Nous remercions James Waters, Gable Wadsworth et Bo Broadwater pour la lecture critique du manuscrit. Nous remercions également quatre évaluateurs anonymes pour leurs commentaires utiles. Nous reconnaissons l&#39;appui financier du Georgia Institute of Technology, le prix du Burroughs Wellcome Fund carrière à l&#39;interface scientifique, et la subvention du réseau de recherche de l&#39;étudiant de la NSF Physique des systèmes vivants.

1. Préparation ADN double brin de l&#39;échantillon <ol><li> Concevoir ADN courbes globalement en répétant une séquence de 10-mer. Par exemple 5&#39;-GTGCCAGCAACAGATAGC, - (TTTATCATCCTTTATCATCC X) 7 - TTTCATTCGAGCTCGTTGTTG-3 &#39;de l&#39;ADN est une courbe de 186 bp, où X est une base aléatoire supplémentaire et la séquence flanquant la séquence 10-mère sont des séquences de répétition adaptateur. REMARQUE:. Dans cet exemple, deux 10-mères ayant des préférences opposées à la formation nucléosome basé sur une grande échelle étude d&#39;occupation nucléosome par Kaplan et al 15 ont été choisis. Depuis la répétition hélicoïdale de l&#39;ADN bicaténaire est proche de 10 pb, toute déviation nette de l&#39;axe hélicoïdal de la 10-mer s&#39;accumule pour produire une forme d&#39;arc de cercle (figure 3A). Etant donné que la période hélicoïdale est plus proche de 10,5 pb, une base supplémentaire est inséré après tous les deux répétitions de conserver la structure recourbée comme plane que possible. Ces séquences plus courtes de 200 pb peuvent être commandés auprès de companies qui offre gène service de synthèse. Il est commode pour flanquer ces séquences avec des séquences d&#39;adaptation communes pour les étapes ultérieures. Le mode opératoire est schématisé sur la figure 3B. </li><li> Effectuer PCR avec l&#39;amorce 1 (GTGCCAGCAACAGATAGC) et l&#39;amorce 2 (/ 5Cy3/TAAATTCCTACAACAACGAGCTCGAATG). NOTE: Primer 2 est marqué avec le Cy3 donneur FRET à l&#39;extrémité 5 &#39;. Une recette typique de la PCR et le protocole de cyclage sont présentés dans les tableaux 1 et 2. </li><li> Faire la PCR Primer 3 (/ 5BioTEG/GAAACATAG/iCy5/GAATTTACCGTGCCAGCAACAGATAGC) et l&#39;amorce 4 (CAACAACGAGCTCGAATG). NOTE: Primer 3 est marqué avec l&#39;accepteur Cy5 FRET à travers la colonne vertébrale et la biotine-segment de liaison à l&#39;extrémité 5 &#39;. Recette PCR et le protocole de cyclisme sont comme ci-dessus. </li><li> Purifier les produits de la PCR en utilisant un kit de nettoyage de PCR. </li><li> Mélanger le produit marqué au Cy3 et Cy5 le produit marqué dans un tampon pour l&#39;échange de brin (100 mM de NaCl, 10 mM Tris-HCl pH 7,0, 1 mM EDTA) à des concentrations finales de 0,4 et# 181; M et 0,1 uM, respectivement. NOTE: Le Cy3-ADN en excès augmente la concentration du duplex portant à la fois Cy3 et Cy5 en tant que résultat de l&#39;échange de brin. </li><li> brins de change par incubation à 98,5 ° C pendant 2 min, refroidissement progressif à 5 ° C avec un taux de 0,1 ° C / s de la rampe, et en incubant à 5 &#160; ° C pendant 2 heures. </li></ol> 2. Gel d&#39;électrophorèse pour détecter ADN double brin courbure <ol><li> Verser le gel de polyacrylamide en mélangeant 16,17 acrylamide et de solutions de bis-acrylamide à un rapport 29.2:0.8, 5% (p / v) dans 1 x Tris / Borate / EDTA (TBE) tampon à pH 8,0. Note: 10 ml de solution de gel contient: 1.217 ml 40% d&#39;acrylamide, 0,667 ml 2% de bis-acrylamide, 1 ml TBE 10X, 100 L persulfate d&#39;ammonium (APS) 10%, 10 L TEMED, et le reste est dH 2 O. Solidification complète du gel prend environ 30 min. </li><li> Charger le gel de polyacrylamide avec des échantillons d&#39;ADN et de l&#39;échelle d&#39;ADN dans un tampon de charge 1X (5% de glycerol, 0,03% (p / v) de bromophénol blue) et exécuter le gel à 5-8 V / cm à 4 ° C pendant 45 min ou jusqu&#39;à ce que le front de colorant se rapproche de l&#39;extrémité du gel. </li><li> Colorer le gel en utilisant un tampon TBE 1X contenant 0,5 g / ml de bromure d&#39;éthidium pendant 30 min. Identifier les bandes d&#39;ADN sous illumination UV. Comparer les positions des bandes avec le marqueur de taille (100 bp DNA ladder) pour calculer les tailles apparentes des molécules d&#39;ADN. NOTE: Curved ADN se déplacent généralement plus lent que les ADN droites. </li></ol> 3. Préparation de débit cellulaire <ol><li> Percer 6-7 paires de trous le long de deux bords opposés d&#39;une lame de verre (3&#39;&#39; x 1&#39;&#39;) à l&#39;aide d&#39;une perceuse à colonne et des trépans de forage diamantés. Après le perçage, frotter la lame dans l&#39;eau qui coule pour enlever la poudre de verre visible. REMARQUE: Les trous servent entrées et sorties perfusion. Pendant le forage, la lame de refroidissement à l&#39;eau est importante pour empêcher la fissuration. </li><li> Placer les lames en position verticale dans un bocal de verre et de le remplir avec de l&#39;eau. Soniquer pendant 15 minutes et de les transférer dans un autre pot de verre dedicated pour le nettoyage à l&#39;acétone. Remplissez-le avec de l&#39;acétone et de traitement par ultrasons pendant 15 min. Rincer les lames avec de l&#39;éthanol à l&#39;aide d&#39;un flacon pulvérisateur, puis avec de l&#39;eau. Placez-les dans un bocal en polypropylène, le remplir avec 5 M d&#39;hydroxyde de potassium, et de traitement par ultrasons pendant 15 min. Enfin, soniquer les diapositives dans l&#39;eau pendant 15 min. Nettoyer les lamelles (n ° 1, 24 x 40 mm) en utilisant le même protocole. NOTE: diapositives et des lamelles nettoyés peuvent être stockés dans dH 2 O pour une utilisation à long terme. </li><li> Mélanger 1 mg de biotine-PEG-silane (MW 3400) avec 80 mg de la norme MPEG-silane (MW 2000) dans 340 L de 0,1 solution de bicarbonate de sodium M. Bien mélanger et centrifuger le mélange brièvement pour se débarrasser de bulles. REMARQUE: La fonctionnalisation de la surface avec du polyéthylène glycol (PEG) permet de réduire la liaison non spécifique de l&#39;ADN à la surface. </li><li> Mettre 80 L de la solution de PEG à chaque lame et une lamelle couvre-objet abaisser doucement dessus. Attendez 45 min. Séparer la lamelle de la diapositive avec des pincettes, les rincer abondamment avec de l&#39;dH 2 O et laisser tourlet sèche à l&#39;air libre. </li><li> Placez minces bandes de ruban adhésif double face sur la diapositive à former des canaux. Aligner une lamelle dessus et appuyez fermement sur la lamelle contre la glissière pour former des canaux étanches aux liquides. Utilisez cinq minutes époxy pour sceller les bords des canaux. </li></ol> 4. Préparation de Trolox Solution <ol><li> Mettez ~ 30 mg Trolox et 10 ml dH 2 O dans un ballon et utiliser une barre aimant d&#39;agitation pour agiter la solution à l&#39;air libre pendant 18 heures. </li><li> Filtrer la solution à l&#39;aide d&#39;un filtre de 0,2 um et ajuster le pH à 7 par addition de ~ 6 pi de 1 M de base Tris (pH 11). Remarque: le Trolox est un réactif anti-clignotement qui est couramment utilisé dans une seule molécule études 18. L&#39;action de antidécoloration de Trolox vient de son dérivé oxydé qui est présent dans la solution Trolox partiellement dégradé 19. À dissolution rapide Trolox dans le méthanol ou solution Tris pH élevé doit être évitée en raison de l&#39;oxydation inefficace. </li></ol> 5. Single-molImagerie ecule <ol><li> Injecter 15 ul de solution de neutravidine (0,5 mg / ml) dans le canal et attendre pendant 2 minutes avant de rincer avec 100 ul de tampon T50 (10 mM Tris-HCl, 50 mM de NaCl, pH 7,0). </li><li> Injecter 50 ul d&#39;échantillon d&#39;ADN (50 à 100 pM) dans le canal. Attendez 5 minutes et rincer l&#39;ADN non lié à une distance de 100 L de tampon T50. NOTE: les molécules d&#39;ADN vont se lier spécifiquement à la surface à travers l&#39;interaction neutravidine-biotine. </li><li> Remplir les puits avec le tampon de formation d&#39;image qui contient un système de piégeage de l&#39;oxygène 20 (100 mM PCD, PCA 5 mM, 1 mM de Trolox, et NaCl 500 mM). </li><li> Réglez le EMCCD en mode de transfert de trame pour écouter 2 x 2 images regroupées par casiers (256 x 256) à l&#39;ordinateur à 25 images par seconde. </li><li> Mettre de l&#39;huile d&#39;immersion sur l&#39;objectif du microscope, et fixer la cellule d&#39;écoulement sur la platine du microscope en utilisant des clips spécimens. Gros la mise au point en regardant le motif de réflexion de laser sur le mur. Ajustez la mise au point avec l&#39;affichage en direct de la fluorescence imans sur le moniteur. </li><li> Commencer l&#39;acquisition de données avec le laser 532 nm sur. Vérifiez l&#39;affichage en direct et la mise au point si nécessaire. Arrêter l&#39;acquisition des données lorsque la plupart des molécules ont Photo-blanchissement. NOTE: Dans cette installation, un programme de laboratoire écrit C pour contrôler le microscope et afficher des images en direct sur l&#39;écran quand ils sont enregistrés sur le disque dur est utilisé. </li></ol> 6. Traitement de l&#39;image et l&#39;analyse des données REMARQUE: Une série de temps de 256 x 256 images sont traitées par un code MATLAB pour générer une seule molécule traces de temps de Cy3 et Cy5 intensités. Pour jumeler pixels entre le canal et le canal donneur accepteur de l&#39;image split-vue, 6-7 paires de Cy3 et Cy5 taches, chaque paire de la même molécule uniformément dispersés dans le champ de vision, sont récoltés manuellement, et une transformation affine est calculée en utilisant les coordonnées de ces points en tant que points d&#39;ancrage. <ol><li> Utilisation d&#39;un script MATLAB, regarder à travers tous les temps seule molécule traces tchapeau montrent de multiples transitions entre les signaux faibles et élevées de FRET. Identifier les États boucle et non bouclé. REMARQUE: Le signal de FRET est définie comme l&#39;intensité Cy5 (I a) divisé par la somme des intensités Cy3 et Cy5 (I a + I d). État boucle a une valeur élevée de FRET en état non bouclé a une valeur faible de FRET. L&#39;histogramme de signaux FRET partir d&#39;une seule molécule est bimodale distribué en raison du bouclage et débouclage réversible. </li><li> Trouver le seuil qui sépare les deux distributions en déterminant l&#39;intersection entre les deux courbes de Gauss de rangement. </li><li> Calculer l&#39;efficacité de FRET comme <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq7.jpg" /> et assigner les États en boucle avec des valeurs élevées de FRET et les Etats non tricotées avec de faibles valeurs de FRET. </li><li> Utilisation d&#39;un script MATLAB, analyser le nombre cumulatif de molécules (N (t)) qui en boucle (ouatteint l&#39;état haut FRET) à différents laps de temps depuis le début de l&#39;acquisition de données. NOTE: Depuis une molécule ADN double brin peut commencer à n&#39;importe quel conformation de l&#39;état non bouclé au début de l&#39;acquisition de données, le taux d&#39;accroissement de la population en boucle reflète le taux moyen boucle moyenne sur conformations initiales. Extraire la boucle de vitesse k boucle en ajustant N (t) avec une fonction exponentielle: <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq1.jpg" /> Si l&#39;augmentation biphasique, il peut être muni d&#39;une double fonction exponentielle: <img fo:content-width="2.2in" src="/files/ftp_upload/51667/eq2.jpg" /> Dans ce cas, k boucle est obtenu à partir: <img fo:content-width="1.7in" src="/files/ftp_upload/51667/eq3.jpg" /> NOTE: En théorie, la probabilité de survie que d&#39;un polymère n&#39;a pas bouclé au temps t n&#39;est pas une fonction exponentielle simple ou double 12. FITT exponentielleING est utilisé comme un moyen pratique d&#39;extraire le temps de doublement moyen. </li></ol> 7. Détermination du facteur J NOTE: Le facteur J représente la façon concentrée une extrémité d&#39;un ADN double brin est de l&#39;ordre de l&#39;autre extrémité. Elle peut être déterminée par interpolation de la concentration d&#39;un segment d&#39;extrémité de l&#39;ADN qui produirait la même vitesse de réaction avec l&#39;autre segment d&#39;extrémité comme mesuré le taux de bouclage. Expérimentalement, un segment d&#39;extrémité est immobilisée sur la surface, et l&#39;autre segment d&#39;extrémité est introduit à une certaine concentration c. Si le taux de recuit mesurée entre les deux extrémités est recuit k, alors le facteur de J 21 est donnée par <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq4.jpg" /> . La constante de vitesse de recuit (recuit k = k recuit / C) est indépendant de la concentration de la sonde. <ol><li> Débit 20 pi de 30-50 pM biotine-Cy5 oligo (Primer 3) into un canal neutravidine revêtu. Rincer le canal avec 100 pi de T50 à laver oligos non liés. </li><li> Préparer le tampon de formation d&#39;image tel que décrit dans la partie 5 avec l&#39;addition d&#39;oligo Cy3 (amorce 2) à une concentration finale de 50 nM. Couler ce tampon d&#39;imagerie dans le canal. </li><li> Tout en gardant le laser 532 nm, tournez brièvement le laser 640 nm à identifier les emplacements des oligos Cy5 liés à la surface. Éteignez le laser 640 nm et commencer à surveiller le signal de FRET. REMARQUE: Lors de l&#39;hybridation d&#39;un oligo Cy3 à un Cy5 oligo lié à la surface, Cy5 fluorescence se posera de FRET. </li><li> Utilisation d&#39;un script MATLAB, analyser le nombre de molécules qui commencent dans l&#39;état non lié (faible intensité de Cy5), mais se transforment plus tard en l&#39;état (haute intensité de Cy5) recuit en fonction du temps à partir des traces d&#39;intensité Cy5. </li><li> Tracer ce nombre de molécules en fonction du temps recuits. Monter cette courbe avec une fonction exponentielle simple ( <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq5.jpg"/&gt;) Pour obtenir le taux de recuit (k recuit). </li><li> Répéter cette expérimentation à différentes concentrations Cy3 oligo (60, 100, et 180 nM) pour confirmer la linéarité entre le taux d&#39;hybridation et la concentration des réactifs. Extraire la constante de vitesse de recuit de second ordre (k recuit ) À partir de la pente. </li><li> Calculer le facteur de J de <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq6.jpg" /> , Où k est le taux boucle en boucle mesurée dans les mêmes conditions de tampon. </li></ol>

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

Les auteurs déclarent aucun conflit d&#39;intérêt.

Un test simple molécule unique basé sur le FRET a été utilisé pour étudier la cinétique de bouclage des ADN de différentes formes intrinsèques. ADN courbes peuvent être préparés par la répétition d&#39;une séquence 10-mère en phase avec la période d&#39;hélice de 10,5 pb, et leurs courbures peuvent être estimées en utilisant PAGE. Ces dsDNAs sont conçus avec des extrémités cohésives pour permettre la stabilisation de la boucle transitoire. Nous avons extrait le taux de bouclage de l&#39;augmentat...

Comprendre les propriétés mécaniques des ADN double brin est d&#39;une importance fondamentale dans les sciences fondamentales et les applications d&#39;ingénierie. La structure de l&#39;ADN bicaténaire est plus compliqué que d&#39;une échelle hélicoïdale droite parce angles roulis, d&#39;inclinaison et de torsion entre les paires de base successives peuvent varier en fonction de la séquence. Fluctuations thermiques peuvent provoquer des ADN double brin à subir divers modes de fluctuations conformationnelles telles que la flexion, de torsion et d&#39;étirement. Transitions comme la fonte et de déformation peuvent également se produire dans des conditions extrêmes. Parmi ces propositions, ADNds flexion a l&#39;impact le plus notable biologique 1. ADNdb flexion est associée à la répression ou l&#39;activation de gènes en amenant deux sites distants proches les uns des autres. Il joue également un rôle important dans l&#39;emballage de l&#39;ADN à l&#39;intérieur du noyau de la cellule ou une capside virale. Déformation en flexion de l&#39;ADN bicaténaire peut être visualisée expérimentalement par microscopie à haute résolution (AFM 2 et 3 TEM), et la ThermodynAmics et cinétique peuvent être étudiés par des analyses en boucle, qui relient des sites chimiquement juxtaposés de l&#39;ADN double brin. Un tel dosage est une ligase dépendante cyclisation 4. Dans ce dosage, les molécules ADN double brin avec des extrémités collantes &quot;cohésives&quot; () sont circularisées ou dimérisés par l&#39;ADN ligase. En comparant les taux de cercle et la formation de dimère, on peut obtenir une concentration molaire efficace d&#39;une extrémité de l&#39;ADN dans le voisinage de l&#39;autre extrémité, qui est connu comme le facteur de J. Ce facteur de J est dimensionnellement équivalente à la densité de probabilité de trouver une extrémité de l&#39;ADN à une courte distance de l&#39;autre extrémité, et reflète ainsi la flexibilité de l&#39;ADN. Mesurer le facteur de J en fonction de la longueur de l&#39;ADN révèle de nombreuses caractéristiques de la mécanique d&#39;ADN dont la longueur de persistance 4,5. La chaîne de ver (WLC) modèle a été largement considéré comme le modèle de polymère canonique pour la mécanique ADN double brin sur la base de son succès dans explicationining les courbes force-extension obtenus dans l&#39;ADN tirant expériences 6 et prédire correctement les facteurs de J dsDNAs plus de 200 pb 7. Cependant, en utilisant l&#39;essai de cyclisation de molécules d&#39;ADNdb aussi courtes que 100 bp, et Cloutier Widom mesuré les facteurs J pour être de plusieurs ordres de grandeur plus élevés que la prédiction du modèle WLC 8. Un an plus tard, Du et al. produite facteurs J en accord avec le modèle WLC en utilisant le test de cyclisation avec des concentrations plus faibles de ligase et attribué le résultat anormal dans le groupe Widom à des concentrations élevées ligase utilisé 9. Cette controverse illustre l&#39;influence inévitable de l&#39;ADN ligase sur la cinétique de cyclisation en utilisant le test classique 9. En outre, l&#39;ADN ligase peut également affecter la structure de l&#39;ADN et de la rigidité à travers non spécifique 10,11 liaison. Pour éliminer les problèmes techniques de tests de bouclage protéine dépendante, nous avons récemment démontré une prottest de bouclage ein, à base de Fluorescence Resonance Energy Transfer (FRET) 12. Dans ce procédé, des conformations en boucle sont détectées par FRET entre le donneur et l&#39;accepteur attaché à proximité des extrémités cohésives d&#39;une molécule d&#39;ADN. Un total de microscope de fluorescence par réflexion interne du type à objectif (TIRFM) est utilisé pour enregistrer des trajectoires en boucle réversible et débouclage événements à partir de molécules d&#39;ADN simple surface immobilisé pendant une période de temps prolongée. Cette méthode comporte l&#39;assemblage de molécules d&#39;ADN à base de PCR pour générer des molécules d&#39;ADN libre mésappariement, ce qui est une amélioration cruciale sur une méthode similaire par Vafabakhsh Ha et 13. L&#39;aspect unique molécule de ce protocole permet la mesure des distributions en plus de Ensemble moyennes tandis que l&#39;aspect FRET permet de mesurer la dynamique de l&#39;ADN de boucle à plusieurs reprises de la même molécule, même dans des conditions qui peuvent nuire à l&#39;activité de ligase. La configuration de TIRFM est illustré à la figure 1. Une coutumeStade-éprouvette conçu est placé sur un corps de microscope Olympus IX61. 532 nm et 640 nm lasers sont introduits à partir du côté et sont réfléchies par les miroirs elliptiques minuscules 14 dans l&#39;objectif d&#39;atteindre une grande NA angle d&#39;incidence critique à l&#39;interface lamelle couvre-objet dans l&#39;eau. Nous notons que plus répandue TIR par-objectif en utilisant des miroirs dichroïques ou configurations de TIR sur la base de prisme peut également être utilisé pour cette application de FRET. L&#39;image de fluorescence formée par le microscope est divisée en images de donneur et d&#39;accepteur par un miroir dichroïque. Ils sont ensuite convertis à la sur les deux moitiés d&#39;un EMCCD. Filtres d&#39;émission passe-longue supplémentaires sont utilisés pour réduire le signal de fond. Contrôle de la température est essentielle pour acquérir des données cinétiques reproductibles. Pour le contrôle de la température, l&#39;objectif est séparée de la pièce de nez du corps de microscope pour minimiser le transfert de chaleur, et de l&#39;eau à partir d&#39;une température contrôlée refroidisseur / réchauffeur est mis en circulation par l&#39;intermédiaire d&#39;un collier en laiton qui s&#39;adapte étroitement deautour du métal intérieur sous la veste objectif. Cette configuration est en mesure de réaliser robuste contrôle de la température à la surface de la lamelle couvre entre 15 et 50 ° C (Figure 2). Dans ce travail, la température de l&#39;échantillon a été maintenue à 24 ° C. Le protocole ci-dessous présente la procédure étape par étape pour la construction d&#39;ADN, de l&#39;estimation de la forme de l&#39;ADN, molécule expérience unique, et la détermination du facteur J.

<table border="0" cellpadding="0" cellspacing="0" width="793">
	<tbody>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Small DNA FRAG Extract Kit-100PR</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97060-558</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Acrylamide 40% solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97064-522</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Bis-acrylamide 2% (w/v) solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97063-948</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">GeneRuler 100 bp DNA Ladder, 100-1000 bp</td>
			<td style="width:124px;">Fermentas</td>
			<td>SM0241</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Mini Vertical PAGE System</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">89032-300</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Syringe filter 0.2um CS50</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Trolox</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">238813-1G</td>
			<td>triplet state quencher</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuic acid (PCA)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">08992-50MG</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuate 3,4-Dioxygenase (PCD)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">P8279-25UN</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">mPEG-silane, MW 2000 1g</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">MPEG-SIL-2000-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Biotin-PEG-Silane, MW 3400</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">Biotin-PEG-SIL-3400-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Avidin, NeutrAvidin Biotin-binding Protein</td>
			<td style="width:124px;">Invitrogen</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Phusion Hot Start High-Fidelity DNA Polymerase</td>
			<td style="width:124px;">New England Biolabs</td>
			<td style="width:135px;">F-540L</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Gel/PCR DNA Fragments Extraction Kit</td>
			<td>IBI Scientific</td>
			<td>IB47020</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Premium plain glass microscope slides</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;">12-544-1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">VWR micro cover glass, rectangular, no. 1</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">48404-456</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fisher Scientific Isotemp 1006s Recirculating Chiller/Heater</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;"></td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective Cooling Collar</td>
			<td style="width:124px;">Bioptechs</td>
			<td style="width:135px;">150303</td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">KMI53 Biological Micrometer Measuring Stage</td>
			<td style="width:124px;">Semprex</td>
			<td style="width:135px;">KMI53</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">High Performance DPSS Laser 532nm 50mW&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">NT66-968</td>
			<td>Cy3 excitation</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:351px;">CUBE Fiber Pigtailed 640 nm, 30mW, Fiber, FC/APC Connector</td>
			<td style="width:124px;">Coherent</td>
			<td style="width:135px;">1139604</td>
			<td>Cy5 excitation</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">650 nm BrightLine Dichroic Beamsplitter</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">FF650-Di01-25x36</td>
			<td>splitting dichroic</td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:351px;">LaserMUX Beam Combiner, reflects 514.5, 532, &#38; 543.5 nm lasers, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">LM01-552-25</td>
			<td>combining dichroic</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Brightline Fluorescence Filter 593/40</td>
			<td style="width:124px;">Semrock</td>
			<td>FF01-593/40-25</td>
			<td>Cy3 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">635 nm EdgeBasic LWP longpass Filter, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">BLP01-635R-25</td>
			<td>Cy5 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">EMCCD iXon+</td>
			<td style="width:124px;">Andor Technology</td>
			<td style="width:135px;">DU-897E-CS0-#BV</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">IX51 inverted microscope frame</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective UApo N 100x/1.49 Oil TIRF</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Immersion oil type-F for fluorescence microscopy</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;">IMMOIL-F30CC</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">2mm Diameter 45&#176; Rod Lens Aluminum Coated&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">54-092</td>
			<td>miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">1/4&#34; Travel Single-Axis Translation Stage</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">MS-1</td>
			<td>translation of miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">&#216;1&#34; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-200-A</td>
			<td>focusing lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Adjustable Mechanical Slit</td>
			<td style="width:124px;">Thorlabs</td>
			<td>VA100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dielectric Mirror</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">BB1-E02</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">&#216;1&#34; Achromatic Doublet, f = 100 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-100-A</td>
			<td>relay lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Lens Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LMR1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dichroic Filter Mount</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">FFM1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fixed Cage Cube Platform</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">B3C</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Kinematic Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">KM100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lens, &#216;1&#34;, f = 40 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1422-A</td>
			<td>collimating lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 15 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1222-A</td>
			<td>telescope lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 150 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1433-A</td>
			<td>telescope lens</td>
		</tr>
	</tbody>
</table>

studying dna looping by single-molecule fret

La flexion de l&#39;ADN double brin (ADNdb) est associée à de nombreux processus biologiques importants tels que la reconnaissance protéine-ADN et ADN emballage dans des nucléosomes. Thermodynamique de l&#39;ADN double brin de flexion a été étudiée par une méthode dite de cyclisation qui repose sur l&#39;ADN ligase pour joindre de manière covalente des extrémités cohésives courtes d&#39;un ADN double brin. Cependant, l&#39;efficacité de la ligature peut être affectée par de nombreux facteurs qui ne sont pas liés à ADN double brin boucle comme la structure de l&#39;ADN entourant les extrémités collantes jointes, et ligase peut également affecter le taux de boucle apparente à travers des mécanismes tels que la liaison non spécifique. Ici, nous montrons comment mesurer dsADN cinétique de boucle sans ligase en détectant transitoire formation de boucle d&#39;ADN par FRET (Fluorescence Resonance Energy Transfer). les molécules d&#39;ADNdb sont construites en utilisant un protocole simple basé sur la PCR avec une paire de FRET et une séquence de liaison à la biotine. La densité de probabilité de boucle connue comme le facteur J est extrait à partir de la vitesse en boucle et le taux d&#39;hybridation entre deux déconnexionextrémités cohésives TED. En testant deux dsDNAs avec des courbures différentes intrinsèques, on montre que le facteur de J est sensible à la forme intrinsèque de l&#39;ADN double brin.

molécules d&#39;ADN utilisées pour l&#39;étude de bouclage sont constitués d&#39;une région duplex de longueur et séquence variable et des surplombs simple brin qui sont complémentaires les unes aux autres. Les saillies, qui sont à base de temps 7, peuvent s&#39;hybrider à l&#39;autre pour capter l&#39;état de boucle. Chaque surplomb contient soit Cy3 ou Cy5 qui est lié à l&#39;ossature de l&#39;ADN grâce à la chimie amidite. Le Cy5-faux est également lié à la biotine-TEG (15 atome Tetra-éthylène glyc...

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

Cette étude présente une procédure expérimentale détaillée pour mesurer la dynamique de boucle d&#39;ADN double-brin en utilisant une seule molécule Fluorescence Resonance Energy Transfer (FRET). Le protocole décrit également comment extraire la densité de probabilité boucle appelée facteur de J.

Étude de l&#39;ADN Looping par une seule molécule FRET

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

studying-dna-looping-by-single-molecule-fret

Research

JoVE Journal

Biology

15.3K vues.  Georgia Institute of Technology.  Cette étude présente une procédure expérimentale détaillée pour mesurer la dynamique de boucle d'ADN double-brin en utilisant une seule molécule Fluorescence Resonance Energy Transfer (FRET). Le protocole décrit également comment extraire la densité de probabilité boucle appelée facteur de J. 

Vidéo: Studying DNA Looping by Single-Molecule FRET

Single Molecule Methods for Monitoring Changes in Bilayer Elastic Properties

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein interactions and more general lipid bilayer-protein interactions. These interactions are particularly important in pharmacological research, as many current pharmaceuticals on the market can alter the lipid bilayer material properties, which can lead to altered membrane protein function.   The formation of gramicidin channels are dependent on conformational changes in gramicidin subunits which are in turn dependent on the properties of the lipid.  Hence the gramicidin channel  current is a reporter of altered properties of the bilayer due to certain compounds.  

Membrane protein function is regulated by the cell membrane lipid composition. This video-article details how to form a patch using bilayer patch electrodes, as well as how to use gramicidin channels as reporters of altered membrane properties.

Méthodes Single Molecule pour surveiller les changements dans les propriétés élastique bicouche

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein ...

Recherche

Biologie

Combining QD-FRET and Microfluidics to Monitor DNA Nanocomplex Self-Assembly in Real-Time

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically functional inside the cell, nucleic acid-based therapeutics require an efficient intracellular delivery system. One widely adopted approach is to complex DNA with a gene carrier to form nanocomplexes via electrostatic self-assembly, facilitating cellular uptake of DNA while protecting it against degradation. The challenge lies in the rational design of efficient gene carriers, since premature dissociation or overly stable binding would be detrimental to the cellular uptake and therapeutic efficacy. Nanocomplexes synthesized by bulk mixing showed a diverse range of intracellular unpacking and trafficking behavior, which was attributed to the heterogeneity in size and stability of nanocomplexes. Such heterogeneity hinders the accurate assessment of the self-assembly kinetics and adds to the difficulty in correlating their physical properties to transfection efficiencies or bioactivities. We present a novel convergence of nanophotonics (i.e. QD-FRET) and microfluidics to characterize the real-time kinetics of the nanocomplex self-assembly under laminar flow. QD-FRET provides a highly sensitive indication of the onset of molecular interactions and quantitative measure throughout the synthesis process, whereas microfluidics offers a well-controlled microenvironment to spatially analyze the process with high temporal resolution (~milliseconds). For the model system of polymeric nanocomplexes, two distinct stages in the self-assembly process were captured by this analytic platform. The kinetic aspect of the self-assembly process obtained at the microscale would be particularly valuable for microreactor-based reactions which are relevant to many micro- and nano-scale applications. Further, nanocomplexes may be customized through proper design of microfludic devices, and the resulting QD-FRET polymeric DNA nanocomplexes could be readily applied for establishing structure-function relationships. 

We present a novel and powerful integration of nanophotonics (QD-FRET) and microfluidics to investigate the formation of polyelectrolyte polyplexes, which is expected to provide better control and synthesis of uniform and customizable polyplexes for future nucleic acid-based therapeutics.

Combinant QD-FRET et la microfluidique pour surveiller Nanocomplex ADN auto-assemblage en temps réel

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically ...

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides (Figure 1). The growing product double-strand DNA (dsDNA) is extended with laminar flow and visualized by using an intercalating dye. Measuring the position of the growing DNA end in real time allows precise determination of replication rate (Figure 2). Furthermore, the length of completed DNA products reports on the processivity of replication. This experiment can be performed very easily and rapidly and requires only a fluorescence microscope with a reasonably sensitive camera.


This protocol demonstrates a simple single-molecule fluorescence microscopy technique for visualizing DNA replication by individual replisomes in real time.

Visualisation de la réplication d&#39;ADN molécule unique par microscopie à fluorescence

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

Système automatisé pour les simples mesures de fluorescence de la molécule de surface immobilisée Biomolécules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. Linearized &lambda; DNA is modified to have a biotin on the end of one strand, and a digoxigenin moiety on the other end of the same strand. The biotinylated end is attached to a functionalized glass coverslip and the digoxigeninated end to a small bead. The assembly of these DNA-bead tethers on the surface of a flow cell allows a laminar flow to be applied to exert a drag force on the bead. As a result, the DNA is stretched close to and parallel to the surface of the coverslip at a force that is determined by the flow rate (Figure 1). The length of the DNA is measured by monitoring the position of the bead. Length differences between single- and double-stranded DNA are utilized to obtain real-time information on the activity of the replication proteins at the fork. Measuring the position of the bead allows precise determination of the rates and processivities of DNA unwinding and polymerization (Figure 2).

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system.

Observation directe d&#39;ADN Enzymes réplication via un ADN simple molécule Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

Single-Molecule Imaging of Nuclear Transport

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the last decade. The investigation of molecular interactions with high temporal and spatial resolutions deep within cells has remained challenging due to the inherently weak signals arising from individual molecules. Recent works by Yang et al. demonstrated that narrow-field epifluorescence microscopy allows visualization of nucleocytoplasmic transport at the single molecule level. By the single molecule approach, important kinetics, such as nuclear transport time and efficiency, for signal-dependent and independent cargo molecules have been obtained. Here we described a protocol for the methodological approach with an improved spatiotemporal resolution of 0.4 ms and 12 nm. The improved resolution enabled us to capture transient active transport and passive diffusion events through the nuclear pore complexes (NPC) in semi-intact cells. We expect this method to be used in elucidating other binding and trafficking events within cells.

Single molecule microscopy approch provided novel insights into nuclear transport.

Molécules simples à l&#39;imagerie du transport nucléaire

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the ...

Monitoring Kinase and Phosphatase Activities Through the Cell Cycle by Ratiometric FRET

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such probes typically consist of variants of CFP and YFP, intervened by a phosphorylatable sequence and a phospho-binding domain. Upon phosphorylation, the probe changes conformation, which results in a change of the distance or orientation between CFP and YFP, leading to a change in FRET efficiency (Fig 1). Several probes have been published during the last decade, monitoring the activity balance of multiple kinases and phosphatases, including reporters of PKA2, PKB3, PKC4, PKD5, ERK6, JNK7, Cdk18, Aurora B9 and Plk19. Given the modular design, additional probes are likely to emerge in the near future10. 
Progression through the cell cycle is affected by stress signaling pathways 11. Notably, the cell cycle is regulated differently during unperturbed growth compared to when cells are recovering from stress12.Time-lapse imaging of cells through the cell cycle therefore requires particular caution. This becomes a problem particularly when employing ratiometric imaging, since two images with a high signal to noise ratio are required to correctly interpret the results. Ratiometric FRET imaging of cell cycle dependent changes in kinase and phosphatase activities has predominately been restricted to sub-sections of the cell cycle8,9,13,14.
Here, we discuss a method to monitor FRET-based probes using ratiometric imaging throughout the human cell cycle. The method relies on equipment that is available to many researchers in life sciences and does not require expert knowledge of microscopy or image processing.

FRET-based reporters are increasingly used to monitor kinase and phosphatase activities in live cells. Here we describe a method on how to use FRET-based reporters to assess cell cycle-dependent changes in target phosphorylation.

Activités de surveillance kinase et la phosphatase dans le cycle cellulaire par Ratiométrique FRET

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such ...

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage (CoTrAC)

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method makes it possible to count the numbers of protein molecules produced in one cell during sequential, five-minute time windows. It requires a fluorescence microscope with laser excitation power density of ~0.5 to 1 kW/cm2, which is sufficiently sensitive to detect single fluorescent protein molecules in live cells. The fluorescent reporter used in this method consists of three parts: a membrane targeting sequence, a fast-maturing, yellow fluorescent protein and a protease recognition sequence. The reporter is translationally fused to the N-terminus of a protein of interest. Cells are grown on a temperature-controlled microscope stage. Every five minutes, fluorescent molecules within cells are imaged (and later counted by analyzing fluorescence images) and subsequently photobleached so that only newly translated proteins are counted in the next measurement.
Fluorescence images resulting from this method can be analyzed by detecting fluorescent spots in each image, assigning them to individual cells and then assigning cells to cell lineages. The number of proteins produced within a time window in a given cell is calculated by dividing the integrated fluorescence intensity of spots by the average intensity of single fluorescent molecules. We used this method to measure expression levels in the range of 0-45 molecules in single 5 min time windows. This method enabled us to measure noise in the expression of the &lambda; repressor CI, and has many other potential applications in systems biology.

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage CoTrAC

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC), to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method has been used to follow the stochastic expression dynamics of a transcription factor, the &lambda; repressor CI 1.

Une seule molécule d&#39;imagerie du règlement Gene<em&gt; In vivo</em&gt; Utilisation de l&#39;activation par clivage cotraductionnelle (COTRAC)

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells ...

Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable.

Here we describe the instrumentation and methods for detecting single fluorescently-labeled protein molecules interacting with a single DNA molecule suspended between two optically trapped microspheres.

La combinaison unique molécule manipulation et d&#39;imagerie pour l&#39;étude des interactions protéine-ADN

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method ...

FRET Imaging in Three-dimensional Hydrogels

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly employ two-dimensional (2D) culture, which does not mimic the three-dimensional (3D) cellular microenvironment. A method to perform quenched emission FRET imaging using conventional widefield epifluorescence microscopy of cells within a 3D hydrogel environment is presented. Here an analysis method for ratiometric FRET probes that yields linear ratios over the probe activation range is described. Measurement of intracellular cyclic adenosine monophosphate (cAMP) levels is demonstrated in chondrocytes under forskolin stimulation using a probe for EPAC1 activation (ICUE1) and the ability to detect differences in cAMP signaling dependent on hydrogel material type, herein a photocrosslinking hydrogel (PC-gel, polyethylene glycol dimethacrylate) and a thermoresponsive hydrogel (TR-gel). Compared with 2D FRET methods, this method requires little additional work. Laboratories already utilizing FRET imaging in 2D can easily adopt this method to perform cellular studies in a 3D microenvironment. It can further be applied to high throughput drug screening in engineered 3D microtissues. Additionally, it is compatible with other forms of FRET imaging, such as anisotropy measurement and fluorescence lifetime imaging (FLIM), and with advanced microscopy platforms using confocal, pulsed, or modulated illumination.

F&#246;rster resonance energy transfer (FRET) imaging is a powerful tool for real-time cell biology studies. Here a method for FRET imaging cells in physiologic three-dimensional (3D) hydrogel microenvironments using conventional epifluorescence microscopy is presented. An analysis for ratiometric FRET probes that yields linear ratios over the activation range is described.

FRET Imaging en hydrogels en trois dimensions

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly ...