אנו מודים לג&#39;יימס ווטרס, גייבל Wadsworth ובי Broadwater לקריאה ביקורתי של כתב היד. אנו מודים גם לארבעה מבקרים האנונימיים על מתן הערות מועילות. אנו מכירים תמיכה כספית מהמכון הטכנולוגי של ג&#39;ורג&#39;יה, פרס הקריירה בורוז Wellcome הקרן בממשק המדעי, ומענק רשת מחקר הסטודנט מNSF הפיזיקה של מערכות חיים.

1. לדוגמא הכנה dsDNA <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> עיצוב DNAs מעוקל ברחבי העולם על ידי חזרה על רצף 10-Mer. לדוגמא, 5&#39;-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCC X) 7 - TTTCATTCGAGCTCGTTGTTG-3 &quot;הוא ה-DNA 186-bp מעוקלת כאשר X הוא בסיס נוסף אקראי ורצף איגוף רצף 10-mer החוזר הם רצפי מתאם. הערה:. בדוגמא זו שני 10 מרס עם העדפות הפוכות להיווצרות הנוקלאוזום מבוססות על מחקר תפוסת הנוקלאוזום בקנה מידה גדולה על ידי קפלן ואח&#39; 15 נבחרו. מאז חוזר הסליל של dsDNA הוא קרוב ל10 נ&quot;ב, כל סטיה נקי של ציר הסליל של 10-mer תצטבר לייצר צורה כמו קשת עגולה (איור 3 א). מאחר שתקופת הסליל היא קרובה יותר ל10.5 נ&quot;ב, בסיס נוסף מוכנס אחרי כל שתי חזרות כדי לשמור על המבנה המעוגל כמישוריים ככל האפשר. ניתן להזמין ברצפים אלה קצרים יותר מאשר 200 נ&quot;ב מcompanieים ששירות סינתזת גן ההצעה. זה נוח לאגף רצפים אלה עם רצפי מתאם משותפים לשלבים הבאים. הליך schematized באיור 3. </li><li style=";text-align:right;direction:rtl"> לבצע PCR עם 1 פריימר (GTGCCAGCAACAGATAGC) ופריימר 2 (/ 5Cy3/TAAATTCCTACAACAACGAGCTCGAATG). הערה: פריימר 2 מתויג עם Cy3 תורם סריג בסוף &quot;5. מתכון PCR טיפוסי ופרוטוקול רכיבה על אופניים מוצגים בלוחות 1 ו -2. </li><li style=";text-align:right;direction:rtl"> לבצע PCR עם פריימר 3 (/ 5BioTEG/GAAACATAG/iCy5/GAATTTACCGTGCCAGCAACAGATAGC) ו -4 פריימר (CAACAACGAGCTCGAATG). הערה: פריימר 3 מתויג עם Cy5 acceptor סריג דרך עמוד השדרה וביוטין-מקשר בסוף &quot;5. מתכון PCR ופרוטוקול רכיבה על אופניים הם כאמור לעיל. </li><li style=";text-align:right;direction:rtl"> לטהר את מוצרי ה-PCR באמצעות ערכת ניקוי ה-PCR. </li><li style=";text-align:right;direction:rtl"> מערבבים את המוצר שכותרתו Cy3 ומוצר שכותרתו Cy5 בחיץ להחלפת גדיל (100 mM NaCl, 10 מ&quot;מ טריס-HCl pH 7.0, 1 mM EDTA) בריכוזים סופיים של 0.4 &amp;181 #; M ו0.1 מיקרומטר, בהתאמה. הערה: Cy3-DNA העודף מגביר את הריכוז של דופלקס ביצוע שני Cy3 וCy5 כתוצאה מחילופי גדיל. </li><li style=";text-align:right;direction:rtl"> קווצות שערי על ידי דוגרים על 98.5 מעלות צלזיוס למשך 2 דקות, קירור בהדרגה עד 5 מעלות צלזיוס עם שיעור רמפה של 0.1 ° C / sec, ודוגר על 5 &#160; ° C למשך 2 שעות. </li></ol> 2. ג&#39;ל אלקטרופורזה לזיהוי dsDNA עקמומיות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> יוצקים את הג&#39;ל polyacrylamide 16,17 על ידי ערבוב acrylamide ופתרונות bis-acrylamide ב29.2:0.8 יחס, 5% (w / v) במאגר 1X טריס / Borate / EDTA (TBE) ב-pH 8.0. הערה: 10 מיליליטר של תמיסת ג&#39;ל מכיל: 1.217 acrylamide מיליליטר 40%, 0.667 מיליליטר 2% bis-acrylamide, 1 מיליליטר TBE 10X, 100 persulfate אמוניום L (APS) 10%, 10 L TEMED, וכל השאר הוא DH 2 O. התמצקות מלאה של הג&#39;ל לוקחת בערך 30 דקות. </li><li style=";text-align:right;direction:rtl"> טען את ג&#39;ל polyacrylamide עם דגימות DNA וסולם ה-DNA בחיץ טעינת 1X (5% גליצרול, 0.03% (w / v bl bromophenol)UE) ולהפעיל את הג&#39;ל על 5-8 V / סנטימטר ב-C ° 4 דקות 45 או עד שצבען הקדמי מתקרב לסוף של הג&#39;ל. </li><li style=";text-align:right;direction:rtl"> כתם ג&#39;ל באמצעות חיץ 1X TBE המכיל 0.5 גר &#39;/ מיליליטר ethidium ברומיד ל30 דקות. זהה את להקות ה-DNA תחת תאורת UV. שקלו את עמדות להקה עם סמן הגודל (100 סולם DNA נ&quot;ב) כדי לחשב את הגדלים, לכאורה, של מולקולות ה-DNA. הערה: DNAs המעוקל בדרך כלל איטי יותר מאשר להעביר DNAs הישר. </li></ol> 3. זרימת הכנת תא <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מקדחה 6-7 זוגות של חורים בשני קצוות מנוגדים של שקופיות זכוכית (3&#39;&#39; x 1&#39;&#39;) באמצעות מקדחה ומקדחי יהלום. לאחר קידוח, לשפשף את השקופית במים זורמים כדי להסיר אבקת זכוכית גלויה. הערה: החורים משמשים כפתחי כניסת זלוף ושקעים. במהלך קידוח, קירור השקופית עם מים חשוב כדי למנוע פיצוח. </li><li style=";text-align:right;direction:rtl"> מניחים את השקופיות זקופות בצנצנת זכוכית ולמלא אותו במים. Sonicate במשך 15 דקות ולהעביר אותם לעוד דה צנצנת זכוכיתdicated לניקוי אצטון. מלא אותו עם אצטון sonicate במשך 15 דקות. יש לשטוף את השקופיות עם אתנול באמצעות בקבוק תרסיס ולאחר מכן עם מים. למקם אותם בצנצנת פוליפרופילן, למלא אותו עם 5 הידרוקסיד M אשלגן, sonicate במשך 15 דקות. לבסוף, sonicate השקופיות במים במשך 15 דקות. נקה את coverslips (מס &#39;1, 24 x 40 מ&quot;מ) משתמש באותו פרוטוקול. הערה: שקופיות וcoverslips ניקה יכולים להיות מאוחסנים ב DH 2 O לשימוש לטווח ארוך. </li><li style=";text-align:right;direction:rtl"> מערבבים 1 מ&quot;ג של ביוטין-PEG-silane (MW 3400) עם 80 מ&quot;ג של MPEG-silane (MW 2000) ב340 L של 0.1 פתרון ביקרבונט M נתרן. מערבבים היטב וצנטריפוגות התערובת בקצרה להיפטר מבועות. הערה: functionalization של פני השטח עם פוליאתילן גליקול (PEG) מסייע להפחית ספציפי מחייב של הדנ&quot;א אל פני השטח. </li><li style=";text-align:right;direction:rtl"> שים 80 L של פתרון PEG בכל שקופית ועדינות להוריד את coverslip על זה. חכה 45 דקות. הפרד את coverslip מהשקופית עם פינצטה, לשטוף אותם עם כמות העצומה של DH 2 O ולתת tיבש מכפלת באוויר פתוח. </li><li style=";text-align:right;direction:rtl"> מניחים רצועות דקות של קלטת דו מקל על פני השקופית כדי ליצור ערוצים. יישר coverslip על זה ולחץ בחוזקה נגד coverslip לשקופית כדי ליצור ערוצים נוזל הדוקה. השתמש אפוקסי 5 דקות כדי לאטום את הקצוות של הערוצים. </li></ol> 4. הכנת Trolox הפתרון <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> שים ~ 30 מ&quot;ג Trolox ו10 מיליליטר DH 2 O בבקבוק ולהשתמש בבר ומערבב מגנט לעורר את הפתרון באוויר פתוח במשך 18 שעה. </li><li style=";text-align:right;direction:rtl"> סנן את הפתרון באמצעות מסנן 0.2 מיקרומטר ולהתאים את ה-pH ל 7 על ידי הוספה ~ 6 μl של 1 בסיס M טריס (pH 11). הערה: Trolox הוא מגיב אנטי מהבהב המשמש בדרך כלל במולקולה בודדת לומד 18. פעולת antifading של Trolox מגיעה מנגזרת חמצון שלה, אשר נמצא בפתרון Trolox המושפל באופן חלקי 19. מהירות המסת Trolox במתנול או פתרון ה-pH טריס גבוה יש להימנע בגלל חמצון יעיל. </li></ol> 5. Single-molהדמיה ecule <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הזרק 15 μl של פתרון NeutrAvidin (0.5 מ&quot;ג / מיליליטר) לתוך הערוץ ולחכות 2 דקות לפני השטיפה עם של חיץ T50 100 μl (10 מ&quot;מ טריס-HCl, 50 mM NaCl, pH 7.0). </li><li style=";text-align:right;direction:rtl"> הזרק 50 μl של דגימת DNA (50-100 PM) לתוך התעלה. מתן 5 דקות ולשטוף את ה-DNA מאוגד משם עם של חיץ T50 100 L. הערה: מולקולות דנ&quot;א ספציפיות תהיה לאגד את פני השטח באמצעות האינטראקציה NeutrAvidin-ביוטין. </li><li style=";text-align:right;direction:rtl"> מלא ערוץ עם חיץ ההדמיה המכיל מערכת הדחה חמצן 20 (100 מ&quot;מ PCD, 5 מ&quot;מ PCA, 1 מ&quot;מ Trolox, ו500 מ&quot;מ NaCl). </li><li style=";text-align:right;direction:rtl"> הגדר את EMCCD במצב מסגרת העברה להזרים 2 x 2 תמונות זרקת לפח (256 x 256) למחשב ב25 מסגרות לשנייה. </li><li style=";text-align:right;direction:rtl"> שים שמן טבילה במטרת מיקרוסקופ, ולתקן את תא הזרימה על הבמה מיקרוסקופ באמצעות קליפים דגימה. גס להתאים את הפוקוס ע&quot;י הסתכלות בדפוס השתקפות לייזר על הקיר. עדין להתאים את הפוקוס באמצעות התצוגה החיה של im הקרינהגילים על המסך. </li><li style=";text-align:right;direction:rtl"> בגין רכישת נתונים עם לייזר 532 ננומטר ב. בדוק את התצוגה החיה ולהתאים את הפוקוס במידת צורך. תפסיק רכישת נתונים כאשר רוב המולקולות photobleached. הערה: במתקן זה, משמשת תכנית C-נכתב מעבדה כדי לשלוט במיקרוסקופ ולהציג תמונות חיות על המסך כפי שהם נשמרים לדיסק הקשיח. </li></ol> 6. עיבוד תמונה וניתוח נתונים הערה: סדרת זמן של 256 x 256 תמונות מעובדות על ידי קוד MATLAB ליצור עקבות זמן מולקולה בודדת של עוצמות Cy3 וCy5. כדי לשייך פיקסלים בין ערוץ התורם וערוץ acceptor של התמונה מפוצלת נוף, 6-7 זוגות של כתמי Cy3 וCy5, כל זוג מאותו המולקולה המפוזרת באופן שווה על פני שדה הראייה, הם הרימו ידני, ושינוי affine מחושב באמצעות הקואורדינטות של נקודות אלה כנקודות עיגון. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> באמצעות תסריט MATLAB, להסתכל דרך כל זמן המולקולה בודדת עקבות tמעברים מרובים מופע כובע בין אותות סריג נמוכים וגבוהים. זהה את מדינות כרך וunlooped. הערה: אות סריג מוגדרת כעוצמת Cy5 (אני), מחולק בסכום של עוצמות Cy3 וCy5 (אני + אני D). יש מדינה בלולאה ערך סריג גבוה תוך מדינת unlooped יש ערך סריג נמוך. היסטוגרמה של אותות סריג ממולקולה בודדת מופצת bimodally בגלל לולאות וunlooping הפיכים. </li><li style=";text-align:right;direction:rtl"> מצא את הסף המפריד בין שתי הפצות על ידי קביעת הצומת שבין שתי עקומות גאוס מצוידים. </li><li style=";text-align:right;direction:rtl"> לחשב את יעילות סריג כמו <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq7.jpg" /> ולהקצות את המדינות בלולאה עם ערכים גבוה סריג ומדינות unlooped עם ערכי סריג נמוכים. </li><li style=";text-align:right;direction:rtl"> באמצעות תסריט MATLAB, לנתח את המספר המצטבר של מולקולות (N (t)) שכרך (אוהגיע למצב סריג הגבוה) בפערי זמן שונים מאז תחילת רכישת נתונים. הערה: מאחר שמולקולת dsDNA יכולה להתחיל בכל קונפורמציה של מדינת unlooped בתחילת רכישת נתונים, שיעור הגידול באוכלוסיית הכרך משקף את שיעור הלולאה הממוצע בממוצע לכל תצורות ראשוניות. לחלץ את k שיעור לולאת לולאה על ידי התאמת N (t) עם פונקציה מעריכית: <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq1.jpg" /> אם עליות biphasically, זה יכול להיות מצויד עם פונקציה כפולה מעריכי: <img fo:content-width="2.2in" src="/files/ftp_upload/51667/eq2.jpg" /> במקרה זה, k לולאה מתקבלת: <img fo:content-width="1.7in" src="/files/ftp_upload/51667/eq3.jpg" /> הערה: באופן תיאורטי, את הסתברות ההישרדות שפולימר לא בלולאה בזמן t היא לא פונקציה מעריכית יחידה או כפולה 12. Fitt מעריכיing משמש כאמצעים מעשיים כדי לחלץ את זמן לולאות הממוצע. </li></ol> 7. קביעת פקטור J הערה: גורם J מייצג איך מרוכז קצה אחד של dsDNA הוא מעבר לקצה השני. זה יכול להיקבע על ידי ביון הריכוז של קטע קצה אחד של ה-DNA שמייצר את אותו קצב התגובה עם מגזר הקצה השני כשיעור לולאות שנמדד. בניסוי, קטע קצה אחד הוא משותק על פני השטח, ומגזר הקצה השני הוא הציג בריכוז ג מסוים. אם שיעור חישול נמדד בין שני הקצוות הוא לחשל k, אז גורם J 21 ניתן על ידי <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq4.jpg" /> . השיעור הקבוע חישול (לחשל k = לחשל k / C) אינו תלוי בריכוז הבדיקה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לזרום 20 μl של אוליגו ביוטין-Cy5 30-50 PM (פריימר 3) in כדי ערוץ מצופה NeutrAvidin. יש לשטוף את הערוץ עם 100 T50 μl לשטוף oligos מאוגד. </li><li style=";text-align:right;direction:rtl"> הכן את חיץ ההדמיה כפי שמתואר בחלק 5 עם התוספת של אוליגו Cy3 (פריימר 2) בריכוז סופי של 50 ננומטר. לזרום חיץ הדמיה זו לתוך התעלה. </li><li style=";text-align:right;direction:rtl"> תוך שמירה על לייזר 532 ננומטר ב, פונה בקצרה לייזר 640 ננומטר למקומות של oligos Cy5 מאוגד משטח לזהות. כבה את לייזר 640 ננומטר ולהתחיל ניטור אות סריג. הערה: עם הכלאה של אוליגו Cy3 לאוליגו Cy5 מאוגד פני השטח, הקרינה Cy5 תנבע מסריג. </li><li style=";text-align:right;direction:rtl"> באמצעות תסריט MATLAB, לנתח את מספר המולקולות שתתחלנה במדינה מאוגדת (עוצמת Cy5 נמוכה), אך מאוחר יותר יהפכו למדינה (בעצימות גבוהה Cy5) annealed כפונקציה של זמן מעקבות עוצמת Cy5. </li><li style=";text-align:right;direction:rtl"> מגרש מספר זה של מולקולות לעומת זמן annealed. להתאים עקומה זו עם פונקציה מעריכית יחידה ( <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq5.jpg"/&gt;) כדי להשיג את שיעור חישול (לחשל k). </li><li style=";text-align:right;direction:rtl"> חזור על הניסוי הזה בריכוזים שונים Cy3 אוליגו (60, 100, ו180 ננומטר) כדי לאשר את הליניאריות בין שיעור חישול והריכוז מגיב. חלץ את שיעור קבוע חישול מסדר השנייה (לחשל k ) מהמדרון. </li><li style=";text-align:right;direction:rtl"> חשב את גורם J מ <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq6.jpg" /> , כאשר k לולאה היא שיעור הלולאות שנמדד באותו מצב החיץ. </li></ol>

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

המחברים מצהירים שום ניגוד עניינים.

Assay מולקולה בודדת פשוט המבוסס על סריג שימש ללמוד קינטיקה לולאות של DNAs של צורות פנימיות שונות. ניתן להכין DNAs מעוקל על ידי חזרה על רצף 10-mer בשלב עם תקופת הסליל של 10.5 נ&quot;ב, וניתן להעריך עקמומיות שלהם באמצעות עמוד. dsDNAs אלה נועדו עם קצוות דביקים על מנת לאפשר ייצוב לולאה חולף...

הבנת התכונות מכאניות של dsDNA היא בעל חשיבות עליונה במדעים בסיסיים ויישומים הנדסיים. המבנה של dsDNA הוא מסובך יותר מאשר סולם סליל ישר בגלל זוויות גלגול, הטיה ופיתול בין זוגות בסיסים רצופים יכולות להשתנות עם רצף. תנודות תרמיות יכולות לגרום dsDNA לעבור מצבים שונים של תנודות קונפורמציה כגון כיפוף, פיתול ומתיחות. מעברים כגון היתוך ומסתלסל יכולים להתרחש גם בתנאים קיצוניים. בין תנועות אלה, יש כיפוף dsDNA ההשפעה הביולוגית הבולטת ביותר 1. כיפוף dsDNA קשור לדיכוי גן או הפעלה על ידי הבאת שני אתרים מרוחקים קרובים אחד לשני. זה גם משחק תפקיד חשוב באריזת ה-DNA בתוך גרעין התא או הקופסית נגיפית. עיוות כיפוף של dsDNA ניתן דמיינו באופן ניסיוני על ידי מיקרוסקופ ברזולוציה גבוהה (AFM 2 וTEM 3), וthermodynamics וקינטיקה ניתן ללמוד על ידי מבחני לולאות, אשר כימי קישור אתרים זה לצד זה של dsDNA. assay אחד כזה הוא cyclization האנזים תלוי 4. ב assay זה, מולקולות dsDNA עם קצוות &quot;דביקים&quot; (מגובש) הן circularized או dimerized ידי האנזים ה-DNA. על ידי השוואת המחירים של המעגל והיווצרות דימר, ניתן לקבל ריכוז טוחנת יעיל של קצה אחד של ה-DNA בקרבת הקצה השני, אשר ידוע כגורם J. גורם J זה ממדי שווה לצפיפות הסתברות למציאת קצה אחד של ה-DNA במרחק קצר מהקצה השני, ובכך משקף את הגמישות של ה-DNA. מדידת גורם J כפונקציה של אורך ה-DNA מגלה מאפיינים רבים על מכניקת DNA כולל 4,5 אורך ההתמדה. השרשרת דמוית תולעת המודל (WLC) כבר נחשב למודל הפולימר הקנונית למכניקת dsDNA מבוססת על הצלחתה בexplaining עקומות כוח ההארכה שהושגו ב-DNA מושך ניסויי 6, ובצורה נכונה לניבוי גורמי J של dsDNAs זמן רב יותר מאשר 200 נ&quot;ב 7. עם זאת, באמצעות assay cyclization על מולקולות dsDNA קצרות ככל 100 נ&quot;ב, קלוטייה וWidom מדדו את גורמי J להיות בכמה סדרי גודל גבוהים יותר מהתחזית של מודל WLC 8. שנה לאחר מכן, דו et al. מיוצר גורמי J בהסכם עם מודל WLC באמצעות assay cyclization עם ריכוזים נמוכים יותר של האנזים וייחס את התוצאה החריגה מקבוצת Widom לריכוזי האנזים גבוהים בשימוש 9. מחלוקת זו מדגימה את ההשפעה הבלתי נמנעת של האנזים ה-DNA על קינטיקה cyclization בעת שימוש assay הקונבנציונלי 9. יתר על כן, האנזים DNA יכול להשפיע גם על מבנה ה-DNA ונוקשות דרך 10,11 מחייב ספציפי. כדי למנוע חששות הטכניים של מבחני לולאות חלבון תלוי, לאחרונה הפגינו protassay לולאות עין בחינם מבוסס על פלואורסצנטי התהודה העברת אנרגיה (סריג) 12. בשיטה זו, תצורות כרך מזוהות על ידי סריג בין תורם acceptor המצורף ליד הקצוות הדביקים של מולקולת ה-DNA. מיקרוסקופ אובייקטיבי מסוג הקרינה השתקפות הכל הפנימית (TIRFM) משמש להקלטת מסלולים של לולאות הפיכים ואירועי unlooping ממולקולות דנ&quot;א חד משותק פני השטח לתקופה ממושכת של זמן. שיטה זו כוללת הרכבה של מולקולות ה-DNA המבוססת על ה-PCR לייצור מולקולות ה-DNA ללא חוסר התאמה, שהוא שיפור מכריע על שיטה דומה על ידי Vafabakhsh ו13 הא. היבט המולקולה בודדת של פרוטוקול זה מאפשר מדידה של הפצות בנוסף לאנסמבל ממוצע ואילו היבט סריג מאפשר למדוד דינמיקת לולאות DNA שוב ושוב מאותה המולקולה, גם במצבים שעלולים לפגוע בפעילות האנזים. התקנת TIRFM מוצגת באיור 1. מותאמת אישיתשלב דגימה מעוצבת ממוקם מעל גוף מיקרוסקופ אולימפוס IX61. 532 ננומטר ו640 לייזרי ננומטר הם הציגו מהצד ובאים לידי הביטוי במראות סגלגלות זעירות 14 למטרת NA הגבוהה כדי להשיג זווית קריטית של שכיחות בממשק coverslip המים. נציין כי נפוץ יותר TIR דרך אובייקטיבי באמצעות מראות dichroic או setups TIR מבוסס פריזמה יכול לשמש גם עבור יישום סריג הזה. תמונת הקרינה שהוקמה על ידי מיקרוסקופ מחולקת לתמונות תורם acceptor ידי מראה dichroic. הם לאחר מכן מחדש הדמיה על שני חצאים של EMCCD. מסנני פליטה ארוך לעבור נוספים נמצאים בשימוש כדי להפחית את אות רקע. בקרת טמפרטורה היא חיונית לרכישת נתונים הקינטית לשחזור. לבקרת טמפרטורה, המטרה היא להפריד את מזנקים של גוף מיקרוסקופ כדי למזער העברת חום, ומים מנשלט ילר / תנור בטמפרטורה מופצת דרך צווארון פליז שחוזקה התקפיםסביב מתכת הפנים מתחת למעייל האובייקטיבי. התקנה זו היא מסוגלת להשיג שליטה בטמפרטורה יציבה על פני השטח coverslip בין 15 50 ° C (איור 2). בעבודה זו, מדגם הטמפרטורה נשמרה ב24 ° C. הפרוטוקול שלהלן מציג את הליך צעד אחר צעד לבניית ה-DNA, הערכה של צורת ה-DNA, ניסוי מולקולה בודדת, ונחישות גורם J.

<table border="0" cellpadding="0" cellspacing="0" width="793">
	<tbody>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Small DNA FRAG Extract Kit-100PR</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97060-558</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Acrylamide 40% solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97064-522</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Bis-acrylamide 2% (w/v) solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97063-948</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">GeneRuler 100 bp DNA Ladder, 100-1000 bp</td>
			<td style="width:124px;">Fermentas</td>
			<td>SM0241</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Mini Vertical PAGE System</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">89032-300</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Syringe filter 0.2um CS50</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Trolox</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">238813-1G</td>
			<td>triplet state quencher</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuic acid (PCA)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">08992-50MG</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuate 3,4-Dioxygenase (PCD)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">P8279-25UN</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">mPEG-silane, MW 2000 1g</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">MPEG-SIL-2000-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Biotin-PEG-Silane, MW 3400</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">Biotin-PEG-SIL-3400-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Avidin, NeutrAvidin Biotin-binding Protein</td>
			<td style="width:124px;">Invitrogen</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Phusion Hot Start High-Fidelity DNA Polymerase</td>
			<td style="width:124px;">New England Biolabs</td>
			<td style="width:135px;">F-540L</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Gel/PCR DNA Fragments Extraction Kit</td>
			<td>IBI Scientific</td>
			<td>IB47020</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Premium plain glass microscope slides</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;">12-544-1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">VWR micro cover glass, rectangular, no. 1</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">48404-456</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fisher Scientific Isotemp 1006s Recirculating Chiller/Heater</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;"></td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective Cooling Collar</td>
			<td style="width:124px;">Bioptechs</td>
			<td style="width:135px;">150303</td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">KMI53 Biological Micrometer Measuring Stage</td>
			<td style="width:124px;">Semprex</td>
			<td style="width:135px;">KMI53</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">High Performance DPSS Laser 532nm 50mW&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">NT66-968</td>
			<td>Cy3 excitation</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:351px;">CUBE Fiber Pigtailed 640 nm, 30mW, Fiber, FC/APC Connector</td>
			<td style="width:124px;">Coherent</td>
			<td style="width:135px;">1139604</td>
			<td>Cy5 excitation</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">650 nm BrightLine Dichroic Beamsplitter</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">FF650-Di01-25x36</td>
			<td>splitting dichroic</td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:351px;">LaserMUX Beam Combiner, reflects 514.5, 532, &#38; 543.5 nm lasers, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">LM01-552-25</td>
			<td>combining dichroic</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Brightline Fluorescence Filter 593/40</td>
			<td style="width:124px;">Semrock</td>
			<td>FF01-593/40-25</td>
			<td>Cy3 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">635 nm EdgeBasic LWP longpass Filter, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">BLP01-635R-25</td>
			<td>Cy5 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">EMCCD iXon+</td>
			<td style="width:124px;">Andor Technology</td>
			<td style="width:135px;">DU-897E-CS0-#BV</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">IX51 inverted microscope frame</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective UApo N 100x/1.49 Oil TIRF</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Immersion oil type-F for fluorescence microscopy</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;">IMMOIL-F30CC</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">2mm Diameter 45&#176; Rod Lens Aluminum Coated&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">54-092</td>
			<td>miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">1/4&#34; Travel Single-Axis Translation Stage</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">MS-1</td>
			<td>translation of miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">&#216;1&#34; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-200-A</td>
			<td>focusing lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Adjustable Mechanical Slit</td>
			<td style="width:124px;">Thorlabs</td>
			<td>VA100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dielectric Mirror</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">BB1-E02</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">&#216;1&#34; Achromatic Doublet, f = 100 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-100-A</td>
			<td>relay lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Lens Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LMR1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dichroic Filter Mount</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">FFM1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fixed Cage Cube Platform</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">B3C</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Kinematic Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">KM100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lens, &#216;1&#34;, f = 40 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1422-A</td>
			<td>collimating lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 15 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1222-A</td>
			<td>telescope lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 150 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1433-A</td>
			<td>telescope lens</td>
		</tr>
	</tbody>
</table>

studying dna looping by single-molecule fret

כיפוף של גדילי הדנ&quot;א כפול (dsDNA) קשור עם הרבה תהליכים ביולוגיים חשובים כגון זיהוי חלבון דנ&quot;א ואריזת ה-DNA לתוך nucleosomes. תרמודינמיקה של כיפוף dsDNA נחקרה על ידי cyclization שיטה הנקראת אשר מסתמך על האנזים DNA להצטרף קוולנטית קצוות דביקים קצרים של dsDNA. עם זאת, יעילות קשירה יכולה להיות מושפעת מגורמים רבים שאינם קשורים לdsDNA לולאה כגון מבנה ה-DNA המקיף את הקצוות הדביקים הצטרפו, ואנזים יכול להשפיע גם על שיעור לולאות לכאורה באמצעות מנגנונים כגון ספציפי מחייב. כאן, אנו מראים כיצד למדוד קינטיקה לולאות dsDNA ללא האנזים על ידי איתור היווצרות ה-DNA לולאה חולפת ידי סריג (פלואורסצנטי התהודה העברת אנרגיה). מולקולות dsDNA נבנות באמצעות פרוטוקול המבוסס על ה-PCR פשוט עם זוג סריג ומקשר ביוטין. צפיפות הסתברות הלולאה הידועה כגורם J מופק שיעור לולאות ושיעור חישול בין שתי disconnecקצוות דביקים טד. על ידי בדיקת שתי dsDNAs עם עקמומיות פנימית שונה, אנו מראים כי גורם J הוא רגיש לצורה הפנימית של dsDNA.

מולקולות ה-DNA משמשות למחקר הלולאה מורכבת של אזור דופלקס של רצף משתנה ובאורך וסככות חד גדילים שהם משלימים אחד את השני. הסככות, שהן ארוכות 7 בסיס, יכולות לחשל זה לזה כדי ללכוד את מצב הכרך. כל הסככה מכילה גם Cy3 או Cy5 כי הוא מקושר בעמוד שדרת ה-DNA באמצעות הכימיה amidite. Cy5-הסככה קשו...

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

מחקר זה מציג הליך ניסיון מפורט כדי למדוד דינמיקת לולאות של גדילי הדנ&quot;א כפול באמצעות פלואורסצנטי התהודה העברת אנרגיה מולקולה בודדת (סריג). הפרוטוקול מתאר גם כיצד לחלץ את צפיפות הסתברות הלולאה נקראת גורם J.

לימוד ה-DNA Looping ידי סריג Single-מולקולה

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

studying-dna-looping-by-single-molecule-fret

Research

JoVE Journal

Biology

15.3K Views.  Georgia Institute of Technology.  מחקר זה מציג הליך ניסיון מפורט כדי למדוד דינמיקת לולאות של גדילי הדנ"א כפול באמצעות פלואורסצנטי התהודה העברת אנרגיה מולקולה בודדת (סריג). הפרוטוקול מתאר גם כיצד לחלץ את צפיפות הסתברות הלולאה נקראת גורם J. 

Video: Studying DNA Looping by Single-Molecule FRET

Single Molecule Methods for Monitoring Changes in Bilayer Elastic Properties

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein interactions and more general lipid bilayer-protein interactions. These interactions are particularly important in pharmacological research, as many current pharmaceuticals on the market can alter the lipid bilayer material properties, which can lead to altered membrane protein function.   The formation of gramicidin channels are dependent on conformational changes in gramicidin subunits which are in turn dependent on the properties of the lipid.  Hence the gramicidin channel  current is a reporter of altered properties of the bilayer due to certain compounds.  

Membrane protein function is regulated by the cell membrane lipid composition. This video-article details how to form a patch using bilayer patch electrodes, as well as how to use gramicidin channels as reporters of altered membrane properties.

שיטות מולקולה בודדת עבור ניטור שינויים ב bilayer תכונות אלסטיות

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein ...

Combining QD-FRET and Microfluidics to Monitor DNA Nanocomplex Self-Assembly in Real-Time

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically functional inside the cell, nucleic acid-based therapeutics require an efficient intracellular delivery system. One widely adopted approach is to complex DNA with a gene carrier to form nanocomplexes via electrostatic self-assembly, facilitating cellular uptake of DNA while protecting it against degradation. The challenge lies in the rational design of efficient gene carriers, since premature dissociation or overly stable binding would be detrimental to the cellular uptake and therapeutic efficacy. Nanocomplexes synthesized by bulk mixing showed a diverse range of intracellular unpacking and trafficking behavior, which was attributed to the heterogeneity in size and stability of nanocomplexes. Such heterogeneity hinders the accurate assessment of the self-assembly kinetics and adds to the difficulty in correlating their physical properties to transfection efficiencies or bioactivities. We present a novel convergence of nanophotonics (i.e. QD-FRET) and microfluidics to characterize the real-time kinetics of the nanocomplex self-assembly under laminar flow. QD-FRET provides a highly sensitive indication of the onset of molecular interactions and quantitative measure throughout the synthesis process, whereas microfluidics offers a well-controlled microenvironment to spatially analyze the process with high temporal resolution (~milliseconds). For the model system of polymeric nanocomplexes, two distinct stages in the self-assembly process were captured by this analytic platform. The kinetic aspect of the self-assembly process obtained at the microscale would be particularly valuable for microreactor-based reactions which are relevant to many micro- and nano-scale applications. Further, nanocomplexes may be customized through proper design of microfludic devices, and the resulting QD-FRET polymeric DNA nanocomplexes could be readily applied for establishing structure-function relationships. 

We present a novel and powerful integration of nanophotonics (QD-FRET) and microfluidics to investigate the formation of polyelectrolyte polyplexes, which is expected to provide better control and synthesis of uniform and customizable polyplexes for future nucleic acid-based therapeutics.

שילוב QD-סריג ו מיקרופלואידיקה לפקח Nanocomplex DNA הרכבה עצמית בזמן אמת

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically ...

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides (Figure 1). The growing product double-strand DNA (dsDNA) is extended with laminar flow and visualized by using an intercalating dye. Measuring the position of the growing DNA end in real time allows precise determination of replication rate (Figure 2). Furthermore, the length of completed DNA products reports on the processivity of replication. This experiment can be performed very easily and rapidly and requires only a fluorescence microscope with a reasonably sensitive camera.


This protocol demonstrates a simple single-molecule fluorescence microscopy technique for visualizing DNA replication by individual replisomes in real time.

חזותי יחיד מולקולת הדנ&quot;א שכפול עם מיקרוסקופ פלואורסצנטי

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

אוטומטי של המערכת עבור מדידות הקרינה מולקולה בודדת של Surface-משותקת ביומולקולות

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. Linearized &lambda; DNA is modified to have a biotin on the end of one strand, and a digoxigenin moiety on the other end of the same strand. The biotinylated end is attached to a functionalized glass coverslip and the digoxigeninated end to a small bead. The assembly of these DNA-bead tethers on the surface of a flow cell allows a laminar flow to be applied to exert a drag force on the bead. As a result, the DNA is stretched close to and parallel to the surface of the coverslip at a force that is determined by the flow rate (Figure 1). The length of the DNA is measured by monitoring the position of the bead. Length differences between single- and double-stranded DNA are utilized to obtain real-time information on the activity of the replication proteins at the fork. Measuring the position of the bead allows precise determination of the rates and processivities of DNA unwinding and polymerization (Figure 2).

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system.

תצפית ישירה של ה-DNA אנזימים שכפול באמצעות DNA מולקולה בודדת מתיחה Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

Single-Molecule Imaging of Nuclear Transport

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the last decade. The investigation of molecular interactions with high temporal and spatial resolutions deep within cells has remained challenging due to the inherently weak signals arising from individual molecules. Recent works by Yang et al. demonstrated that narrow-field epifluorescence microscopy allows visualization of nucleocytoplasmic transport at the single molecule level. By the single molecule approach, important kinetics, such as nuclear transport time and efficiency, for signal-dependent and independent cargo molecules have been obtained. Here we described a protocol for the methodological approach with an improved spatiotemporal resolution of 0.4 ms and 12 nm. The improved resolution enabled us to capture transient active transport and passive diffusion events through the nuclear pore complexes (NPC) in semi-intact cells. We expect this method to be used in elucidating other binding and trafficking events within cells.

Single molecule microscopy approch provided novel insights into nuclear transport.

מולקולה בודדת הדמיה התחבורה גרעיני

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the ...

Monitoring Kinase and Phosphatase Activities Through the Cell Cycle by Ratiometric FRET

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such probes typically consist of variants of CFP and YFP, intervened by a phosphorylatable sequence and a phospho-binding domain. Upon phosphorylation, the probe changes conformation, which results in a change of the distance or orientation between CFP and YFP, leading to a change in FRET efficiency (Fig 1). Several probes have been published during the last decade, monitoring the activity balance of multiple kinases and phosphatases, including reporters of PKA2, PKB3, PKC4, PKD5, ERK6, JNK7, Cdk18, Aurora B9 and Plk19. Given the modular design, additional probes are likely to emerge in the near future10. 
Progression through the cell cycle is affected by stress signaling pathways 11. Notably, the cell cycle is regulated differently during unperturbed growth compared to when cells are recovering from stress12.Time-lapse imaging of cells through the cell cycle therefore requires particular caution. This becomes a problem particularly when employing ratiometric imaging, since two images with a high signal to noise ratio are required to correctly interpret the results. Ratiometric FRET imaging of cell cycle dependent changes in kinase and phosphatase activities has predominately been restricted to sub-sections of the cell cycle8,9,13,14.
Here, we discuss a method to monitor FRET-based probes using ratiometric imaging throughout the human cell cycle. The method relies on equipment that is available to many researchers in life sciences and does not require expert knowledge of microscopy or image processing.

FRET-based reporters are increasingly used to monitor kinase and phosphatase activities in live cells. Here we describe a method on how to use FRET-based reporters to assess cell cycle-dependent changes in target phosphorylation.

ניטור פעילות קינאז ו phosphatase דרך מחזור התא על ידי Ratiometric סריג

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such ...

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage (CoTrAC)

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method makes it possible to count the numbers of protein molecules produced in one cell during sequential, five-minute time windows. It requires a fluorescence microscope with laser excitation power density of ~0.5 to 1 kW/cm2, which is sufficiently sensitive to detect single fluorescent protein molecules in live cells. The fluorescent reporter used in this method consists of three parts: a membrane targeting sequence, a fast-maturing, yellow fluorescent protein and a protease recognition sequence. The reporter is translationally fused to the N-terminus of a protein of interest. Cells are grown on a temperature-controlled microscope stage. Every five minutes, fluorescent molecules within cells are imaged (and later counted by analyzing fluorescence images) and subsequently photobleached so that only newly translated proteins are counted in the next measurement.
Fluorescence images resulting from this method can be analyzed by detecting fluorescent spots in each image, assigning them to individual cells and then assigning cells to cell lineages. The number of proteins produced within a time window in a given cell is calculated by dividing the integrated fluorescence intensity of spots by the average intensity of single fluorescent molecules. We used this method to measure expression levels in the range of 0-45 molecules in single 5 min time windows. This method enabled us to measure noise in the expression of the &lambda; repressor CI, and has many other potential applications in systems biology.

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage CoTrAC

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC), to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method has been used to follow the stochastic expression dynamics of a transcription factor, the &lambda; repressor CI 1.

הדמית מולקולה הבודדה של רגולציה גנטית<em&gt; בחי</em&gt; שימוש הפעלת Cotranslational ידי מחשוף (CoTrAC)

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells ...

Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable.

Here we describe the instrumentation and methods for detecting single fluorescently-labeled protein molecules interacting with a single DNA molecule suspended between two optically trapped microspheres.

שילוב מניפולציה מולקולה בודדת והדמיה לחקר אינטראקציות החלבון-DNA

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method ...

FRET Imaging in Three-dimensional Hydrogels

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly employ two-dimensional (2D) culture, which does not mimic the three-dimensional (3D) cellular microenvironment. A method to perform quenched emission FRET imaging using conventional widefield epifluorescence microscopy of cells within a 3D hydrogel environment is presented. Here an analysis method for ratiometric FRET probes that yields linear ratios over the probe activation range is described. Measurement of intracellular cyclic adenosine monophosphate (cAMP) levels is demonstrated in chondrocytes under forskolin stimulation using a probe for EPAC1 activation (ICUE1) and the ability to detect differences in cAMP signaling dependent on hydrogel material type, herein a photocrosslinking hydrogel (PC-gel, polyethylene glycol dimethacrylate) and a thermoresponsive hydrogel (TR-gel). Compared with 2D FRET methods, this method requires little additional work. Laboratories already utilizing FRET imaging in 2D can easily adopt this method to perform cellular studies in a 3D microenvironment. It can further be applied to high throughput drug screening in engineered 3D microtissues. Additionally, it is compatible with other forms of FRET imaging, such as anisotropy measurement and fluorescence lifetime imaging (FLIM), and with advanced microscopy platforms using confocal, pulsed, or modulated illumination.

F&#246;rster resonance energy transfer (FRET) imaging is a powerful tool for real-time cell biology studies. Here a method for FRET imaging cells in physiologic three-dimensional (3D) hydrogel microenvironments using conventional epifluorescence microscopy is presented. An analysis for ratiometric FRET probes that yields linear ratios over the activation range is described.

סריג הדמיה ב הידרוג תלת ממדי

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly ...