través inespecífica 10,11 vinculante. Para eliminar los problemas técnicos de los ensayos de bucles de proteínas dependientes, hemos demostrado una protensayo de bucle ein-gratuito basado en energía de resonancia fluorescente Transfer (FRET) 12. En este método, las conformaciones en bucle se detectan por FRET entre el donante y aceptor unido cerca de los extremos pegajosos de una molécula de ADN. Un microscopio de fluorescencia de reflexión total interna de tipo objetivo (TIRFM) se utiliza para registrar las trayectorias de bucle reversible y eventos unlooping de moléculas individuales de ADN inmovilizado en la superficie por un período de tiempo prolongado. Este método cuenta con el montaje basado en la PCR de moléculas de ADN para generar moléculas de ADN-desajuste libre, que es una mejora crucial en un método similar por Vafabakhsh y Ha 13. El aspecto de una sola molécula de este protocolo permite la medición de distribuciones en adición a Ensemble promedios mientras que el aspecto de FRET permite medir la dinámica de bucle de ADN repetidamente de la misma molécula, incluso en condiciones que pueden afectar la actividad ligasa. La configuración TIRFM se muestra en la Figura 1. Una costumbrePlatina de diseño se coloca sobre un cuerpo del microscopio Olympus IX61. 532 nm y 640 nm láser se introducen desde el lado y son reflejados por espejos diminutos elípticas 14 en el alta NA objetivo de lograr ángulo crítico de incidencia en la interfaz agua-cubreobjetos. Observamos que más generalizada-a través de objetivo TIR utilizando espejos dicroicos o configuraciones de TIR a base de prisma también se puede utilizar para esta aplicación de FRET. La imagen de fluorescencia formado por el microscopio se divide en donante y aceptor de imágenes por un espejo dicroico. Ellos se vuelven a reflejados en dos mitades de una EMCCD. Filtros de emisión de paso de largo adicionales se utilizan para reducir la señal de fondo. El control de temperatura es esencial para la adquisición de los datos cinéticos reproducibles. Para el control de la temperatura, el objetivo se separa de la pieza de nariz del cuerpo del microscopio para minimizar la transferencia de calor, y el agua de un enfriador controlada / calentador de la temperatura se hace circular a través de un collar de latón que encaja herméticamentealrededor del metal interior debajo de la chaqueta objetivo. Esta configuración es capaz de alcanzar control de la temperatura robusta en la superficie cubreobjetos entre 15 y 50 ° C (Figura 2). En este trabajo, la temperatura de la muestra se mantuvo a 24 ° C. El protocolo siguiente se presenta el procedimiento paso a paso para la construcción de ADN, la estimación de la forma de ADN, el experimento de una sola molécula, y la determinación del factor J.

<table border="0" cellpadding="0" cellspacing="0" width="793">
	<tbody>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Small DNA FRAG Extract Kit-100PR</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97060-558</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Acrylamide 40% solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97064-522</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Bis-acrylamide 2% (w/v) solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97063-948</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">GeneRuler 100 bp DNA Ladder, 100-1000 bp</td>
			<td style="width:124px;">Fermentas</td>
			<td>SM0241</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Mini Vertical PAGE System</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">89032-300</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Syringe filter 0.2um CS50</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Trolox</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">238813-1G</td>
			<td>triplet state quencher</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuic acid (PCA)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">08992-50MG</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuate 3,4-Dioxygenase (PCD)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">P8279-25UN</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">mPEG-silane, MW 2000 1g</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">MPEG-SIL-2000-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Biotin-PEG-Silane, MW 3400</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">Biotin-PEG-SIL-3400-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Avidin, NeutrAvidin Biotin-binding Protein</td>
			<td style="width:124px;">Invitrogen</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Phusion Hot Start High-Fidelity DNA Polymerase</td>
			<td style="width:124px;">New England Biolabs</td>
			<td style="width:135px;">F-540L</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Gel/PCR DNA Fragments Extraction Kit</td>
			<td>IBI Scientific</td>
			<td>IB47020</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Premium plain glass microscope slides</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;">12-544-1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">VWR micro cover glass, rectangular, no. 1</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">48404-456</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fisher Scientific Isotemp 1006s Recirculating Chiller/Heater</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;"></td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective Cooling Collar</td>
			<td style="width:124px;">Bioptechs</td>
			<td style="width:135px;">150303</td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">KMI53 Biological Micrometer Measuring Stage</td>
			<td style="width:124px;">Semprex</td>
			<td style="width:135px;">KMI53</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">High Performance DPSS Laser 532nm 50mW&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">NT66-968</td>
			<td>Cy3 excitation</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:351px;">CUBE Fiber Pigtailed 640 nm, 30mW, Fiber, FC/APC Connector</td>
			<td style="width:124px;">Coherent</td>
			<td style="width:135px;">1139604</td>
			<td>Cy5 excitation</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">650 nm BrightLine Dichroic Beamsplitter</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">FF650-Di01-25x36</td>
			<td>splitting dichroic</td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:351px;">LaserMUX Beam Combiner, reflects 514.5, 532, &#38; 543.5 nm lasers, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">LM01-552-25</td>
			<td>combining dichroic</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Brightline Fluorescence Filter 593/40</td>
			<td style="width:124px;">Semrock</td>
			<td>FF01-593/40-25</td>
			<td>Cy3 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">635 nm EdgeBasic LWP longpass Filter, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">BLP01-635R-25</td>
			<td>Cy5 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">EMCCD iXon+</td>
			<td style="width:124px;">Andor Technology</td>
			<td style="width:135px;">DU-897E-CS0-#BV</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">IX51 inverted microscope frame</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective UApo N 100x/1.49 Oil TIRF</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Immersion oil type-F for fluorescence microscopy</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;">IMMOIL-F30CC</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">2mm Diameter 45&#176; Rod Lens Aluminum Coated&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">54-092</td>
			<td>miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">1/4&#34; Travel Single-Axis Translation Stage</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">MS-1</td>
			<td>translation of miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">&#216;1&#34; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-200-A</td>
			<td>focusing lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Adjustable Mechanical Slit</td>
			<td style="width:124px;">Thorlabs</td>
			<td>VA100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dielectric Mirror</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">BB1-E02</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">&#216;1&#34; Achromatic Doublet, f = 100 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-100-A</td>
			<td>relay lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Lens Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LMR1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dichroic Filter Mount</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">FFM1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fixed Cage Cube Platform</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">B3C</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Kinematic Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">KM100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lens, &#216;1&#34;, f = 40 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1422-A</td>
			<td>collimating lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 15 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1222-A</td>
			<td>telescope lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 150 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1433-A</td>
			<td>telescope lens</td>
		</tr>
	</tbody>
</table>

studying dna looping by single-molecule fret

De flexión de ADN de doble cadena (dsDNA) se asocia con muchos procesos biológicos importantes, tales como el reconocimiento de DNA-proteína y el empaquetamiento del ADN en nucleosomas. Termodinámica de ADN de doble cadena de flexión se ha estudiado mediante un método denominado ciclación que se basa en la ADN ligasa para unir covalentemente los extremos pegajosos cortos de un ADN de doble cadena. Sin embargo, la eficiencia de la ligadura puede verse afectada por muchos factores que no están relacionados con dsDNA bucle tales como la estructura del ADN que rodea los extremos pegajosos unidas, y ligasa también puede afectar a la velocidad de bucle evidente a través de mecanismos tales como la unión no específica. Aquí, se muestra la forma de medir la cinética de bucle de ADN bicatenario sin ligasa mediante la detección de la formación de bucle de ADN transitoria por FRET (transferencia de energía de resonancia fluorescente). moléculas de ADN de doble cadena se construyen usando un simple protocolo basado en PCR con un par de FRET y un enlazador biotina. La densidad de probabilidad de bucle conocido como el factor de J se extrae de la tasa de bucle y la tasa de recocido entre dos desconexiónted extremos pegajosos. Al poner a prueba dos dsDNAs con diferentes curvaturas intrínsecas, se muestra que el factor J es sensible a la forma intrínseca de la ADN de doble cadena.

Moléculas de ADN utilizados para el estudio de bucle consisten en una región dúplex de la secuencia y longitud variables y salientes monocatenarios que son complementarios entre sí. Los salientes, que son 7 bases de longitud, pueden hibridar entre sí para capturar el estado de bucle. Cada saliente contiene ya sea Cy3 o Cy5 que está vinculado en la columna vertebral del ADN a través de la química amidita. El Cy5-alero también está vinculado con biotina-TEG (15-átomo de Tetra-etilenglicol espaciador) para la in...

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

Este estudio presenta un procedimiento experimental detallado para medir la dinámica de bucle de ADN de doble cadena utilizando una sola molécula de transferencia de energía de resonancia fluorescente (FRET). El protocolo también se describe cómo extraer la densidad de probabilidad de bucle llamado factor J.

El estudio de ADN Looping por FRET sola molécula

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

studying-dna-looping-by-single-molecule-fret

Research

JoVE Journal

Biology

15.3K vistas.  Georgia Institute of Technology.  Este estudio presenta un procedimiento experimental detallado para medir la dinámica de bucle de ADN de doble cadena utilizando una sola molécula de transferencia de energía de resonancia fluorescente (FRET). El protocolo también se describe cómo extraer la densidad de probabilidad de bucle llamado factor J. 

Video: Studying DNA Looping by Single-Molecule FRET

Single Molecule Methods for Monitoring Changes in Bilayer Elastic Properties

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein interactions and more general lipid bilayer-protein interactions. These interactions are particularly important in pharmacological research, as many current pharmaceuticals on the market can alter the lipid bilayer material properties, which can lead to altered membrane protein function.   The formation of gramicidin channels are dependent on conformational changes in gramicidin subunits which are in turn dependent on the properties of the lipid.  Hence the gramicidin channel  current is a reporter of altered properties of the bilayer due to certain compounds.  

Membrane protein function is regulated by the cell membrane lipid composition. This video-article details how to form a patch using bilayer patch electrodes, as well as how to use gramicidin channels as reporters of altered membrane properties.

Métodos de una sola molécula para vigilar los cambios en las propiedades elásticas bicapa

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein ...

Investigación

Biología

Combining QD-FRET and Microfluidics to Monitor DNA Nanocomplex Self-Assembly in Real-Time

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically functional inside the cell, nucleic acid-based therapeutics require an efficient intracellular delivery system. One widely adopted approach is to complex DNA with a gene carrier to form nanocomplexes via electrostatic self-assembly, facilitating cellular uptake of DNA while protecting it against degradation. The challenge lies in the rational design of efficient gene carriers, since premature dissociation or overly stable binding would be detrimental to the cellular uptake and therapeutic efficacy. Nanocomplexes synthesized by bulk mixing showed a diverse range of intracellular unpacking and trafficking behavior, which was attributed to the heterogeneity in size and stability of nanocomplexes. Such heterogeneity hinders the accurate assessment of the self-assembly kinetics and adds to the difficulty in correlating their physical properties to transfection efficiencies or bioactivities. We present a novel convergence of nanophotonics (i.e. QD-FRET) and microfluidics to characterize the real-time kinetics of the nanocomplex self-assembly under laminar flow. QD-FRET provides a highly sensitive indication of the onset of molecular interactions and quantitative measure throughout the synthesis process, whereas microfluidics offers a well-controlled microenvironment to spatially analyze the process with high temporal resolution (~milliseconds). For the model system of polymeric nanocomplexes, two distinct stages in the self-assembly process were captured by this analytic platform. The kinetic aspect of the self-assembly process obtained at the microscale would be particularly valuable for microreactor-based reactions which are relevant to many micro- and nano-scale applications. Further, nanocomplexes may be customized through proper design of microfludic devices, and the resulting QD-FRET polymeric DNA nanocomplexes could be readily applied for establishing structure-function relationships. 

We present a novel and powerful integration of nanophotonics (QD-FRET) and microfluidics to investigate the formation of polyelectrolyte polyplexes, which is expected to provide better control and synthesis of uniform and customizable polyplexes for future nucleic acid-based therapeutics.

La combinación de QD-FRET y microfluídica para monitorear Nanocomplex ADN auto-ensamblado en tiempo real

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically ...

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides (Figure 1). The growing product double-strand DNA (dsDNA) is extended with laminar flow and visualized by using an intercalating dye. Measuring the position of the growing DNA end in real time allows precise determination of replication rate (Figure 2). Furthermore, the length of completed DNA products reports on the processivity of replication. This experiment can be performed very easily and rapidly and requires only a fluorescence microscope with a reasonably sensitive camera.


This protocol demonstrates a simple single-molecule fluorescence microscopy technique for visualizing DNA replication by individual replisomes in real time.

Visualización de una sola molécula de ADN de replicación con microscopía de fluorescencia

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

Sistema Automatizado de Soltero mediciones de fluorescencia de la molécula de superficie inmovilizada Biomoléculas

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. Linearized &lambda; DNA is modified to have a biotin on the end of one strand, and a digoxigenin moiety on the other end of the same strand. The biotinylated end is attached to a functionalized glass coverslip and the digoxigeninated end to a small bead. The assembly of these DNA-bead tethers on the surface of a flow cell allows a laminar flow to be applied to exert a drag force on the bead. As a result, the DNA is stretched close to and parallel to the surface of the coverslip at a force that is determined by the flow rate (Figure 1). The length of the DNA is measured by monitoring the position of the bead. Length differences between single- and double-stranded DNA are utilized to obtain real-time information on the activity of the replication proteins at the fork. Measuring the position of the bead allows precise determination of the rates and processivities of DNA unwinding and polymerization (Figure 2).

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system.

La observación directa de ADN Enzimas Replicar El uso de un ADN de una sola molécula de estiramiento de ensayo

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

Single-Molecule Imaging of Nuclear Transport

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the last decade. The investigation of molecular interactions with high temporal and spatial resolutions deep within cells has remained challenging due to the inherently weak signals arising from individual molecules. Recent works by Yang et al. demonstrated that narrow-field epifluorescence microscopy allows visualization of nucleocytoplasmic transport at the single molecule level. By the single molecule approach, important kinetics, such as nuclear transport time and efficiency, for signal-dependent and independent cargo molecules have been obtained. Here we described a protocol for the methodological approach with an improved spatiotemporal resolution of 0.4 ms and 12 nm. The improved resolution enabled us to capture transient active transport and passive diffusion events through the nuclear pore complexes (NPC) in semi-intact cells. We expect this method to be used in elucidating other binding and trafficking events within cells.

Single molecule microscopy approch provided novel insights into nuclear transport.

Imagen de una sola molécula de transporte nuclear

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the ...

Monitoring Kinase and Phosphatase Activities Through the Cell Cycle by Ratiometric FRET

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such probes typically consist of variants of CFP and YFP, intervened by a phosphorylatable sequence and a phospho-binding domain. Upon phosphorylation, the probe changes conformation, which results in a change of the distance or orientation between CFP and YFP, leading to a change in FRET efficiency (Fig 1). Several probes have been published during the last decade, monitoring the activity balance of multiple kinases and phosphatases, including reporters of PKA2, PKB3, PKC4, PKD5, ERK6, JNK7, Cdk18, Aurora B9 and Plk19. Given the modular design, additional probes are likely to emerge in the near future10. 
Progression through the cell cycle is affected by stress signaling pathways 11. Notably, the cell cycle is regulated differently during unperturbed growth compared to when cells are recovering from stress12.Time-lapse imaging of cells through the cell cycle therefore requires particular caution. This becomes a problem particularly when employing ratiometric imaging, since two images with a high signal to noise ratio are required to correctly interpret the results. Ratiometric FRET imaging of cell cycle dependent changes in kinase and phosphatase activities has predominately been restricted to sub-sections of the cell cycle8,9,13,14.
Here, we discuss a method to monitor FRET-based probes using ratiometric imaging throughout the human cell cycle. The method relies on equipment that is available to many researchers in life sciences and does not require expert knowledge of microscopy or image processing.

FRET-based reporters are increasingly used to monitor kinase and phosphatase activities in live cells. Here we describe a method on how to use FRET-based reporters to assess cell cycle-dependent changes in target phosphorylation.

Seguimiento de las actividades de quinasa y fosfatasa través del ciclo celular por Proporcional FRET

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such ...

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage (CoTrAC)

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method makes it possible to count the numbers of protein molecules produced in one cell during sequential, five-minute time windows. It requires a fluorescence microscope with laser excitation power density of ~0.5 to 1 kW/cm2, which is sufficiently sensitive to detect single fluorescent protein molecules in live cells. The fluorescent reporter used in this method consists of three parts: a membrane targeting sequence, a fast-maturing, yellow fluorescent protein and a protease recognition sequence. The reporter is translationally fused to the N-terminus of a protein of interest. Cells are grown on a temperature-controlled microscope stage. Every five minutes, fluorescent molecules within cells are imaged (and later counted by analyzing fluorescence images) and subsequently photobleached so that only newly translated proteins are counted in the next measurement.
Fluorescence images resulting from this method can be analyzed by detecting fluorescent spots in each image, assigning them to individual cells and then assigning cells to cell lineages. The number of proteins produced within a time window in a given cell is calculated by dividing the integrated fluorescence intensity of spots by the average intensity of single fluorescent molecules. We used this method to measure expression levels in the range of 0-45 molecules in single 5 min time windows. This method enabled us to measure noise in the expression of the &lambda; repressor CI, and has many other potential applications in systems biology.

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage CoTrAC

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC), to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method has been used to follow the stochastic expression dynamics of a transcription factor, the &lambda; repressor CI 1.

Una sola molécula de imágenes del Reglamento Gene<em&gt; En vivo</em&gt; Utilización de la activación cotraduccional por escisión (COTRAC)

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells ...

Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable.

Here we describe the instrumentation and methods for detecting single fluorescently-labeled protein molecules interacting with a single DNA molecule suspended between two optically trapped microspheres.

Combinando Manipulación sola molécula y de imagen para el estudio de las interacciones proteína-ADN

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method ...

FRET Imaging in Three-dimensional Hydrogels

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly employ two-dimensional (2D) culture, which does not mimic the three-dimensional (3D) cellular microenvironment. A method to perform quenched emission FRET imaging using conventional widefield epifluorescence microscopy of cells within a 3D hydrogel environment is presented. Here an analysis method for ratiometric FRET probes that yields linear ratios over the probe activation range is described. Measurement of intracellular cyclic adenosine monophosphate (cAMP) levels is demonstrated in chondrocytes under forskolin stimulation using a probe for EPAC1 activation (ICUE1) and the ability to detect differences in cAMP signaling dependent on hydrogel material type, herein a photocrosslinking hydrogel (PC-gel, polyethylene glycol dimethacrylate) and a thermoresponsive hydrogel (TR-gel). Compared with 2D FRET methods, this method requires little additional work. Laboratories already utilizing FRET imaging in 2D can easily adopt this method to perform cellular studies in a 3D microenvironment. It can further be applied to high throughput drug screening in engineered 3D microtissues. Additionally, it is compatible with other forms of FRET imaging, such as anisotropy measurement and fluorescence lifetime imaging (FLIM), and with advanced microscopy platforms using confocal, pulsed, or modulated illumination.

F&#246;rster resonance energy transfer (FRET) imaging is a powerful tool for real-time cell biology studies. Here a method for FRET imaging cells in physiologic three-dimensional (3D) hydrogel microenvironments using conventional epifluorescence microscopy is presented. An analysis for ratiometric FRET probes that yields linear ratios over the activation range is described.

FRET Imaging en hidrogeles tridimensionales

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly ...