Ringraziamo James Waters, Gable Wadsworth e Bo Broadwater per criticamente la lettura del manoscritto. Ringraziamo anche quattro revisori anonimi per fornire commenti utili. Noi riconosciamo il sostegno finanziario Georgia Institute of Technology, il Burroughs Wellcome Fund Award Career l&#39;interfaccia scientifico, e la borsa di rete di ricerca studente dalla NSF Fisica dei sistemi viventi.

1. Preparazione dsDNA campione <ol><li> Progettare DNA curve globalmente ripetendo una sequenza di 10-mer. Ad esempio, 5&#39;-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCC X) 7 - TTTCATTCGAGCTCGTTGTTG-3 &#39;è un DNA curvo 186-bp, dove X è una base supplementare casuale e la sequenza fiancheggiante la sequenza ripetuta 10-mer sono sequenze adattatore. NOTA:. In questo esempio 15 sono stati scelti due 10-mers con preferenze opposte alla formazione dei nucleosomi sulla base di una larga scala studio occupazione nucleosomi da Kaplan et al. Poiché la ripetizione dell&#39;elica di dsDNA è vicino a 10 bp, qualsiasi deviazione netto dell&#39;asse elicoidale del 10-mer si accumulerà per produrre una forma ad arco di cerchio (Figura 3A). Poiché il periodo elicoidale è più vicino a 10,5 bp, una base supplementare è inserito dopo ogni due ripetizioni di mantenere la struttura curva come planare possibile. Queste sequenze più brevi di 200 bp possono essere ordinati da companies che offrono gene servizio di sintesi. E &#39;conveniente per affiancare queste sequenze con sequenze adattatori comuni per i passi successivi. La procedura è schematizzata in Figura 3B. </li><li> Eseguire la PCR con Primer 1 (GTGCCAGCAACAGATAGC) e Primer 2 (/ 5Cy3/TAAATTCCTACAACAACGAGCTCGAATG). NOTA: Primer 2 è etichettato con il Cy3 donatore FRET all&#39;estremità 5 &#39;. Una tipica ricetta PCR e protocollo di ciclismo sono presentati nelle tabelle 1 e 2. </li><li> Eseguire la PCR con Primer 3 (/ 5BioTEG/GAAACATAG/iCy5/GAATTTACCGTGCCAGCAACAGATAGC) e Primer 4 (CAACAACGAGCTCGAATG). NOTA: Primer 3 è etichettato con l&#39;accettante Cy5 FRET attraverso la spina dorsale e la biotina-linker all&#39;estremità 5 &#39;. PCR ricetta e il protocollo ciclismo sono come sopra. </li><li> Purificare i prodotti di PCR utilizzando un kit di pulizia PCR. </li><li> Mescolare il prodotto Cy3 marcato e il prodotto Cy5 marcato in un buffer di scambio strand (NaCl 100 mM, 10 mM Tris-HCl pH 7,0, 1 mM EDTA) a concentrazioni finali di 0,4 &amp;# 181, M e 0,1 micron, rispettivamente. NOTA: L&#39;eccesso Cy3-DNA aumenta la concentrazione del duplex trasportare sia Cy3 e Cy5 per effetto dello scambio filamento. </li><li> Scambio trefoli incubando a 98,5 ° C per 2 min, gradualmente raffreddamento a 5 ° C con velocità di rampa di 0,1 ° C / sec, e incubando a 5 &#160; ° C per 2 ore. </li></ol> 2. Elettroforesi su gel per rilevare dsDNA curvatura <ol><li> Versare il gel poliacrilammide 16,17 mescolando acrilammide e soluzioni bis-acrilammide a 29.2:0.8 rapporto, 5% (w / v) in 1X Tris / Borato / EDTA (TBE) tampone a pH 8,0. Nota: 10 ml di soluzione di gel contiene: 1.217 ml 40% di acrilammide, 0.667 ml 2% bis-acrilammide, 1 ml di TBE 10X, 100 L persolfato di ammonio (APS) 10%, 10 L TEMED, e il resto è dH 2 O. Solidificazione completa del gel dura circa 30 min. </li><li> Caricare il gel di poliacrilammide con campioni di DNA e il DNA ladder in 1X tampone di caricamento (5% glicerolo, 0,03% (w / v) di bromofenolo blue) ed eseguire il gel a 5-8 V / cm a 4 ° C per 45 minuti o fino a quando il fronte del colorante si avvicina alla fine del gel. </li><li> Macchiare il gel utilizzando tampone 1X TBE contenente 0,5 g / ml di etidio bromuro per 30 min. Identificare le bande di DNA sotto illuminazione UV. Confronta le posizioni di banda con il marcatore di formato (100 bp DNA ladder) per calcolare le dimensioni apparenti delle molecole di DNA. NOTA: curvo DNA generalmente si muovono più lentamente rispetto DNA dritto. </li></ol> 3. Flusso Preparazione cellulare <ol><li> Praticare 6-7 coppie di fori lungo due lati opposti di un vetrino (3&#39;&#39; x 1&#39;&#39;) utilizzando un trapano a colonna e punte di diamante. Dopo la foratura, strofinare lo scivolo in acqua corrente per eliminare polvere di vetro visibile. NOTA: I fori servono come ingressi di perfusione e punti vendita. Durante la perforazione, raffreddando il vetrino con acqua è importante per evitare fessurazioni. </li><li> Porre i vetrini in posizione verticale in un barattolo di vetro e riempirlo con acqua. Ultrasuoni per 15 min e trasferirli in un altro vaso di vetro dedicated per pulizia acetone. Riempire con acetone e ultrasuoni per 15 min. Sciacquare i vetrini con etanolo utilizzando un flacone spray e poi con acqua. Metterli in un barattolo di polipropilene, riempirlo con idrossido di potassio 5 M, e ultrasuoni per 15 min. Infine, sonicare i vetrini in acqua per 15 minuti. Pulire i coprioggetti (n. 1, 24 x 40 mm) utilizzando lo stesso protocollo. NOTA: diapositive e vetrini puliti possono essere memorizzati in dH 2 O per l&#39;uso a lungo termine. </li><li> Mescolare 1 mg di biotina-PEG-silano (MW 3400) con 80 mg di MPEG-silano (MW 2000) in 340 L di soluzione di bicarbonato 0,1 M di sodio. Mescolare bene e centrifugare la miscela brevemente per sbarazzarsi di bolle. NOTA: La funzionalizzazione della superficie con polietilene glicole (PEG) aiuta a ridurre il legame non specifico del DNA alla superficie. </li><li> Mettere 80 L della soluzione di PEG in ogni diapositiva e abbassare delicatamente un coprioggetto su di esso. Attendere 45 min. Separare il vetrino dalla diapositiva con le pinzette, sciacquare con abbondante dH 2 O e lasciare torlo asciugare all&#39;aria aperta. </li><li> Mettere sottili strisce di nastro biadesivo in tutta la diapositiva di formare canali. Allineare un coprioggetto su di esso e premere con decisione il vetrino contro la diapositiva di formare canali a tenuta stagna. Utilizzare 5 minuti epossidica per sigillare i bordi dei canali. </li></ol> 4. Preparazione della Soluzione Trolox <ol><li> Mettere ~ 30 mg Trolox e 10 ml di dH 2 O in un pallone e utilizzare una barra di magnete scalpore per mescolare la soluzione all&#39;aria aperta per 18 ore. </li><li> Filtrare la soluzione con un filtro da 0,2 micron e regolare il pH a 7 con l&#39;aggiunta di ~ 6 microlitri di 1 base M Tris (pH 11). Nota: Trolox è un reagente anti-lampeggiante che viene comunemente usato in singola molecola studi 18. L&#39;azione antiscolorimento di Trolox deriva dal suo derivato ossidato che è presente in parzialmente degradata soluzione Trolox 19. Sciogliendo rapidamente Trolox in metanolo o ad alto pH della soluzione Tris deve essere evitato a causa dell&#39;ossidazione inefficiente. </li></ol> 5. Single-molImaging ecule <ol><li> Iniettare 15 ml di soluzione NeutrAvidin (0,5 mg / ml) nel canale e attendere 2 minuti prima di risciacquare con 100 microlitri di tampone T50 (10 mM Tris-HCl, 50 mM NaCl, pH 7,0). </li><li> Iniettare 50 ml di campione di DNA (50-100 pM) nel canale. Attendere 5 minuti e risciacquare il DNA non legato via con 100 L di tampone T50. NOTA: molecole di DNA saranno specificatamente legarsi alla superficie attraverso l&#39;interazione NeutrAvidin-biotina. </li><li> Riempire il canale con il buffer di imaging che contiene un sistema che assorbe ossigeno 20 (PCD 100 mM, 5 mM PCA, 1 Trolox mM e NaCl 500 mM). </li><li> Impostare la EMCCD in modalità a trasferimento di quadro per lo streaming di 2 x 2 immagini categorizzate (256 x 256) al computer a 25 fotogrammi al secondo. </li><li> Mettete l&#39;olio per immersione sull&#39;obiettivo microscopio, e fissare la cella di flusso sul palco microscopio utilizzando clip campioni. Coarse-regolare il fuoco osservando il modello riflessione laser sulla parete. Fine-regolare la messa a fuoco utilizzando la visualizzazione in tempo reale della fluorescenza imetà sul monitor. </li><li> Iniziare acquisizione dati con il laser 532 nm su. Controllare il live view e regolare la messa a fuoco, se necessario. Smettere di acquisizione dati quando la maggior parte delle molecole sono fotodecolorate. NOTA: In questa struttura, viene utilizzato un programma-lab scritta C per controllare il microscopio e visualizzare le immagini in diretta sul monitor in quanto vengono salvati sul disco rigido. </li></ol> 6. Elaborazione delle immagini e analisi dei dati NOTA: Una serie temporale di 256 x 256 le immagini vengono elaborate da un codice MATLAB per generare singola molecola tempo tracce di Cy3 e Cy5 intensità. Per accoppiare pixel tra il canale donatore e accettore canale dell&#39;immagine split-view, 6-7 coppie di Cy3 e Cy5 macchie, ciascuna coppia dalla stessa molecola uniformemente dispersa attraverso il campo di vista, vengono raccolte manualmente, e una trasformazione affine viene calcolato utilizzando le coordinate di questi punti come punti di ancoraggio. <ol><li> Utilizzo di uno script MATLAB, guardare attraverso tutti i tempi singola molecola tracce tcappello mostrano più transizioni tra i segnali alte e basse tasto. Identificare gli stati in loop e in loop. NOTA: Il segnale FRET è definita come l&#39;intensità Cy5 (I a) diviso per la somma di Cy3 e Cy5 intensità (I a + I d). Stato Looped ha un alto valore FRET mentre lo stato in loop ha un valore basso FRET. L&#39;istogramma dei segnali FRET da una singola molecola è bimodale distribuito a causa di looping reversibile e unlooping. </li><li> Trova la soglia che separa le due distribuzioni determinando l&#39;intersezione tra le due curve gaussiane muro. </li><li> Calcolare l&#39;efficienza FRET come <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq7.jpg" /> e assegnare gli stati ansa con alti valori di FRET e gli stati in loop con valori bassi FRET. </li><li> Utilizzo di uno script MATLAB, analizzare il numero cumulativo di molecole (N (t)), che in loop (oraggiunto lo stato alto FRET) a diversi time-lapse da inizio acquisizione dati. NOTA: Dal momento che una molecola di dsDNA può iniziare in qualsiasi conformazione dello stato in loop all&#39;inizio di acquisizione dati, il tasso di aumento della popolazione loop riflette il tasso medio di ciclo media di oltre conformazioni iniziali. Estrarre il looping ciclo tasso k montando N (t) con una funzione esponenziale: <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq1.jpg" /> Se aumenta bifasico, può essere dotato di una doppia funzione esponenziale: <img fo:content-width="2.2in" src="/files/ftp_upload/51667/eq2.jpg" /> In questo caso, k ciclo è ottenuta da: <img fo:content-width="1.7in" src="/files/ftp_upload/51667/eq3.jpg" /> NOTA: Teoricamente, la probabilità di sopravvivenza che un polimero non ha loop al tempo t non è una singola o doppia funzione esponenziale 12. FITT esponenzialeING è usato come un mezzo pratico per estrarre il tempo medio looping. </li></ol> 7. Determinazione del fattore J NOTA: Il fattore J rappresenta come concentrato un&#39;estremità di un dsDNA è intorno all&#39;altra estremità. Può essere determinato interpolando la concentrazione di una estremità del segmento di DNA che produrrebbe la stessa velocità di reazione con l&#39;altra estremità segmento come tasso loop misurata. Sperimentalmente, un segmento finale viene immobilizzato sulla superficie, e l&#39;altra estremità segmento viene introdotto ad una certa concentrazione c. Se il tasso di ricottura misurata tra le due estremità è k ricottura, allora il fattore J 21 è dato da <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq4.jpg" /> . La costante di velocità di ricottura (k = k ricottura ricottura / C) è indipendente dalla concentrazione sonda. <ol><li> Flusso 20 l di 30-50 pM biotina-Cy5 oligo (Primer 3) into un canale NeutrAvidin rivestita. Sciacquare il canale con 100 microlitri T50 per lavare via oligo non legato. </li><li> Preparare il tampone di imaging come descritto nella parte 5 con l&#39;aggiunta di Cy3 oligo (Primer 2) ad una concentrazione finale di 50 nM. Flusso questo buffer di imaging nel canale. </li><li> Pur mantenendo il laser 532 nm su, girare brevemente il laser 640 nm a identificare le posizioni di associazione superficie Cy5 oligo. Spegnere il laser 640 nm e iniziare a monitorare il segnale FRET. NOTA: Su ibridazione di un oligo Cy3 ad un Cy5 oligo-bound superficie, Cy5 fluorescenza derivare da FRET. </li><li> Utilizzo di uno script MATLAB, analizzare il numero di molecole che si aprono nello stato non legato (bassa intensità Cy5) ma poi si trasformano in stato (intensità alta Cy5) ricotto in funzione del tempo per l&#39;intensità tracce Cy5. </li><li> Tracciare questo numero di molecole vs tempo ricottura. Montare questa curva con una singola funzione esponenziale ( <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq5.jpg"/&gt;) Per ottenere il tasso di ricottura (k tempra). </li><li> Ripetere questo esperimento a diverse concentrazioni Cy3 oligo (60, 100 e 180 nm) per confermare la linearità tra il tasso di ricottura e la concentrazione reagente. Estrarre la costante di velocità di ricottura secondo ordine (k tempra ) Dal pendio. </li><li> Calcolare il fattore J da <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq6.jpg" /> , Dove k ciclo è il tasso loop misurata nelle stesse condizioni buffer. </li></ol>

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

Gli autori dichiarano assenza di conflitti di interesse.

Un semplice test single-molecule basato su FRET è stato usato per studiare la cinetica di loop di DNA di diverse forme intrinseche. DNA curve possono essere preparati ripetendo una sequenza di 10-mer in fase con il periodo elicoidale di 10,5 bp, e le curvature possono essere stimati usando PAGE. Questi dsDNAs sono progettati con le estremità adesive per permettere la stabilizzazione ciclo transitorio. Abbiamo estratto il tasso loop dalla crescita esponenziale del numero di molecole in loop nel tempo. La costante di ve...

Comprendere le proprietà meccaniche di dsDNA è di fondamentale importanza nelle scienze di base e applicazioni di ingegneria. La struttura di dsDNA è più complicato di una scala elicoidale dritto, perché angoli di rollio, inclinazione e torsione tra coppie di basi successive possono variare con la sequenza. Fluttuazioni termiche possono causare dsDNA di sottoporsi a diversi modi di fluttuazioni conformazionali come la flessione, torsione e stretching. Transizioni come fusione e attorcigliamenti possono verificarsi anche in condizioni estreme. Tra questi movimenti, dsDNA flessione ha l&#39;impatto biologico più evidente 1. dsDNA piegatura è associato repressione genica o attivazione portando due siti distanti vicini tra loro. Esso gioca un ruolo importante nella confezione DNA all&#39;interno del nucleo cellulare o un capside virale. Deformazione piegatura di dsDNA possono essere visualizzati sperimentalmente microscopia ad alta risoluzione (AFM 2 e 3 TEM), e il Thermodynamics e cinetiche possono essere studiati mediante saggi di looping, che legano chimicamente siti giustapposte del dsDNA. Un tale saggio è ligasi-dipendente ciclizzazione 4. In questo saggio, le molecole di dsDNA con (coesivi) estremita &#39;adesive&#39; sono circolarizzato o dimerizzate da DNA ligasi. Confrontando i tassi di cerchio e la formazione di dimeri, si può ottenere una concentrazione molare efficace di una delle estremità del DNA in prossimità dell&#39;altra estremità, che è conosciuto come il fattore J. Questo fattore J è dimensionalmente equivalente alla densità di probabilità di trovare una estremità del DNA a breve distanza dall&#39;altra estremità, e riflette quindi la flessibilità del DNA. Misurare il fattore J in funzione della lunghezza del DNA rivela molte caratteristiche di meccanica DNA compresa la lunghezza di persistenza 4,5. La catena vermiforme (WLC) modello è stato ampiamente considerato come il modello di polimero canonico per la meccanica dsDNA in base al suo successo nel spiegazioneining le curve forza-estensione ottenuti in DNA tirare esperimenti 6, e correttamente predire i fattori di J dsDNAs più di 200 bp 7. Tuttavia, utilizzando il test ciclizzazione su molecole dsDNA più brevi 100 bp, Cloutier e Widom misurato i fattori J di essere diversi ordini di grandezza superiori rispetto al modello WLC previsione 8. Un anno dopo, Du et al. prodotta fattori J in accordo con il modello WLC utilizzando il test ciclizzazione con concentrazioni più basse di ligasi e attribuito il risultato anomalo dal gruppo Widom ad alte concentrazioni ligasi utilizzati 9. Questa controversia esemplifica l&#39;influenza inevitabile di DNA ligasi sulla cinetica di ciclizzazione quando si utilizza il test convenzionali 9. Inoltre, DNA ligasi può anche influenzare la struttura del DNA e la rigidità attraverso legame non specifico 10,11. Per eliminare le preoccupazioni tecniche di analisi looping proteina-dipendente, abbiamo recentemente dimostrato una prottest looping ein-libero basato sul Fluorescence Resonance Energy Transfer (FRET) 12. In questo metodo, conformazioni loop vengono rilevati dal FRET tra donatore e accettore divisoria in prossimità delle estremità appiccicose di una molecola di DNA. Un microscopio a fluorescenza a riflessione interna totale obiettivo di tipo (TIRFM) viene utilizzato per registrare traiettorie di ciclaggio reversibile e eventi unlooping di molecole di DNA a singola superficie immobilizzato per un periodo prolungato di tempo. Questo metodo offre assemblaggio basato su PCR di molecole di DNA per generare molecole di DNA senza disadattamento, che è un miglioramento fondamentale per un metodo simile per Vafabakhsh e Ha 13. L&#39;aspetto unico molecola di questo protocollo permette misura delle distribuzioni oltre Ensemble medie mentre l&#39;aspetto FRET permette di misurare la dinamica di ciclica DNA ripetutamente dalla stessa molecola, anche in condizioni che possono alterare ligasi attività. La configurazione TIRFM è mostrato in Figura 1. A personalizzatoPortaoggetti progettato è posto sopra un corpo del microscopio Olympus IX61. 532 nm e 640 nm laser vengono introdotti dal lato e sono riflessi da specchi ellittici minuscoli 14 nella alta obiettivo NA per ottenere l&#39;angolo di incidenza critico all&#39;interfaccia coprioggetto-acqua. Notiamo che più diffusa passante obiettivo TIR utilizzando specchi dicroici o configurazioni TIR basato prisma può essere utilizzato anche per questa applicazione FRET. L&#39;immagine di fluorescenza formata dal microscopio è suddiviso in immagini donatore e accettore da uno specchio dicroico. Vengono poi ri-masterizzata su due metà di un EMCCD. Ulteriori filtri di emissione passa-lungo sono utilizzati per ridurre segnale di fondo. Il controllo della temperatura è essenziale per acquisire dati cinetici riproducibili. Per il controllo della temperatura, l&#39;obiettivo è separato dal boccaglio del corpo del microscopio per ridurre al minimo il trasferimento di calore, e l&#39;acqua da un raffreddatore / riscaldatore di temperatura controllata è distribuito attraverso un collare di ottone che si adatta strettamenteattorno al metallo interno sotto la giacca obiettivo. Questa configurazione è in grado di ottenere il controllo della temperatura solido a superficie coprioggetto tra 15 e 50 ° C (Figura 2). In questo lavoro, la temperatura del campione è stata mantenuta a 24 ° C. Il protocollo seguente presenta la procedura step-by-step per la costruzione del DNA, la stima di forma del DNA, esperimento di singola molecola, e J determinazione fattore.

<table border="0" cellpadding="0" cellspacing="0" width="793">
	<tbody>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Small DNA FRAG Extract Kit-100PR</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97060-558</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Acrylamide 40% solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97064-522</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Bis-acrylamide 2% (w/v) solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97063-948</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">GeneRuler 100 bp DNA Ladder, 100-1000 bp</td>
			<td style="width:124px;">Fermentas</td>
			<td>SM0241</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Mini Vertical PAGE System</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">89032-300</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Syringe filter 0.2um CS50</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Trolox</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">238813-1G</td>
			<td>triplet state quencher</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuic acid (PCA)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">08992-50MG</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuate 3,4-Dioxygenase (PCD)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">P8279-25UN</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">mPEG-silane, MW 2000 1g</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">MPEG-SIL-2000-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Biotin-PEG-Silane, MW 3400</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">Biotin-PEG-SIL-3400-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Avidin, NeutrAvidin Biotin-binding Protein</td>
			<td style="width:124px;">Invitrogen</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Phusion Hot Start High-Fidelity DNA Polymerase</td>
			<td style="width:124px;">New England Biolabs</td>
			<td style="width:135px;">F-540L</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Gel/PCR DNA Fragments Extraction Kit</td>
			<td>IBI Scientific</td>
			<td>IB47020</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Premium plain glass microscope slides</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;">12-544-1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">VWR micro cover glass, rectangular, no. 1</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">48404-456</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fisher Scientific Isotemp 1006s Recirculating Chiller/Heater</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;"></td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective Cooling Collar</td>
			<td style="width:124px;">Bioptechs</td>
			<td style="width:135px;">150303</td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">KMI53 Biological Micrometer Measuring Stage</td>
			<td style="width:124px;">Semprex</td>
			<td style="width:135px;">KMI53</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">High Performance DPSS Laser 532nm 50mW&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">NT66-968</td>
			<td>Cy3 excitation</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:351px;">CUBE Fiber Pigtailed 640 nm, 30mW, Fiber, FC/APC Connector</td>
			<td style="width:124px;">Coherent</td>
			<td style="width:135px;">1139604</td>
			<td>Cy5 excitation</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">650 nm BrightLine Dichroic Beamsplitter</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">FF650-Di01-25x36</td>
			<td>splitting dichroic</td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:351px;">LaserMUX Beam Combiner, reflects 514.5, 532, &#38; 543.5 nm lasers, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">LM01-552-25</td>
			<td>combining dichroic</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Brightline Fluorescence Filter 593/40</td>
			<td style="width:124px;">Semrock</td>
			<td>FF01-593/40-25</td>
			<td>Cy3 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">635 nm EdgeBasic LWP longpass Filter, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">BLP01-635R-25</td>
			<td>Cy5 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">EMCCD iXon+</td>
			<td style="width:124px;">Andor Technology</td>
			<td style="width:135px;">DU-897E-CS0-#BV</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">IX51 inverted microscope frame</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective UApo N 100x/1.49 Oil TIRF</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Immersion oil type-F for fluorescence microscopy</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;">IMMOIL-F30CC</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">2mm Diameter 45&#176; Rod Lens Aluminum Coated&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">54-092</td>
			<td>miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">1/4&#34; Travel Single-Axis Translation Stage</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">MS-1</td>
			<td>translation of miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">&#216;1&#34; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-200-A</td>
			<td>focusing lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Adjustable Mechanical Slit</td>
			<td style="width:124px;">Thorlabs</td>
			<td>VA100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dielectric Mirror</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">BB1-E02</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">&#216;1&#34; Achromatic Doublet, f = 100 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-100-A</td>
			<td>relay lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Lens Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LMR1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dichroic Filter Mount</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">FFM1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fixed Cage Cube Platform</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">B3C</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Kinematic Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">KM100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lens, &#216;1&#34;, f = 40 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1422-A</td>
			<td>collimating lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 15 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1222-A</td>
			<td>telescope lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 150 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1433-A</td>
			<td>telescope lens</td>
		</tr>
	</tbody>
</table>

studying dna looping by single-molecule fret

Curvatura del DNA a doppia elica (dsDNA) è associato con molti importanti processi biologici quali il riconoscimento DNA-proteine ​​e confezionamento DNA in nucleosomi. Termodinamica di dsDNA curvatura è stata studiata da un metodo chiamato ciclizzazione che si basa sul DNA ligasi di unirsi covalentemente brevi estremità coesive di un dsDNA. Tuttavia, l&#39;efficienza legatura può essere influenzata da molti fattori che non sono legati a dsDNA loop come la struttura del DNA che circonda le estremità appiccicose uniti, e ligasi può anche influenzare il tasso looping apparente attraverso meccanismi quali il legame non specifico. Qui mostriamo come misurare dsDNA cinetica looping senza ligasi rilevando formazione transitoria ciclo DNA mediante FRET (Fluorescence Resonance Energy Transfer). molecole di dsDNA sono costruiti utilizzando un protocollo basato su PCR semplice con un paio FRET e un linker biotina. La densità di probabilità loop noto come fattore J viene estratto dal prezzo loop e il tasso di ricottura tra due sezionatoreTed estremità appiccicose. Testando due dsDNAs con curvature diverse intrinseche, mostriamo che il fattore J è sensibile alla forma intrinseca del dsDNA.

Molecole di DNA utilizzati per lo studio loop consistono in una regione duplex di sequenza e lunghezza variabile e sporgenze a singolo filamento che sono complementari tra loro. Le sporgenze, che sono lunghe 7-base, possono ricombinarsi tra loro per acquisire lo stato in loop. Ogni sbalzo contiene sia Cy3 o Cy5 che è collegato nella spina dorsale del DNA attraverso la chimica amidite. Il Cy5-sporgenza è anche collegata con biotina-TEG (15-atomo Tetra-glicole etilenico distanziale) per l&#39;immobilizzazione di superfi...

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

Questo studio presenta una procedura sperimentale dettagliato per misurare le dinamiche di loop di DNA a doppio filamento con singola molecola Fluorescence Resonance Energy Transfer (FRET). Il protocollo descrive inoltre come estrarre il ciclo di densità di probabilità chiamato il fattore J.

Studiare Looping DNA a singola molecola FRET

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

studying-dna-looping-by-single-molecule-fret

Research

JoVE Journal

Biology

15.3K Views.  Georgia Institute of Technology.  Questo studio presenta una procedura sperimentale dettagliato per misurare le dinamiche di loop di DNA a doppio filamento con singola molecola Fluorescence Resonance Energy Transfer (FRET). Il protocollo descrive inoltre come estrarre il ciclo di densità di probabilità chiamato il fattore J. 

Video: Studying DNA Looping by Single-Molecule FRET

Single Molecule Methods for Monitoring Changes in Bilayer Elastic Properties

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein interactions and more general lipid bilayer-protein interactions. These interactions are particularly important in pharmacological research, as many current pharmaceuticals on the market can alter the lipid bilayer material properties, which can lead to altered membrane protein function.   The formation of gramicidin channels are dependent on conformational changes in gramicidin subunits which are in turn dependent on the properties of the lipid.  Hence the gramicidin channel  current is a reporter of altered properties of the bilayer due to certain compounds.  

Membrane protein function is regulated by the cell membrane lipid composition. This video-article details how to form a patch using bilayer patch electrodes, as well as how to use gramicidin channels as reporters of altered membrane properties.

Metodi di singola molecola per monitorare l&#39;evoluzione a doppio strato: Proprietà meccaniche

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein ...

Ricerca

Biologia

Combining QD-FRET and Microfluidics to Monitor DNA Nanocomplex Self-Assembly in Real-Time

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically functional inside the cell, nucleic acid-based therapeutics require an efficient intracellular delivery system. One widely adopted approach is to complex DNA with a gene carrier to form nanocomplexes via electrostatic self-assembly, facilitating cellular uptake of DNA while protecting it against degradation. The challenge lies in the rational design of efficient gene carriers, since premature dissociation or overly stable binding would be detrimental to the cellular uptake and therapeutic efficacy. Nanocomplexes synthesized by bulk mixing showed a diverse range of intracellular unpacking and trafficking behavior, which was attributed to the heterogeneity in size and stability of nanocomplexes. Such heterogeneity hinders the accurate assessment of the self-assembly kinetics and adds to the difficulty in correlating their physical properties to transfection efficiencies or bioactivities. We present a novel convergence of nanophotonics (i.e. QD-FRET) and microfluidics to characterize the real-time kinetics of the nanocomplex self-assembly under laminar flow. QD-FRET provides a highly sensitive indication of the onset of molecular interactions and quantitative measure throughout the synthesis process, whereas microfluidics offers a well-controlled microenvironment to spatially analyze the process with high temporal resolution (~milliseconds). For the model system of polymeric nanocomplexes, two distinct stages in the self-assembly process were captured by this analytic platform. The kinetic aspect of the self-assembly process obtained at the microscale would be particularly valuable for microreactor-based reactions which are relevant to many micro- and nano-scale applications. Further, nanocomplexes may be customized through proper design of microfludic devices, and the resulting QD-FRET polymeric DNA nanocomplexes could be readily applied for establishing structure-function relationships. 

We present a novel and powerful integration of nanophotonics (QD-FRET) and microfluidics to investigate the formation of polyelectrolyte polyplexes, which is expected to provide better control and synthesis of uniform and customizable polyplexes for future nucleic acid-based therapeutics.

Combinando QD-FRET e microfluidica per il monitoraggio Nanocomplex DNA di auto-assemblaggio in tempo reale

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically ...

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides (Figure 1). The growing product double-strand DNA (dsDNA) is extended with laminar flow and visualized by using an intercalating dye. Measuring the position of the growing DNA end in real time allows precise determination of replication rate (Figure 2). Furthermore, the length of completed DNA products reports on the processivity of replication. This experiment can be performed very easily and rapidly and requires only a fluorescence microscope with a reasonably sensitive camera.


This protocol demonstrates a simple single-molecule fluorescence microscopy technique for visualizing DNA replication by individual replisomes in real time.

Visualizzazione singola molecola di DNA replica con microscopia a fluorescenza

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

Sistema automatico per le misure di fluorescenza singola molecola di superficie, immobilizzato Biomolecole

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. Linearized &lambda; DNA is modified to have a biotin on the end of one strand, and a digoxigenin moiety on the other end of the same strand. The biotinylated end is attached to a functionalized glass coverslip and the digoxigeninated end to a small bead. The assembly of these DNA-bead tethers on the surface of a flow cell allows a laminar flow to be applied to exert a drag force on the bead. As a result, the DNA is stretched close to and parallel to the surface of the coverslip at a force that is determined by the flow rate (Figure 1). The length of the DNA is measured by monitoring the position of the bead. Length differences between single- and double-stranded DNA are utilized to obtain real-time information on the activity of the replication proteins at the fork. Measuring the position of the bead allows precise determination of the rates and processivities of DNA unwinding and polymerization (Figure 2).

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system.

Osservazione diretta del DNA Enzimi Replica utilizzando un singolo-molecola di DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

Single-Molecule Imaging of Nuclear Transport

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the last decade. The investigation of molecular interactions with high temporal and spatial resolutions deep within cells has remained challenging due to the inherently weak signals arising from individual molecules. Recent works by Yang et al. demonstrated that narrow-field epifluorescence microscopy allows visualization of nucleocytoplasmic transport at the single molecule level. By the single molecule approach, important kinetics, such as nuclear transport time and efficiency, for signal-dependent and independent cargo molecules have been obtained. Here we described a protocol for the methodological approach with an improved spatiotemporal resolution of 0.4 ms and 12 nm. The improved resolution enabled us to capture transient active transport and passive diffusion events through the nuclear pore complexes (NPC) in semi-intact cells. We expect this method to be used in elucidating other binding and trafficking events within cells.

Single molecule microscopy approch provided novel insights into nuclear transport.

Singola molecola Imaging dei trasporti nucleari

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the ...

Monitoring Kinase and Phosphatase Activities Through the Cell Cycle by Ratiometric FRET

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such probes typically consist of variants of CFP and YFP, intervened by a phosphorylatable sequence and a phospho-binding domain. Upon phosphorylation, the probe changes conformation, which results in a change of the distance or orientation between CFP and YFP, leading to a change in FRET efficiency (Fig 1). Several probes have been published during the last decade, monitoring the activity balance of multiple kinases and phosphatases, including reporters of PKA2, PKB3, PKC4, PKD5, ERK6, JNK7, Cdk18, Aurora B9 and Plk19. Given the modular design, additional probes are likely to emerge in the near future10. 
Progression through the cell cycle is affected by stress signaling pathways 11. Notably, the cell cycle is regulated differently during unperturbed growth compared to when cells are recovering from stress12.Time-lapse imaging of cells through the cell cycle therefore requires particular caution. This becomes a problem particularly when employing ratiometric imaging, since two images with a high signal to noise ratio are required to correctly interpret the results. Ratiometric FRET imaging of cell cycle dependent changes in kinase and phosphatase activities has predominately been restricted to sub-sections of the cell cycle8,9,13,14.
Here, we discuss a method to monitor FRET-based probes using ratiometric imaging throughout the human cell cycle. The method relies on equipment that is available to many researchers in life sciences and does not require expert knowledge of microscopy or image processing.

FRET-based reporters are increasingly used to monitor kinase and phosphatase activities in live cells. Here we describe a method on how to use FRET-based reporters to assess cell cycle-dependent changes in target phosphorylation.

Monitoraggio Attività chinasi e fosfatasi attraverso il ciclo cellulare da raziometrica FRET

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such ...

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage (CoTrAC)

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method makes it possible to count the numbers of protein molecules produced in one cell during sequential, five-minute time windows. It requires a fluorescence microscope with laser excitation power density of ~0.5 to 1 kW/cm2, which is sufficiently sensitive to detect single fluorescent protein molecules in live cells. The fluorescent reporter used in this method consists of three parts: a membrane targeting sequence, a fast-maturing, yellow fluorescent protein and a protease recognition sequence. The reporter is translationally fused to the N-terminus of a protein of interest. Cells are grown on a temperature-controlled microscope stage. Every five minutes, fluorescent molecules within cells are imaged (and later counted by analyzing fluorescence images) and subsequently photobleached so that only newly translated proteins are counted in the next measurement.
Fluorescence images resulting from this method can be analyzed by detecting fluorescent spots in each image, assigning them to individual cells and then assigning cells to cell lineages. The number of proteins produced within a time window in a given cell is calculated by dividing the integrated fluorescence intensity of spots by the average intensity of single fluorescent molecules. We used this method to measure expression levels in the range of 0-45 molecules in single 5 min time windows. This method enabled us to measure noise in the expression of the &lambda; repressor CI, and has many other potential applications in systems biology.

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage CoTrAC

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC), to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method has been used to follow the stochastic expression dynamics of a transcription factor, the &lambda; repressor CI 1.

Singola molecola di imaging del regolamento Gene<em&gt; In vivo</em&gt; Utilizzo di attivazione Cotranslational da Cleavage (CoTrAC)

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells ...

Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable.

Here we describe the instrumentation and methods for detecting single fluorescently-labeled protein molecules interacting with a single DNA molecule suspended between two optically trapped microspheres.

Combinando singola molecola di manipolazione e di imaging per lo studio delle interazioni proteina-DNA

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method ...

FRET Imaging in Three-dimensional Hydrogels

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly employ two-dimensional (2D) culture, which does not mimic the three-dimensional (3D) cellular microenvironment. A method to perform quenched emission FRET imaging using conventional widefield epifluorescence microscopy of cells within a 3D hydrogel environment is presented. Here an analysis method for ratiometric FRET probes that yields linear ratios over the probe activation range is described. Measurement of intracellular cyclic adenosine monophosphate (cAMP) levels is demonstrated in chondrocytes under forskolin stimulation using a probe for EPAC1 activation (ICUE1) and the ability to detect differences in cAMP signaling dependent on hydrogel material type, herein a photocrosslinking hydrogel (PC-gel, polyethylene glycol dimethacrylate) and a thermoresponsive hydrogel (TR-gel). Compared with 2D FRET methods, this method requires little additional work. Laboratories already utilizing FRET imaging in 2D can easily adopt this method to perform cellular studies in a 3D microenvironment. It can further be applied to high throughput drug screening in engineered 3D microtissues. Additionally, it is compatible with other forms of FRET imaging, such as anisotropy measurement and fluorescence lifetime imaging (FLIM), and with advanced microscopy platforms using confocal, pulsed, or modulated illumination.

F&#246;rster resonance energy transfer (FRET) imaging is a powerful tool for real-time cell biology studies. Here a method for FRET imaging cells in physiologic three-dimensional (3D) hydrogel microenvironments using conventional epifluorescence microscopy is presented. An analysis for ratiometric FRET probes that yields linear ratios over the activation range is described.

FRET Imaging in idrogel tridimensionali

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly ...

Methods Article

Studiare Looping DNA a singola molecola FRET