우리는 비판적으로 원고를 읽는 제임스 워터스, 이블 워즈워스와 보 브로드 감사합니다. 우리는 또한 우리의 유용한 의견을 제공하는 네 개의 익명의 검토를 부탁드립니다. 우리는 조지아 공업 대학교, 과학 인터페이스에서 버로우즈 웰컴 기금 경력 상 및 리빙 시스템의 NSF 물리학에서 학생 연구 네트워크 지원 사업 재정 지원을 인정합니다.

1. dsDNA 샘플 준비 <ol><li> 10 메르 순서를 반복하여 전 세계적으로 곡선의 DNA를 디자인합니다. 예를 들어, 5&#39;-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCC X) 7 - TTTCATTCGAGCTCGTTGTTG-3 &#39;는 186-BP 곡선 X는 임의의 추가 자료입니다 DNA와 반복 10 메르 순서를 측면에서는 순서가 어댑터 시퀀스입니다이다. 참고 :.이 예에서 카플란 등으로 대규모 뉴 클레오 점유율 조사 결과를 기반으로 뉴 클레오 솜 형성에 반대 환경과 2 개의 10-MERS 15이 선택되었다. dsDNA의 나선형 반복 10 BP 부근에 있기 때문에, 10 - 머의 나선 축의 순 편향은 원호 (그림 3A)와 같은 모양을 생산하기 위해 축적됩니다. 헬리컬 기간 10.5 BP에 접근하기 때문에, 여분의 염기는 가능한 한 평면으로 만곡 구조를 유지하기 위해 매 2 반복 후에 삽입된다. 200 BP보다 짧은이 시퀀스는 대기업에서 주문할 수 있습니다의 그 제안의 유전자 합성 서비스를 제공합니다. 그것은 다음 단계에 대한 일반적인 어댑터 시퀀스 이러한 시퀀스를 측면에 편리합니다. 절차는도 3b에 도식화한다. </li><li> 프라이머 1 (GTGCCAGCAACAGATAGC) 프라이머 2 (/ 5Cy3/TAAATTCCTACAACAACGAGCTCGAATG)과 PCR을 수행합니다. 참고 : 프라이머 2는 5 &#39;말단의 FRET 기증자를 Cy3가 표시되어 있습니다. 전형적인 PCR 제조법 및 사이클링 프로토콜은 표 1 및 표 2에 나타낸다. </li><li> 프라이머 3 (/ 5BioTEG/GAAACATAG/iCy5/GAATTTACCGTGCCAGCAACAGATAGC) 프라이머 4 (CAACAACGAGCTCGAATG)과 PCR을 수행합니다. 참고 : 프라이머 3 5 &#39;말단의 백본과 비오틴 링커를 통해 FRET 수용체 Cy5에가 표시되어 있습니다. PCR 제조법 및 순환 프로토콜은 위와 같이되어 있습니다. </li><li> 정리 PCR 키트를 사용하여 PCR 제품을 정제. </li><li> 0.4 &amp;의 최종 농도로 가닥 교환을위한 버퍼 (100 ㎜의 NaCl, 10 MM 트리스 - 염산의 pH 7.0, 1 mM의 EDTA)의 Cy3로 표지 된 제품과 Cy5에 레테르를 붙인 제품을 혼합# 181; 각각 M과 0.1 μM,. NOTE : 과량를 Cy3-DNA 가닥은 과거의 결과를 Cy3 및 Cy5의 양을 운반하는 이중의 농도를 증가시킨다. </li><li> 2 분 동안 98.5 ° C에서 배양하여 Exchange 물가는 점차 5 냉각 ° C 0.1 ° C / 초 램프 속도로, 그리고 5에서 배양 &#160; 2 시간 동안 C를 °. </li></ol> 2. 젤 전기는 dsDNA 곡률을 감지하는 <ol><li> 29.2:0.8의 비율로 아크릴 아미드 및 비스 - 아크릴 아미드 솔루션을 혼합하여 폴리 아크릴 아마이드 젤 (16, 17)을 붓고, 5 % (W / V)의 pH 8.0에서 1X 트리스 / 붕산염 / EDTA (TBE) 버퍼. 주 : 겔 용액 10 ml를 포함 1.217 ml의 40 % 아크릴 아미드 0.667 ml의 2 % 비스 아크릴 아미드, 1 ㎖ TBE 10X를 100 L 황산 암모늄 (APS) 10 %, 10 L TEMED, 및 나머지 dH보다 2 O.이며 젤의 전체 응고 약 30 분 소요됩니다. </li><li> DNA 샘플 및 1X 로딩 버퍼의 DNA 사다리 (5 % 글리세롤, 0.03 % (w / v)의 브로 모 페놀의 BL로 폴리 아크릴 아마이드 젤을로드UE)과 5-8에서 젤을 실행하는 45 분 동안 4 ° C에서 또는 염료 앞까지 V / cm 겔의 끝을 접근한다. </li><li> 30 분 동안 0.5 g / ml의 에티 디움 브로마이드를 포함 1X TBE 버퍼를 사용하여 겔을 염색. UV 조명 아래의 DNA 밴드를 확인합니다. DNA 분자의 외관상의 크기를 계산하는 크기의 마커 (100 염기쌍의 DNA 사다리)와 밴드 위치를 비교. 참고 : 곡선의 DNA는 일반적으로 직선 DNA를보다 느리게 이동합니다. </li></ol> 3. 셀 준비 흐름 <ol><li> 드릴 프레스와 다이아몬드 드릴 비트를 사용하여 유리 슬라이드의 두 양 모서리 (3 &#39;&#39; × 1 &#39;&#39;)를 따라 구멍을 6 ~ 7 쌍을 뚫습니다. 훈련 후, 눈에 보이는 유리 분말을 제거하기 위해 흐르는 물에 슬라이드를 문질러. 참고 : 구멍은 관류 입구와 출구 역할을한다. 훈련하는 동안, 물 슬라이드를 냉각 균열을 방지하는 것이 중요합니다. </li><li> 유리 항아리에 수직 슬라이드를 놓고 물을 채운다. 15 분 동안 초음파 처리하고 다른 유리 항아리 데에 전송할아세톤 청소 dicated. 15 분 동안 아세톤 및 초음파 처리로 입력합니다. 다음 스프레이 용기와 물을 사용하여 에탄올로 슬라이드를 씻어. 폴리 프로필렌 용기에 배치, 5 M 수산화 칼륨으로 채우고, 초음파 처리 15 분. 마지막으로, 15 분 동안 물에 슬라이드를 초음파 처리. 동일한 프로토콜을 이용하여 커버 슬립 (1 번, 24 × 40 mm)를 청소한다. 참고 : 청소 슬라이드와 커버 슬립 장기 사용을 위해 dH보다 2 O에 저장 될 수 있습니다. </li><li> 0.1 M 중탄산 나트륨 용액 340 L로 실란 MPEG-80 MG (MW 2000)와 함께 비오틴-PEG-실란 한 MG (MW 3,400)를 혼합한다. 잘 섞어 거품을 제거하기 위해 잠시 동안 혼합물을 원심 분리기. 참고 : 폴리에틸렌 글리콜 (PEG)로 표면의 작용은 표면에 DNA의 비특이적 결합을 줄일 수 있습니다. </li><li> 각 슬라이드에 PEG 용액 80 L를 넣고 부드럽게 그 위에 커버 슬립을 낮 춥니 다. 45 분 동안 기다립니다. 족집게로 슬라이드에서 커버 슬립을 분리 dH보다 2 O의 풍부한 양을 씻어 보자 t야외에서 단 건조. </li><li> 채널을 형성하기 위해 슬라이드를 통해 양면 테이프의 얇은 스트립을 놓습니다. 그 위에 커버 슬립을 맞추고 단단히 액체 꽉 채널을 형성하기 위해 슬라이드에 커버 슬립을 누릅니다. 채널의 가장자리를 밀봉하기 위해 5 분 에폭시를 사용합니다. </li></ol> 트롤 솔루션 4. 준비 <ol><li> 플라스크에 ~ 30 mg의 트롤과 10 ㎖ dH보다 2 O를 넣고 18 시간 동안 야외에서 솔루션을 저어 자석 교반 막대를 사용합니다. </li><li> 0.2 μm의 필터를 사용하여 솔루션을 필터링하고 1 M 트리스베이스 (산도 11)의 ~ 6 μl를 첨가하여 pH를 7로 조정합니다. 참고 : 트롤은 일반적으로 18 연구 단일 분자에 사용되는 항 깜박 시약입니다. 트롤의 antifading 조치는 부분적으로 저하 트롤 솔루션 19에 존재하는 산화 된 파생 상품에서 비롯됩니다. 신속 메탄올 또는 높은 pH 트리스 용액에 트롤 록스를 용해하기 때문에 비효율적 산화 피해야한다. </li></ol> 5. 싱글 몰ecule 이미징 <ol><li> 채널로 뉴트라 비딘 용액 (0.5 ㎎ / ㎖)의 15 μl를 주입 및 T50 버퍼 100 μL (10 MM 트리스 - 염산, 50 mM의 염화나트륨, 산도 7.0)로 세척하기 전에 2 분 동안 기다립니다. </li><li> 채널에 DNA 샘플 (50 ~ 100 PM)의 50 μl를 주입한다. 5 분 동안 기다린 T50 버퍼 100 L 멀리 언 바운드 DNA를 씻어. NOTE : DNA 분자는 구체적 뉴트라 비딘 - 비오틴 상호 작용을 통해 표면에 결합 할 것이다. </li><li> 산소 소거 시스템 (20) (100 ㎜ PCD, 5 mM의 PCA, 1 mM의 트롤 록스, 및 500 mM의 염화나트륨)을 포함 촬상 완충액으로 채널을 채운다. </li><li> 초당 25 프레임 컴퓨터에 2 × 2 비닝 이미지 (256 X 256)를 스트리밍 프레임 전송 모드 EMCCD를 설정합니다. </li><li> 현미경 대물에 침지 기름을 넣어 시험편 클립을 사용하는 현미경 스테이지 상에 플로우 셀을 고정한다. 벽에 레이저 반사 패턴을 보면 초점을 거친 조정합니다. 형광 메신저의 라이브 뷰를 사용하여 초점을 미세 조정모니터의 나이. </li><li> 에 532 nm의 레이저로 데이터 수집을 시작합니다. 라이브 뷰를 확인하고 필요한 경우 초점을 조정합니다. 대부분의 분자가 photobleached 때 데이터 수집을 중지합니다. 참고 :이 시설에서 현미경을 제어하고이 하드 디스크에 저장 될 때 모니터에 실시간 영상을 표시 할 수있는 연구소가 작성한 C 프로그램에 사용됩니다. </li></ol> 6. 이미지 처리 및 데이터 분석 NOTE : 256 X 256 화상의 시계열를 Cy3 및 Cy5의 강도의 단일 분자 시간 트레이스를 생성하는 MATLAB 코드에 의해 처리된다. 기증자 채널 및 분할보기 이미지의 수용체 채널 사이의 픽셀 쌍을하려면를 Cy3와 Cy5에 반점이 6 ~ 7 쌍, 균등하게 시야에 분산 동일한 분자에서 각 쌍은, 수동으로 아핀 변환에게 포착하고있다 앵커 지점으로이 지점의 좌표를 사용하여 계산됩니다. <ol><li> MATLAB 스크립트를 사용하여 모든 단일 분자의 시간을 통해 봐 t을 추적낮은 높은 FRET 신호 사이의 모자 쇼 다수 전환. 루프와 unlooped 상태를 확인합니다. 참고 : FRET 신호가 Cy5에 강도로 정의된다 (나는)를 Cy3와 Cy5에 강도의 합 (내가 수비 I +)로 나눈. unlooped 상태가 낮은 FRET 값을 가지고있는 동안 루프 상태는 하이 FRET 값이 있습니다. 하나의 분자에서 FRET 신호의 히스토그램 bimodally 때문에 가역 루프와 unlooping으로 배포됩니다. </li><li> 두 개의 장착 가우스 곡선의 교차를 결정하여 두 배포판을 구분하는 임계 값을 찾을 수 있습니다. </li><li> FRET 효율 등을 계산 <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq7.jpg" /> 높은 FRET 값과 낮은 FRET 값으로 unlooped 상태와 루프 상태를 할당합니다. </li><li> MATLAB 스크립트를 사용하여 분자 (N (t))의 누적 수를 분석 그 루프 (또는데이터 수집이 시작된 이후 서로 다른 시간의 경과에 높은 FRET 상태)에 도달. NOTE : dsDNA 분자는 데이터 수집의 시작 unlooped 상태 중 어느 형태로 시작할 수 있기 때문에, 루프 인구의 증가 속도는 평균 반복 속도는 초기 배좌 평균화 반영한다. 지수 함수와 N (t)를 피팅하여 반복 속도 K 루프를 추출 <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq1.jpg" /> biphasically 증가하면 두 지수 함수로 적합 할 수있다 : <img fo:content-width="2.2in" src="/files/ftp_upload/51667/eq2.jpg" /> 이 경우, K의 루프로부터 획득된다 : <img fo:content-width="1.7in" src="/files/ftp_upload/51667/eq3.jpg" /> NOTE : 이론적 중합체는 시간 t에서 반복하지 않았다고 생존 확률은 단일 또는 이중 지수 함수 12 아니다. 지수 FITTING는 평균 반복 시간을 추출하는 실용적인 수단으로서 사용된다. </li></ol> 7. J 인자를 결정 NOTE : J 팩터는 dsDNA의 일단은 타단 주위 얼마나 농축 나타낸다. 그것은 측정 반복 속도로 타단 세그먼트와 동일한 반응 속도를 생산할 DNA의 일단 세그먼트의 농도 보간에 의해 결정될 수있다. 실험적으로, 일단 세그먼트는 표면에 고정되고, 타 단부 ​​세그먼트는 특정 농도 C에 도입된다. 양단 간의 측정 어닐 레이트 K 어닐링이면 J 인자 21에 의해 주어진다 <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq4.jpg" /> . 어닐링 속도 상수 (k = K 어닐링 어닐링 / C)는 프로브의 농도와 무관하다. <ol><li> 30 ~ 50 μM의 비오틴 - Cy5에 올리고 20 ㎕ (프라이머 3) 흐름 전뉴트라 비딘 코팅 채널 n을. 언 바운드 올리고 씻어 100 μL의 T50와 채널을 씻어. </li><li> 50 nM의 최종 농도를 Cy3 올리고 (프라이머 2)의 첨가 부 (5)에 설명 된대로 촬상 버퍼를 준비한다. 채널로이 촬상 버퍼를 흐른다. </li><li> 에 532 nm의 레이저를 유지하면서, 간단히 표면 바인딩 Cy5에 올리고 위치를 확인하기에 640 nm의 레이저를 켭니다. 640 nm의 레이저를 끄고 FRET 신호를 모니터링을 시작합니다. 참고 : 표면 바인딩 Cy5에 올리고에 Cy3에 올리고 하이브리드시, Cy5의 형광 FRET에서 발생합니다. </li><li> MATLAB 스크립트를 사용하여 결합되지 않은 상태 (낮은 Cy5의 강도)에서 시작하지만 나중에 Cy5의 강도 트레이스에서 시간의 함수로서 소둔 상태 (높은 Cy5의 강도)로 바꾸어 분자의 수를 분석한다. </li><li> 어닐링 분자 대 시간이 수를 그린다. 단일 지수 함수 (과이 곡선에 맞게 <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq5.jpg"/&gt;) 어닐 레이트 (k 어닐링)을 얻었다. </li><li> 어닐 레이트 및 반응물 농도의 선형성을 확인하기 위하여 다양한 Cy3에 올리고 농도 (60, 100 및 180 nm 정도)로 실험을 반복한다. 2 차 열처리 속도 상수 (K 어닐링의 압축을 풉니 다 ) 슬로프에서. </li><li> J 인자에서를 계산 <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq6.jpg" /> , k 개의 루프가 동일한 완충액 조건에서 측정 반복 속도이다. </li></ol>

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

저자는 관심 없음 충돌 선언하지 않습니다.

FRET 기반으로 간단한 단일 분자 분석은 서로 다른 고유 한 모양의 DNA를 루프의 속도를 연구하는 데 사용되었다. 곡선 DNA를 10.5 BP의 헬리컬주기 위상이 10 - 머 서열을 반복함으로써 제조 할 수 있고, 그 곡률 PAGE를 이용하여 추정 될 수있다. 이 dsDNAs 과도 루프 안정화 할 수 있도록 스티커 끝으로 설계되어 있습니다. 우리는 시간이 지남에 따라 반복 분자의 수의 지수 상승에서 반복 속도를 추출. 끊?...

dsDNA의 기계적 특성을 이해하는 것은 기초 과학 및 공학 응용 프로그램에서 기본 중요하다. 연속적인 염기쌍 사이의 롤, 상하 이동 및 비틀림 각 시퀀스에 따라 달라질 수 있기 때문에 dsDNA의 구조는 직선 나선형 사다리보다 더 복잡합니다. 열 변동은 dsDNA는, 굽힘 비틀림과 스트레칭 등의 구조적 변동의 다양한 모드를 받아야하는 원인이 될 수 있습니다. 이러한 용융 및 꼬임으로 전환은 극단적 인 조건에서 발생할 수 있습니다. 이러한 움직임 가운데, dsDNA의 굴곡이 가장 눈에 띄는 생물에 미치는 영향 1 있습니다. dsDNA 구부리는 서로 가까운 두 먼 사이트를 가져와 유전자 억제 또는 활성화와 연결되어 있습니다. 또한 DNA를 세포 핵 내부의 포장 또는 바이러스 캡시드에 중요한 역할을한다. dsDNA의 굴곡 변형은 고해상도 현미경 (AFM 2 TEM 3), 및 thermodyn에 의해 실험적으로 시각화 할 수 있습니다amics과 반응 속도는 화학적으로 dsDNA의 병렬 사이트를 링크 반복 분석에 의해 연구 될 수있다. 하나의 분석은 리가에 의존하는 고리 화 4입니다. 이 분석에서 &#39;끈적 끈적한&#39;(응집력) 끝 dsDNA 분자 고리 화하거나 DNA 리가 아제에 의해 이량. 원형 및 이량 체의 비율을 비교하여, 하나는 J 인자로 알려져 타단 근방의 DNA의 일단의 효과적인 몰 농도를 얻을 수있다. 이 J 계수 타단으로부터 짧은 거리에서 DNA의 일단을 찾는 확률 밀도 치수와 동일하며, 따라서 DNA의 유연성을 반영한다. DNA 길이의 함수 J의 계수를 측정하는 것은 지속성 길이 4,5 포함한 DNA 기계에 대한 다양한 특성을 보여준다. 웜과 같은 체인 (WLC) 모델은 널리 expla에서의 성공을 기반으로 dsDNA 역학에 대한 정식 폴리머 모델로 여겨왔다DNA 실험 6 당기는 제대로 이상 200 bp의 7보다 dsDNAs의 J 요인을 예측에서 얻은 힘 - 신장 곡선 ining. 그러나, 100 bp의 짧게 dsDNA 분자의 고리 화 반응의 분석을 사용하여, Cloutier와 Widom는 WLC 모델 예측 8보다 몇 배의 크기로 J 요인을 측정했다. 년 후, 뒤 등. 리가 아제의 낮은 농도로 고리 화 분석법을 사용 WLC 모델과 일치 J 인자 생산 Widom 그룹에서 구를 사용한 높은 리가 아제 농도에 비정상적인 결과를 기인. 기존의 분석 9를 사용하는 경우이 논쟁은 고리 화 반응 속도에 DNA 리가 아제의 피할 수없는 영향을 예시한다. 또한, DNA 리가 아제는 비특이적 결합 10,11 통해 DNA 구조 및 강성에 영향을 미칠 수있다. 단백질에 의존하는 고리를 이루는 분석의 기술적 인 문제를 제거하기 위해, 우리는 최근 제자를 보여 주었다형광 공명 에너지 전달 (FRET) 12을 기준으로 EIN이없는 루프 분석. 이 방법에서, 루프 형 배좌는 DNA 분자의 끈끈한 단부 부근 부착 공여체와 수용체 사이의 FRET에 의해 감지된다. 대물 형 전반사 형광 현미경 (TIRFM)는 가역 루프와 오랜 기간 동안 표면에 고정화 한 DNA 분자로부터 unlooping 이벤트의 궤적을 기록하는 데 사용된다. 이 방법은 Vafabakhsh과 하 (13)에 의해 유사한 방법에 중요한 개선 불일치없는 DNA 분자를 생성하는 DNA 분자의 PCR 기반의 어셈블리를 제공합니다. 이 프로토콜의 단일 분자 측면은 FRET 측면이 하나라도 리가 활동에 악영향을 줄 수 조건에서, 같은 분자에서 반복 DNA 고리를 이루는 역학을 측정 할 수있는 동안뿐만 아니라 분포의 측정이 평균 앙상블 할 수 있습니다. TIRFM 설정은 그림 1에서 볼 수있다. 사용자 정의보기디자인 표본 단계는 올림푸스 IX61 현미경 몸에 배치됩니다. 532 nm 내지 640 nm의 레이저는 측면에서 도입 및 커버 슬립 - 물 계면에 입사 임계각을 달성하기 위해 높은 NA 대물 렌즈에 작은 타원형 미러 (14)에 의해 반사된다. 우리는 더 널리 이색 거울이나 프리즘 기반 TIR의 설정을 사용하여 관통 목적 TIR도이 FRET 응용 프로그램에 사용할 수 있습니다. 현미경에 의해 형성되는 형광 이미지는 다이크로 익 미러에 의해 기증자와 수용체의 이미지로 분할됩니다. 그런 다음 EMCCD의 두 반쪽에 이미지를 다시됩니다. 추가의 롱 패스 배출 필터는 배경 신호를 감소시키기 위해 사용된다. 온도 조절은 재현 운동 데이터를 획득하기위한 필수적입니다. 온도 제어를 위해, 대물가 온도 조절 칠러 / 히터에서 열 전달 및 물을 최소화 현미경 본체의 노즈 피스로부터 분리되어 단단히 끼워 황동 고리를 통해 순환된다목적 재킷 아래의 내부 금속의 주위에. 이 설정은 15 ~ 50 ° C 사이의 커버 슬립 표면 (그림 2)에서 강력한 온도 제어를 달성 할 수있다. 본 연구에서는 샘플 온도는 24 ° C를 유지 하였다 다음 프로토콜은 DNA의 구조, DNA 모양의 추정, 단일 분자 실험 및 J 인자 결정을위한 단계별 절차를 제공합니다.

<table border="0" cellpadding="0" cellspacing="0" width="793">
	<tbody>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Small DNA FRAG Extract Kit-100PR</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97060-558</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Acrylamide 40% solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97064-522</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Bis-acrylamide 2% (w/v) solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97063-948</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">GeneRuler 100 bp DNA Ladder, 100-1000 bp</td>
			<td style="width:124px;">Fermentas</td>
			<td>SM0241</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Mini Vertical PAGE System</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">89032-300</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Syringe filter 0.2um CS50</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Trolox</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">238813-1G</td>
			<td>triplet state quencher</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuic acid (PCA)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">08992-50MG</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuate 3,4-Dioxygenase (PCD)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">P8279-25UN</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">mPEG-silane, MW 2000 1g</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">MPEG-SIL-2000-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Biotin-PEG-Silane, MW 3400</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">Biotin-PEG-SIL-3400-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Avidin, NeutrAvidin Biotin-binding Protein</td>
			<td style="width:124px;">Invitrogen</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Phusion Hot Start High-Fidelity DNA Polymerase</td>
			<td style="width:124px;">New England Biolabs</td>
			<td style="width:135px;">F-540L</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Gel/PCR DNA Fragments Extraction Kit</td>
			<td>IBI Scientific</td>
			<td>IB47020</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Premium plain glass microscope slides</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;">12-544-1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">VWR micro cover glass, rectangular, no. 1</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">48404-456</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fisher Scientific Isotemp 1006s Recirculating Chiller/Heater</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;"></td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective Cooling Collar</td>
			<td style="width:124px;">Bioptechs</td>
			<td style="width:135px;">150303</td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">KMI53 Biological Micrometer Measuring Stage</td>
			<td style="width:124px;">Semprex</td>
			<td style="width:135px;">KMI53</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">High Performance DPSS Laser 532nm 50mW&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">NT66-968</td>
			<td>Cy3 excitation</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:351px;">CUBE Fiber Pigtailed 640 nm, 30mW, Fiber, FC/APC Connector</td>
			<td style="width:124px;">Coherent</td>
			<td style="width:135px;">1139604</td>
			<td>Cy5 excitation</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">650 nm BrightLine Dichroic Beamsplitter</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">FF650-Di01-25x36</td>
			<td>splitting dichroic</td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:351px;">LaserMUX Beam Combiner, reflects 514.5, 532, &#38; 543.5 nm lasers, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">LM01-552-25</td>
			<td>combining dichroic</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Brightline Fluorescence Filter 593/40</td>
			<td style="width:124px;">Semrock</td>
			<td>FF01-593/40-25</td>
			<td>Cy3 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">635 nm EdgeBasic LWP longpass Filter, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">BLP01-635R-25</td>
			<td>Cy5 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">EMCCD iXon+</td>
			<td style="width:124px;">Andor Technology</td>
			<td style="width:135px;">DU-897E-CS0-#BV</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">IX51 inverted microscope frame</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective UApo N 100x/1.49 Oil TIRF</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Immersion oil type-F for fluorescence microscopy</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;">IMMOIL-F30CC</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">2mm Diameter 45&#176; Rod Lens Aluminum Coated&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">54-092</td>
			<td>miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">1/4&#34; Travel Single-Axis Translation Stage</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">MS-1</td>
			<td>translation of miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">&#216;1&#34; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-200-A</td>
			<td>focusing lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Adjustable Mechanical Slit</td>
			<td style="width:124px;">Thorlabs</td>
			<td>VA100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dielectric Mirror</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">BB1-E02</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">&#216;1&#34; Achromatic Doublet, f = 100 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-100-A</td>
			<td>relay lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Lens Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LMR1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dichroic Filter Mount</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">FFM1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fixed Cage Cube Platform</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">B3C</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Kinematic Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">KM100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lens, &#216;1&#34;, f = 40 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1422-A</td>
			<td>collimating lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 15 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1222-A</td>
			<td>telescope lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 150 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1433-A</td>
			<td>telescope lens</td>
		</tr>
	</tbody>
</table>

studying dna looping by single-molecule fret

이중 가닥 DNA (dsDNA)의 굽힘은 DNA와 단백질의 인식과 뉴 클레오에 DNA 포장과 같은 많은 중요한 생물 학적 과정과 연관되어 있습니다. dsDNA 굽힘의 열역학은 공유 dsDNA의 짧은 끈적 끝을 가입 DNA 리가 아제에 의존하는 방법이라는 고리 화 반응에 의해 연구되고있다. 그러나, 결찰 효율 등의 DNA 결합 끈적 단부를 둘러싸는 구조, 및 연결 효소로 반복 dsDNA 관련되지 않은 많은 요인에 의해 영향을받을 수있다 또한 비특이적 결합과 같은 메커니즘을 통해 명백 반복 레이트에 영향을 미칠 수있다. 여기, 우리는 FRET (형광 공명 에너지 이동)에 의하여 과도 DNA 루프 형성을 감지하여 리가없는 dsDNA의 반복 반응 속도를 측정하는 방법을 보여줍니다. dsDNA 분자 FRET 쌍과 비오틴 링커 간단한 PCR 기반 프로토콜을 사용하여 구성됩니다. J 인자로 알려진 루핑 확률 밀도 두 disconnec 사이 반복 속도와 어닐 레이트로부터 추출테드 스티커 끝. 다른 고유 곡률 두 dsDNAs을 테스트함으로써, 우리는 J 계수가 dsDNA의 고유 형상에 민감하다는 것을 보여줍니다.

반복 연구에 사용되는 DNA 분자는 변수 순서와 길이와 서로 보완적인 단일 가닥 오버행의 이중 지역으로 구성되어 있습니다. 7 -베이스 긴 오버행은, 루프 형의 상태를 캡처하기 위해 서로에 어닐링 할 수있다. 각 오버행 아미 다이 화학을 통해 DNA 백본에 연결되어를 Cy3 또는 Cy5에 하나가 포함되어 있습니다. Cy5에 오버행은 표면 고정화 (그림 4A 참조) 비오틴 - TEG (15 원자 테트라 에틸렌 ...

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

이 연구 결과는 단일 분자 형광 공명 에너지 전달 (FRET)를 사용하여 이중 가닥 DNA의 반복 역학을 측정하는 상세한 실험 절차를 제공합니다. 이 프로토콜은 또한 J 인자라는 반복 확률 밀도를 추출하는 방법에 대해 설명합니다.

단일 분자 FRET에 의해 DNA 루핑을 공부

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

studying-dna-looping-by-single-molecule-fret

Research

JoVE Journal

Biology

15.3K 조회수.  Georgia Institute of Technology.  이 연구 결과는 단일 분자 형광 공명 에너지 전달 (FRET)를 사용하여 이중 가닥 DNA의 반복 역학을 측정하는 상세한 실험 절차를 제공합니다. 이 프로토콜은 또한 J 인자라는 반복 확률 밀도를 추출하는 방법에 대해 설명합니다. 

비디오: Studying DNA Looping by Single-Molecule FRET

Single Molecule Methods for Monitoring Changes in Bilayer Elastic Properties

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein interactions and more general lipid bilayer-protein interactions. These interactions are particularly important in pharmacological research, as many current pharmaceuticals on the market can alter the lipid bilayer material properties, which can lead to altered membrane protein function.   The formation of gramicidin channels are dependent on conformational changes in gramicidin subunits which are in turn dependent on the properties of the lipid.  Hence the gramicidin channel  current is a reporter of altered properties of the bilayer due to certain compounds.  

Membrane protein function is regulated by the cell membrane lipid composition. This video-article details how to form a patch using bilayer patch electrodes, as well as how to use gramicidin channels as reporters of altered membrane properties.

이중층 탄성 등록 정보 모니터링 변경에 대한 단일 분자 방법

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein ...

연구

생물학

Combining QD-FRET and Microfluidics to Monitor DNA Nanocomplex Self-Assembly in Real-Time

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically functional inside the cell, nucleic acid-based therapeutics require an efficient intracellular delivery system. One widely adopted approach is to complex DNA with a gene carrier to form nanocomplexes via electrostatic self-assembly, facilitating cellular uptake of DNA while protecting it against degradation. The challenge lies in the rational design of efficient gene carriers, since premature dissociation or overly stable binding would be detrimental to the cellular uptake and therapeutic efficacy. Nanocomplexes synthesized by bulk mixing showed a diverse range of intracellular unpacking and trafficking behavior, which was attributed to the heterogeneity in size and stability of nanocomplexes. Such heterogeneity hinders the accurate assessment of the self-assembly kinetics and adds to the difficulty in correlating their physical properties to transfection efficiencies or bioactivities. We present a novel convergence of nanophotonics (i.e. QD-FRET) and microfluidics to characterize the real-time kinetics of the nanocomplex self-assembly under laminar flow. QD-FRET provides a highly sensitive indication of the onset of molecular interactions and quantitative measure throughout the synthesis process, whereas microfluidics offers a well-controlled microenvironment to spatially analyze the process with high temporal resolution (~milliseconds). For the model system of polymeric nanocomplexes, two distinct stages in the self-assembly process were captured by this analytic platform. The kinetic aspect of the self-assembly process obtained at the microscale would be particularly valuable for microreactor-based reactions which are relevant to many micro- and nano-scale applications. Further, nanocomplexes may be customized through proper design of microfludic devices, and the resulting QD-FRET polymeric DNA nanocomplexes could be readily applied for establishing structure-function relationships. 

We present a novel and powerful integration of nanophotonics (QD-FRET) and microfluidics to investigate the formation of polyelectrolyte polyplexes, which is expected to provide better control and synthesis of uniform and customizable polyplexes for future nucleic acid-based therapeutics.

결합 QD - 걱정과 Microfluidics 실시간으로 DNA의 Nanocomplex 자체 어셈블리를 모니터하기 위해

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically ...

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides (Figure 1). The growing product double-strand DNA (dsDNA) is extended with laminar flow and visualized by using an intercalating dye. Measuring the position of the growing DNA end in real time allows precise determination of replication rate (Figure 2). Furthermore, the length of completed DNA products reports on the processivity of replication. This experiment can be performed very easily and rapidly and requires only a fluorescence microscope with a reasonably sensitive camera.


This protocol demonstrates a simple single-molecule fluorescence microscopy technique for visualizing DNA replication by individual replisomes in real time.

형광 현미경과 함께 머릿속으로 단일 분자의 DNA 복제

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

표면 고정화 Biomolecules의 단일 분자 형광 측정을위한 자동화된 시스템

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. Linearized &lambda; DNA is modified to have a biotin on the end of one strand, and a digoxigenin moiety on the other end of the same strand. The biotinylated end is attached to a functionalized glass coverslip and the digoxigeninated end to a small bead. The assembly of these DNA-bead tethers on the surface of a flow cell allows a laminar flow to be applied to exert a drag force on the bead. As a result, the DNA is stretched close to and parallel to the surface of the coverslip at a force that is determined by the flow rate (Figure 1). The length of the DNA is measured by monitoring the position of the bead. Length differences between single- and double-stranded DNA are utilized to obtain real-time information on the activity of the replication proteins at the fork. Measuring the position of the bead allows precise determination of the rates and processivities of DNA unwinding and polymerization (Figure 2).

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system.

효소 복제 DNA의 직접 관찰 어세을 스트레칭 단일 분자 DNA를 사용하여

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

Single-Molecule Imaging of Nuclear Transport

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the last decade. The investigation of molecular interactions with high temporal and spatial resolutions deep within cells has remained challenging due to the inherently weak signals arising from individual molecules. Recent works by Yang et al. demonstrated that narrow-field epifluorescence microscopy allows visualization of nucleocytoplasmic transport at the single molecule level. By the single molecule approach, important kinetics, such as nuclear transport time and efficiency, for signal-dependent and independent cargo molecules have been obtained. Here we described a protocol for the methodological approach with an improved spatiotemporal resolution of 0.4 ms and 12 nm. The improved resolution enabled us to capture transient active transport and passive diffusion events through the nuclear pore complexes (NPC) in semi-intact cells. We expect this method to be used in elucidating other binding and trafficking events within cells.

Single molecule microscopy approch provided novel insights into nuclear transport.

원자력 교통 단일 분자 이미징

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the ...

Monitoring Kinase and Phosphatase Activities Through the Cell Cycle by Ratiometric FRET

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such probes typically consist of variants of CFP and YFP, intervened by a phosphorylatable sequence and a phospho-binding domain. Upon phosphorylation, the probe changes conformation, which results in a change of the distance or orientation between CFP and YFP, leading to a change in FRET efficiency (Fig 1). Several probes have been published during the last decade, monitoring the activity balance of multiple kinases and phosphatases, including reporters of PKA2, PKB3, PKC4, PKD5, ERK6, JNK7, Cdk18, Aurora B9 and Plk19. Given the modular design, additional probes are likely to emerge in the near future10. 
Progression through the cell cycle is affected by stress signaling pathways 11. Notably, the cell cycle is regulated differently during unperturbed growth compared to when cells are recovering from stress12.Time-lapse imaging of cells through the cell cycle therefore requires particular caution. This becomes a problem particularly when employing ratiometric imaging, since two images with a high signal to noise ratio are required to correctly interpret the results. Ratiometric FRET imaging of cell cycle dependent changes in kinase and phosphatase activities has predominately been restricted to sub-sections of the cell cycle8,9,13,14.
Here, we discuss a method to monitor FRET-based probes using ratiometric imaging throughout the human cell cycle. The method relies on equipment that is available to many researchers in life sciences and does not require expert knowledge of microscopy or image processing.

FRET-based reporters are increasingly used to monitor kinase and phosphatase activities in live cells. Here we describe a method on how to use FRET-based reporters to assess cell cycle-dependent changes in target phosphorylation.

안달 Ratiometric하여 세포주기를 통해 키나제와 인산 가수 분해 효소 활동을 모니터링

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such ...

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage (CoTrAC)

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method makes it possible to count the numbers of protein molecules produced in one cell during sequential, five-minute time windows. It requires a fluorescence microscope with laser excitation power density of ~0.5 to 1 kW/cm2, which is sufficiently sensitive to detect single fluorescent protein molecules in live cells. The fluorescent reporter used in this method consists of three parts: a membrane targeting sequence, a fast-maturing, yellow fluorescent protein and a protease recognition sequence. The reporter is translationally fused to the N-terminus of a protein of interest. Cells are grown on a temperature-controlled microscope stage. Every five minutes, fluorescent molecules within cells are imaged (and later counted by analyzing fluorescence images) and subsequently photobleached so that only newly translated proteins are counted in the next measurement.
Fluorescence images resulting from this method can be analyzed by detecting fluorescent spots in each image, assigning them to individual cells and then assigning cells to cell lineages. The number of proteins produced within a time window in a given cell is calculated by dividing the integrated fluorescence intensity of spots by the average intensity of single fluorescent molecules. We used this method to measure expression levels in the range of 0-45 molecules in single 5 min time windows. This method enabled us to measure noise in the expression of the &lambda; repressor CI, and has many other potential applications in systems biology.

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage CoTrAC

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC), to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method has been used to follow the stochastic expression dynamics of a transcription factor, the &lambda; repressor CI 1.

유전자 규정의 단일 분자 이미징<em&gt; 생체에</em&gt; 절단하여 Cotranslational 인증 (CoTrAC)를 사용

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells ...

Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable.

Here we describe the instrumentation and methods for detecting single fluorescently-labeled protein molecules interacting with a single DNA molecule suspended between two optically trapped microspheres.

단백질-DNA 상호 작용의 연구에 대한 단일 분자 조작 및 이미지를 결합

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method ...

FRET Imaging in Three-dimensional Hydrogels

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly employ two-dimensional (2D) culture, which does not mimic the three-dimensional (3D) cellular microenvironment. A method to perform quenched emission FRET imaging using conventional widefield epifluorescence microscopy of cells within a 3D hydrogel environment is presented. Here an analysis method for ratiometric FRET probes that yields linear ratios over the probe activation range is described. Measurement of intracellular cyclic adenosine monophosphate (cAMP) levels is demonstrated in chondrocytes under forskolin stimulation using a probe for EPAC1 activation (ICUE1) and the ability to detect differences in cAMP signaling dependent on hydrogel material type, herein a photocrosslinking hydrogel (PC-gel, polyethylene glycol dimethacrylate) and a thermoresponsive hydrogel (TR-gel). Compared with 2D FRET methods, this method requires little additional work. Laboratories already utilizing FRET imaging in 2D can easily adopt this method to perform cellular studies in a 3D microenvironment. It can further be applied to high throughput drug screening in engineered 3D microtissues. Additionally, it is compatible with other forms of FRET imaging, such as anisotropy measurement and fluorescence lifetime imaging (FLIM), and with advanced microscopy platforms using confocal, pulsed, or modulated illumination.

F&#246;rster resonance energy transfer (FRET) imaging is a powerful tool for real-time cell biology studies. Here a method for FRET imaging cells in physiologic three-dimensional (3D) hydrogel microenvironments using conventional epifluorescence microscopy is presented. An analysis for ratiometric FRET probes that yields linear ratios over the activation range is described.

3 차원 히드로 겔의 이미지를 FRET

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly ...