Wir danken James Waters, Gable Wadsworth und Bo Broadwater für das Manuskript kritisch zu lesen. Wir danken auch vier anonymen Gutachtern für die Bereitstellung von nützlichen Kommentare. Wir danken für die finanzielle Unterstützung von Georgia Institute of Technology, der Burroughs Wellcome Fund Career Award in der Scientific-Schnittstelle, und dem Studenten-Forschungsnetzwerk Zuschuss von NSF Physik lebender Systeme.

1. DsDNA Probenvorbereitung <ol><li> Gestalten Sie global gekrümmt DNAs durch Wiederholung eines 10-mer-Sequenz. Zum Beispiel 5&#39;-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCC X) 7 - TTTCATTCGAGCTCGTTGTTG-3 &#39;ist ein 186-bp-DNA gekrümmten wobei X eine Zufalls zusätzlichen Basis und der flankierenden Sequenz die sich wiederholende 10-mer-Sequenz Adaptersequenzen. HINWEIS:. In diesem Beispiel wurden zwei 10-mere mit gegenüberliegenden Präferenzen Nukleosom Bildung auf der Grundlage einer großen Nukleosom Belegung Studie von Kaplan et al 15 gewählt. Da die Schrauben Wiederholung der dsDNA ist nahe bei 10 bp, wird jede Netz Auslenkung der Schraubenachse des 10-mer zu akkumulieren, um eine Form wie ein Kreisbogen (Abbildung 3A) zu erzeugen. Da die Schrauben Zeit ist näher an 10,5 bp, wird eine zusätzliche Basis nach jeweils zwei Wiederholungen eingesetzt, um die gekrümmte Struktur so eben wie möglich zu halten. Diese Sequenzen kürzer als 200 bp aus Companie bestellt werdens Angebot, dass Gen-Synthese-Service. Es ist zweckmäßig, diese Sequenzen mit gemeinsamen Adaptersequenzen für nachfolgende Schritte flankieren. Das Verfahren ist in Fig. 3B schematisch dargestellt. </li><li> Führen Sie die PCR mit Primer 1 (GTGCCAGCAACAGATAGC) und Primer 2 (/ 5Cy3/TAAATTCCTACAACAACGAGCTCGAATG). HINWEIS: Primer 2 mit der FRET-Donor Cy3 am 5&#39;-Ende markiert. Ein typisches PCR-Protokoll Rezept und Radfahren sind in den Tabellen 1 und 2 dargestellt. </li><li> Führen Sie die PCR mit Primer 3 (/ 5BioTEG/GAAACATAG/iCy5/GAATTTACCGTGCCAGCAACAGATAGC) und Primer 4 (CAACAACGAGCTCGAATG). HINWEIS: Primer 3 mit dem FRET-Akzeptor Cy5 durch das Rückgrat und die Biotin-Linker am 5&#39;-Ende markiert. PCR-Rezept und Radfahren Protokoll wie oben. </li><li> Reinige die PCR-Produkte mit Hilfe eines PCR-Reinigung-Kit. </li><li> Mischen die Cy3-markierten Produkt und die Cy5-markierte Produkt in einem Puffer für den Strangaustausch (100 mM NaCl, 10 mM Tris-HCl pH 7,0, 1 mM EDTA) in Endkonzentrationen von 0,4 undNr. 181, M und 0,1 uM. HINWEIS: Die überschüssige Cy3-DNA erhöht die Konzentration des Duplex Durchführung sowohl Cy3 und Cy5 als Ergebnis der Strangaustausch. </li><li> Wechsel Stränge durch Inkubation bei 98,5 ° C für 2 Minuten, allmähliches Abkühlen bis 5 º C Anstiegsrate von 0,1 ° C / sec, und Inkubation bei 5 &#160; ° C für 2 Stunden. </li></ol> 2. Gel-Elektrophorese zu dsDNA Krümmung Detect <ol><li> Gießen Polyacrylamidgel 16,17 durch Mischen Acrylamid und Bisacrylamid Lösungen bei 29.2:0.8 Verhältnis von 5% (w / v) in 1 × Tris / Borat / EDTA (TBE)-Puffer bei pH 8,0. Hinweis: 10 ml Gel-Lösung enthält: 1,217 ml 40% Acrylamid, 0,667 ml 2% Bis-Acrylamid, 1 ml 10x TBE, 100 L Ammoniumpersulfat (APS), 10%, 10 l TEMED, und der Rest ist dH 2 O. Vollständige Verfestigung des Gels beträgt etwa 30 min. </li><li> Laden der Polyacrylamid-Gel mit DNA-Proben und die DNA-Leiter in 1X-Beladungspuffer (5% Glycerin, 0,03% (w / v) Bromphenolblau blue) und führen Sie das Gel bei 5-8 V / cm bei 4 ° C für 45 Minuten oder bis die Farbstofffront nähert sich dem Ende des Gels. </li><li> Färben Sie das Gel mit 1X TBE-Puffer, der 0,5 g / ml Ethidiumbromid für 30 min enthält. Identifizieren Sie die DNA-Banden unter UV-Beleuchtung. Vergleichen Bandpositionen mit der Größe Marker (100 bp DNA-Leiter), um die scheinbare Größe der DNA-Moleküle zu berechnen. HINWEIS: Gebogene DNAs bewegen in der Regel langsamer als gerade DNAs. </li></ol> 3. Durchflusszelle Vorbereitung <ol><li> Drill 6-7 Paare von Löchern, die entlang zwei gegenüberliegenden Rändern eines Glasobjektträgers (3&#39;&#39; × 1&#39;&#39;) unter Verwendung einer Bohrmaschine und Diamantbohrer. Nach dem Bohren, reiben Sie die Folie in fließendem Wasser, um sichtbare Glaspulver zu entfernen. HINWEIS: Die Löcher dienen als Perfusions-und Auslässe. Beim Bohren ist Kühl die Folie mit Wasser wichtig Rissbildung zu vermeiden. </li><li> Legen Sie die Folien aufrecht in ein Glas und füllen es mit Wasser. Beschallen für 15 min und übertragen sie in ein anderes Glas deAceton für Reinigungs dicated. Füllen Sie sie mit Aceton und beschallen für 15 min. Spülen Sie die Folien mit Ethanol mit einer Sprühflasche und dann mit Wasser. Legen Sie sie in einem Polypropylen-Glas, füllen Sie es mit 5 M Kaliumhydroxid und beschallen für 15 min. Schließlich beschallen die Folien in Wasser 15 min. Reinigen Sie die Deckgläser (Nr. 1, 24 x 40 mm) mit dem gleichen Protokoll. HINWEIS: Gereinigt Rutschen und Deckgläser können in dH 2 O für langfristige Gebrauch gespeichert werden. </li><li> Mischen 1 mg Biotin-PEG-Silan (MW 3400) mit 80 mg mPEG-Silan (MW 2000) in 340 L 0,1 M Natriumhydrogencarbonat-Lösung. Gut mischen und zentrifugieren Sie die Mischung kurz auf von Blasen loszuwerden. HINWEIS: Die Funktionalisierung der Oberfläche mit Polyethylenglykol (PEG) trägt zur Verringerung unspezifischer Bindung von DNA an die Oberfläche. </li><li> Setzen Sie 80 L der PEG-Lösung auf jeder Folie und senken Sie ein Deckglas darüber. Warten Sie 45 min. Trennen Sie das Deckglas aus der Folie mit einer Pinzette, spülen Sie sie mit reichlich dH 2 O und sei tSaum trocken im Freien. </li><li> Legen Sie dünne Streifen von doppelseitigem Klebeband auf der Folie, um Kanäle zu bilden. Richten Sie ein Deckglas darüber und drücken Sie fest auf das Deckglas gegen den Schieber, um flüssigkeitsdichte Kanäle bilden. Wählen Sie mit 5 Minuten-Epoxy, um die Kanten der Kanäle zu versiegeln. </li></ol> 4. Vorbereitung der Trolox-Lösung <ol><li> Setzen ~ 30 mg Trolox und 10 ml dH 2 O in einem Kolben und verwenden Sie einen Magneten Rührstab, um die Lösung in der offenen Luft für 18 Stunden rühren. </li><li> Filtern der Lösung unter Verwendung eines 0,2 &amp;mgr; m-Filter und den pH auf 7 durch Zugabe von ~ 6 ul 1 M Tris-Base (pH 11). Hinweis: Trolox ist ein Anti-Reagenz blinkt die üblicherweise in Einzel-Molekül verwendet wird, untersucht 18. Die Wirkung von Trolox Antifading kommt aus seiner oxidierten Derivat, das in teilweise abgebaut Trolox-Lösung 19 vorhanden ist. Schnell Lösen Trolox in Methanol oder hohen pH-Tris-Lösung sollte durch ineffiziente Oxidation vermieden werden. </li></ol> 5. Einzel-molkül Imaging <ol><li> Injizieren 15 ul NeutrAvidin-Lösung (0,5 mg / ml) in den Kanal und Warten für 2 Minuten vor dem Spülen mit 100 ul T50-Puffer (10 mM Tris-HCl, 50 mM NaCl, pH 7,0). </li><li> Injizieren 50 ul DNA-Probe (50-100 pM) in den Kanal. 5 min warten und spülen Sie die ungebundene DNA weg mit 100 L T50-Puffer. HINWEIS: Die DNA-Moleküle spezifisch an die Oberfläche binden durch die NeutrAvidin-Biotin-Wechselwirkung. </li><li> Füllen Sie den Kanal mit der Bildpuffer, die eine sauerstoffbindende System 20 (100 mm Lochkreis, 5 mM PCA, 1 mM Trolox und 500 mM NaCl) enthält. </li><li> Stellen Sie den Rahmen in EMCCD-Übertragungsmodus auf dem Computer mit 25 Bildern pro Sekunde streamen 2 x 2 klassierte Bilder (256 x 256). </li><li> Setzen Sionsöl auf dem Mikroskopobjektiv, und befestigen Sie die Durchflusszelle auf dem Mikroskoptisch mit Probe-Clips. Grob den Fokus, indem man die Laser-Reflexionsmuster an der Wand. Feineinstellung des Fokus mit der Live-Ansicht der Fluoreszenz imAlter auf dem Monitor. </li><li> Beginnt die Datenerfassung mit dem 532-nm-Laser auf. Überprüfen Sie die Live-Ansicht und stellen Sie den Fokus, wenn nötig. Stoppen Sie die Datenerfassung, wenn die meisten Moleküle haben gebleicht. HINWEIS: In dieser Anlage wird ein Labor-C-Programm geschrieben, um die Mikroskopsteuerung und Anzeige von Live-Bildern auf dem Bildschirm, wie sie auf der Festplatte gespeichert sind, verwendet. </li></ol> 6. Bildverarbeitung und Datenanalyse HINWEIS: Eine Zeitreihe von 256 x 256 Bilder werden mit einem MATLAB-Code verarbeitet, um Einzelmolekülzeitverläufe von Cy3-und Cy5-Intensitäten zu erzeugen. Um Pixel zwischen dem Spender und dem Akzeptor-Kanal Kanal des Split-View-Bild-Paare, 6-7 Paare von Cy3 und Cy5-Spots, wobei jedes Paar aus dem gleichen Molekül gleichmäßig über das Sichtfeld verteilt sind, werden von Hand gepflückt, und eine affine Transformation wird unter Verwendung der Koordinaten dieser Punkte als Ankerpunkte berechnet. <ol><li> Mit einem MATLAB-Skript, durch alle Einzelmolekül-Zeit zu suchen Spuren tHut zeigen mehrere Übergänge zwischen niedrigen und hohen FRET-Signale. Identifizieren Sie die geschleift und geloopten Staaten. HINWEIS: Die FRET-Signal wird als das Cy5 Intensität (I a), dividiert durch die Summe der Cy3-und Cy5-Intensitäten (I a + I d). Geschleift Staat hat hohe FRET-Wert, während ungeloopte Zustand niedrigen FRET-Wert hat. Das Histogramm von FRET-Signale von einem einzelnen Molekül ist bimodal wegen reversible Looping und unlooping verteilt. </li><li> Finden Sie die Schwelle, die die beiden Verteilungen durch die Bestimmung der Schnittpunkt zwischen den beiden Einbau Gaußkurven trennt. </li><li> Berechnen Sie die FRET-Effizienz als <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq7.jpg" /> und weisen Sie die geschleift Staaten mit hohen FRET-Werten und den geloopten Staaten mit niedrigen FRET-Werte. </li><li> Mit einem MATLAB-Skript, analysieren die kumulative Anzahl der Moleküle (N (t)), die eingeschleift (odererreicht die hohe FRET-Zustand) zu verschiedenen Zeitabläufen seit Beginn der Datenerfassung. HINWEIS: Da eine dsDNA-Molekül kann in jeder Konformation des geloopten Zustand zu Beginn der Datenerfassung zu starten, die Steigerungsrate in der Bevölkerung spiegelt die geschlungenen Schleifendurchschnittsrate gemittelt über anfängliche Konformationen. Entpacken Sie die Looping Rate k-Schleife durch den Einbau N (t) mit einer Exponentialfunktion: <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq1.jpg" /> Wenn biphasisch steigt, kann es mit einem Doppel Exponentialfunktion montiert werden: <img fo:content-width="2.2in" src="/files/ftp_upload/51667/eq2.jpg" /> In diesem Fall ist k Schleife erhalten aus: <img fo:content-width="1.7in" src="/files/ftp_upload/51667/eq3.jpg" /> HINWEIS: Theoretisch ist die Überlebenswahrscheinlichkeit, dass ein Polymer nicht zum Zeitpunkt t geschlungen ist nicht eine einfache oder doppelte Exponentialfunktion 12. Exponential fitting wird als praktisches Mittel, um die durchschnittliche Kreiszeit zu extrahieren. </li></ol> 7. Bestimmung der J-Faktor HINWEIS: Die J-Faktor darstellt, wie konzentriert das eine Ende eines dsDNA ist, um das andere Ende. Es kann durch Interpolieren der Konzentration von einem Ende des Segments der DNA, die die gleiche Reaktionsgeschwindigkeit mit dem anderen Ende des Segments gemessenen Schlingengeschwindigkeit erzeugen würde, bestimmt werden. Experimentell wird ein Endabschnitt auf der Oberfläche immobilisiert ist, und der andere Endabschnitt wird in einer bestimmten Konzentration c eingeführt. Wenn die gemessene Kühlrate zwischen den beiden Enden ist k Glühen, dann wird der Faktor 21 J gegeben durch <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq4.jpg" /> . Die Kühlrate-Konstante (k = k Glühen Glühen / C) ist unabhängig von der Sondenkonzentration. <ol><li> Fluss 20 ul von 30-50 pM Biotin-Cy5 Oligo (Primer 3) into NeutrAvidin einer beschichteten Kanal. Spülen Sie den Kanal mit 100 ul T50 abzuwaschen ungebundenen Oligos. </li><li> Vorbereitung des Bilderzeugungspuffer, wie in Teil 5 mit dem Zusatz von Cy3 Oligo (Primer 2) in einer Endkonzentration von 50 nM beschrieben. Fluss dieses Bildpuffer in den Kanal. </li><li> Während die 532-nm-Laser auf, kurz drehen Sie den 640-nm-Laser auf Standorte der Oberfläche gebundenen Cy5 Oligos zu identifizieren. Schalten Sie die 640-nm-Laser und starten Sie die Überwachung des FRET-Signals. HINWEIS: Bei der Hybridisierung eines Oligo Cy3 mit einem oberflächengebundenen Oligo Cy5, Cy5-Fluoreszenz wird von FRET auftreten. </li><li> Mit einem MATLAB-Skript, analysieren die Anzahl der Moleküle, die im ungebundenen Zustand (geringe Cy5-Intensität) zu starten, aber später in die geglühten Zustand (hohe Intensität Cy5) drehen als Funktion der Zeit aus den Cy5 Intensität Spuren. </li><li> Zeichnen Sie diese Anzahl von geglüht Moleküle gegen die Zeit. Setzen Sie diese Kurve mit einer einzigen Exponentialfunktion ( <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq5.jpg"/&gt;), Um die Kühlrate (k Glühen) zu erhalten. </li><li> Wiederholen dieses Experiment bei verschiedenen Cy3 Oligo-Konzentrationen (60, 100 und 180 nM), um die Linearität zwischen der Kühlrate und der Konzentration der Reaktanten zu bestätigen. Entpacken Sie die zweiter Ordnung Glühen Geschwindigkeitskonstante (k Glühen ) Von der Piste. </li><li> Berechnen Sie die J-Faktor aus <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq6.jpg" /> , Wobei k-Schleife ist der Schlingengeschwindigkeit in der gleichen Pufferbedingungen gemessen. </li></ol>

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

Die Autoren erklären, keine Interessenkonflikte.

Eine einfache Einzelmolekül-FRET-Assay, der auf Looping wurde verwendet, um die Kinetik der DNA von verschiedenen Eigenformen zu studieren. Gekrümmt DNAs können durch Wiederholen eines 10-mer-Sequenz in Phase mit dem Schrauben Zeitraum von 10,5 bp, hergestellt werden, und deren Krümmungen mit PAGE abgeschätzt werden. Diese dsDNAs werden mit klebrigen Enden entwickelt, um transienten Schleife Stabilisierung ermöglichen. Es extrahiert den Schlingengeschwindigkeit von der exponentiellen Anstieg in der Anzahl der Mole...

Das Verständnis der mechanischen Eigenschaften von dsDNA ist von grundlegender Bedeutung in der Grundlagenwissenschaften und technische Anwendungen. Die Struktur der dsDNA ist komplizierter als eine gerade, weil spiralförmigen Leiter Rolle, Neige-und Verdrehungswinkel zwischen aufeinanderfolgenden Basenpaare mit der Sequenz variieren. Temperaturschwankungen können dazu führen, dsDNA zu unterschiedlichen Modi Konformationsfluktuationen wie Biegen, Verdrehen und Strecken unterzogen werden. Übergänge wie Schmelzen und Knicken kann auch unter extremen Bedingungen auftreten. Unter dieser Bewegungen hat dsDNA Biege die auffälligste biologische Wirkung ein. dsDNA Biegung mit Gen-Repression oder Aktivierung, indem zwei entfernten Standorten nahe einander zugeordnet. Es spielt auch eine wichtige Rolle bei der DNA-Verpackung im Zellkern oder ein virales Kapsid. Biegeverformung dsDNA kann experimentell durch die hochauflösende Mikroskopie (AFM-und TEM-2 3) und der ThermoDyn visualisiert werdenamics und Kinetik kann durch Looping-Assays, die chemisch verbinden nebeneinander liegenden Stellen des dsDNA sucht werden. Ein solcher Test ist Ligase-abhängig Cyclisierung 4. In diesem Assay werden dsDNA-Molekülen mit &quot;klebrig&quot; (kohäsiven) Enden zirkularisiert oder durch DNA-Ligase dimerisiert. Durch Vergleichen der Raten der Kreis und die Dimer-Bildung, kann man eine effektive molare Konzentration von einem Ende der DNA in der Nähe des anderen Endes, die als J-Faktor bekannt ist, erhalten. Dieser Faktor ist dimensions J entspricht der Wahrscheinlichkeitsdichte des Findens ein Ende der DNA in einem kurzen Abstand von dem anderen Ende, und spiegelt damit die Flexibilität der DNA. Die Messung der J-Faktor als Funktion der DNA-Länge zeigt viele Merkmale über die DNA Mechanik einschließlich der Persistenz Länge 4,5. Das wurmartige Kette (WLC)-Modell wurde weithin als der kanonischen Polymer-Modell für dsDNA Mechanik basierend auf dem Erfolg in Erklärungen angesehenining der Kraft-Dehnungs-Kurven in DNA ziehen Experimente 6 und richtig Vorhersage der J Faktoren dsDNAs länger als 200 bp 7 erhalten. Allerdings mit der Cyclisierung Assay an dsDNA-Moleküle so kurz wie 100 bp, Cloutier und Widom maßen die J Faktoren, um mehrere Größenordnungen höher als die WLC-Modell-Vorhersage 8 sein. Ein Jahr später, Du et al. J Faktoren erzeugt im Einvernehmen mit dem WLC-Modell mit dem Cyclisierung Assay mit niedrigeren Konzentrationen von Ligase und schrieb den anomalen Ergebnis aus der Gruppe Widom hohen Konzentrationen verwendet Ligase 9. Diese Kontroverse zeigt beispielhaft die unvermeidlichen Einfluss der DNA-Ligase auf Cyclisierung Kinetik bei Verwendung der herkömmlichen Assay 9. Darüber hinaus kann auch auf DNA-Ligase DNA-Struktur und Steifigkeit durch unspezifische Bindung 10,11. Um die technischen Belange der Protein-abhängige Looping-Assays zu beseitigen, vor kurzem haben wir gezeigt, eine protein-kostenlos Looping Assay, der auf Fluoreszenz-Resonanz-Energie-Transfer (FRET) 12. In diesem Verfahren werden geschleift Konformationen von FRET zwischen dem Donor und Akzeptor in der Nähe der klebrigen Enden eines DNA-Moleküls gebunden nachgewiesen. Eine Totalreflexions-Fluoreszenzmikroskopobjektiv-Typ (TIRF) verwendet, um Bahnen der reversible Looping und unlooping Ereignisse von der Oberfläche immobilisierten DNA-Einzelmoleküle für einen längeren Zeitraum aufzuzeichnen. Diese Methode bietet PCR-basierten Aufbau von DNA-Molekülen an Mismatch-freie DNA-Moleküle, die eine entscheidende Verbesserung gegenüber einer ähnlichen Methode Vafabakhsh und Ha 13 zu generieren. Die Einzelmolekül-Aspekt dieses Protokoll ermöglicht die Messung von Verteilungen zusätzlich zu Durchschnittswerte Ensemble während der FRET-Aspekt ermöglicht es, DNA-Looping Dynamik wiederholt aus dem gleichen Molekül messen, auch unter Bedingungen, die Ligase-Aktivität beeinträchtigen können. Die TIRFM Aufbau ist in Abbildung 1 dargestellt. Eine benutzerdefinierteGestalteten Probentisch wird über eine Olympus IX61 Mikroskop Körper platziert. 532 nm und 640 nm-Laser von der Seite eingeführt werden und durch kleine elliptische Spiegel 14 in den hohen NA Ziel reflektiert wird, um kritische Einfallswinkel, unter dem Deckglas-Wasser-Grenzfläche zu erreichen. Wir stellen fest, dass eine weit verbreitete Durch Ziel TIR mit dichroitischen Spiegeln oder Prismen TIR-basierte Setups können auch für diese FRET-Anwendung verwendet werden. Das Fluoreszenzbild durch das Mikroskop gebildet wird durch einen dichroitischen Spiegel in Donor-und Akzeptor-Bilder aufgeteilt. Sie werden dann auf beiden Hälften eines EMCCD erneut abgebildet. Weitere Langpassemissionsfilter verwendet werden, um Hintergrundsignal zu reduzieren. Die Temperaturregelung ist unerlässlich für den Erwerb reproduzierbare kinetischen Daten. Zur Temperaturregelung wird das Ziel aus dem Mundstück des Mikroskopkörpers um die Wärmeübertragung und Wasser von einer Temperatur gesteuert Kühler / Heizung minimieren getrennt durch eine Messing-Kragen, die eng passt in Umlaufum die innere Metall unter der Ziel-Jacke. Diese Einrichtung ist in der Lage, stabile Temperaturregelung an der Deckfläche zwischen 15 und 50 ° C (Fig. 2) zu erreichen. In dieser Arbeit wurde die Probentemperatur auf 24 ° C gehalten wird Das folgende Protokoll zeigt die Schritt-für-Schritt-Verfahren für die DNA-Konstruktion, die Einschätzung der DNA-Form, Einzelmolekül-Experiments, und J-Faktor Bestimmung.

<table border="0" cellpadding="0" cellspacing="0" width="793">
	<tbody>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Small DNA FRAG Extract Kit-100PR</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97060-558</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Acrylamide 40% solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97064-522</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Bis-acrylamide 2% (w/v) solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97063-948</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">GeneRuler 100 bp DNA Ladder, 100-1000 bp</td>
			<td style="width:124px;">Fermentas</td>
			<td>SM0241</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Mini Vertical PAGE System</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">89032-300</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Syringe filter 0.2um CS50</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Trolox</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">238813-1G</td>
			<td>triplet state quencher</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuic acid (PCA)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">08992-50MG</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuate 3,4-Dioxygenase (PCD)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">P8279-25UN</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">mPEG-silane, MW 2000 1g</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">MPEG-SIL-2000-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Biotin-PEG-Silane, MW 3400</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">Biotin-PEG-SIL-3400-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Avidin, NeutrAvidin Biotin-binding Protein</td>
			<td style="width:124px;">Invitrogen</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Phusion Hot Start High-Fidelity DNA Polymerase</td>
			<td style="width:124px;">New England Biolabs</td>
			<td style="width:135px;">F-540L</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Gel/PCR DNA Fragments Extraction Kit</td>
			<td>IBI Scientific</td>
			<td>IB47020</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Premium plain glass microscope slides</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;">12-544-1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">VWR micro cover glass, rectangular, no. 1</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">48404-456</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fisher Scientific Isotemp 1006s Recirculating Chiller/Heater</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;"></td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective Cooling Collar</td>
			<td style="width:124px;">Bioptechs</td>
			<td style="width:135px;">150303</td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">KMI53 Biological Micrometer Measuring Stage</td>
			<td style="width:124px;">Semprex</td>
			<td style="width:135px;">KMI53</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">High Performance DPSS Laser 532nm 50mW&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">NT66-968</td>
			<td>Cy3 excitation</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:351px;">CUBE Fiber Pigtailed 640 nm, 30mW, Fiber, FC/APC Connector</td>
			<td style="width:124px;">Coherent</td>
			<td style="width:135px;">1139604</td>
			<td>Cy5 excitation</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">650 nm BrightLine Dichroic Beamsplitter</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">FF650-Di01-25x36</td>
			<td>splitting dichroic</td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:351px;">LaserMUX Beam Combiner, reflects 514.5, 532, &#38; 543.5 nm lasers, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">LM01-552-25</td>
			<td>combining dichroic</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Brightline Fluorescence Filter 593/40</td>
			<td style="width:124px;">Semrock</td>
			<td>FF01-593/40-25</td>
			<td>Cy3 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">635 nm EdgeBasic LWP longpass Filter, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">BLP01-635R-25</td>
			<td>Cy5 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">EMCCD iXon+</td>
			<td style="width:124px;">Andor Technology</td>
			<td style="width:135px;">DU-897E-CS0-#BV</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">IX51 inverted microscope frame</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective UApo N 100x/1.49 Oil TIRF</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Immersion oil type-F for fluorescence microscopy</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;">IMMOIL-F30CC</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">2mm Diameter 45&#176; Rod Lens Aluminum Coated&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">54-092</td>
			<td>miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">1/4&#34; Travel Single-Axis Translation Stage</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">MS-1</td>
			<td>translation of miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">&#216;1&#34; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-200-A</td>
			<td>focusing lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Adjustable Mechanical Slit</td>
			<td style="width:124px;">Thorlabs</td>
			<td>VA100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dielectric Mirror</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">BB1-E02</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">&#216;1&#34; Achromatic Doublet, f = 100 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-100-A</td>
			<td>relay lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Lens Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LMR1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dichroic Filter Mount</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">FFM1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fixed Cage Cube Platform</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">B3C</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Kinematic Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">KM100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lens, &#216;1&#34;, f = 40 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1422-A</td>
			<td>collimating lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 15 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1222-A</td>
			<td>telescope lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 150 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1433-A</td>
			<td>telescope lens</td>
		</tr>
	</tbody>
</table>

studying dna looping by single-molecule fret

Biegen der Doppelstrang-DNA (dsDNA) mit vielen wichtigen biologischen Prozessen wie der DNA-Protein-DNA-Erkennung und Verpackung in Nukleosomen verbunden. Thermodynamik der dsDNA Biege wurde durch eine Methode namens Cyclisierung, die auf DNA-Ligase kovalent zu verbinden setzt kurz klebrigen Enden eines dsDNA sucht. Allerdings kann Ligationseffizienz durch viele Faktoren, die nicht verwandt sind dsDNA Looping, wie die DNA-Struktur rund um die klebrigen Enden verbunden, und Ligase betroffen sein können auch die scheinbare Schleifenrate beeinflussen durch Mechanismen wie unspezifische Bindung. Hier zeigen wir, wie man dsDNA Looping Kinetik ohne Ligase durch Erfassen transienter DNA-Schleifenbildung durch FRET (Fluorescence Resonance Energy Transfer) zu messen. dsDNA-Moleküle werden mit einem einfachen PCR-basiertes Protokoll mit einem FRET-Paar und einem Biotin-Linker konstruiert. Die Schleifenwahrscheinlichkeitsdichte als die J-Faktor bekannt ist, aus dem Looping Rate und der Kühlrate zwischen zwei abschaltung extrahiertted klebrigen Enden. Durch das Testen zwei dsDNAs mit verschiedenen intrinsischen Krümmungen zeigen wir, dass die J-Faktor ist sensibel für die Eigenform der dsDNA.

DNA-Moleküle für die Untersuchung verwendet Schleifen bestehen aus einem Duplexregion der variablen Sequenz und Länge und einzelsträngige Überhänge, welche komplementär zueinander sind. Die Überhänge, die 7-Basis lang sind, können miteinander zu glühen, um die Loop-Zustand zu erfassen. Jeder Überstand enthält entweder Cy3 oder Cy5, die in dem DNA-Rückgrat durch Amiditchemie verbunden ist. Die Cy5-Überhang ist auch mit Biotin-TEG (15-Atom-Tetra-Ethylen-Glykol-Abstandshalter) für die Oberflächen Immobilis...

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

Diese Studie stellt eine detaillierte experimentelle Verfahren zur Looping Dynamik der Doppelstrang-DNA mit Einzelmolekül-Fluoreszenz-Resonanz-Energie-Transfer (FRET) zu messen. Das Protokoll beschreibt auch, wie die Looping-Wahrscheinlichkeitsdichte genannt J-Faktor zu extrahieren.

Studieren von DNA-Looping von Einzelmolekül-FRET

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

studying-dna-looping-by-single-molecule-fret

Research

JoVE Journal

Biology

15.3K Aufrufe.  Georgia Institute of Technology.  Diese Studie stellt eine detaillierte experimentelle Verfahren zur Looping Dynamik der Doppelstrang-DNA mit Einzelmolekül-Fluoreszenz-Resonanz-Energie-Transfer (FRET) zu messen. Das Protokoll beschreibt auch, wie die Looping-Wahrscheinlichkeitsdichte genannt J-Faktor zu extrahieren. 

Serie: Studying DNA Looping by Single-Molecule FRET

Single Molecule Methods for Monitoring Changes in Bilayer Elastic Properties

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein interactions and more general lipid bilayer-protein interactions. These interactions are particularly important in pharmacological research, as many current pharmaceuticals on the market can alter the lipid bilayer material properties, which can lead to altered membrane protein function.   The formation of gramicidin channels are dependent on conformational changes in gramicidin subunits which are in turn dependent on the properties of the lipid.  Hence the gramicidin channel  current is a reporter of altered properties of the bilayer due to certain compounds.  

Membrane protein function is regulated by the cell membrane lipid composition. This video-article details how to form a patch using bilayer patch electrodes, as well as how to use gramicidin channels as reporters of altered membrane properties.

Single Molecule Methoden zur Überwachung von Veränderungen in Bilayer Elastic Properties

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein ...

Forschung

Biologie

Combining QD-FRET and Microfluidics to Monitor DNA Nanocomplex Self-Assembly in Real-Time

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically functional inside the cell, nucleic acid-based therapeutics require an efficient intracellular delivery system. One widely adopted approach is to complex DNA with a gene carrier to form nanocomplexes via electrostatic self-assembly, facilitating cellular uptake of DNA while protecting it against degradation. The challenge lies in the rational design of efficient gene carriers, since premature dissociation or overly stable binding would be detrimental to the cellular uptake and therapeutic efficacy. Nanocomplexes synthesized by bulk mixing showed a diverse range of intracellular unpacking and trafficking behavior, which was attributed to the heterogeneity in size and stability of nanocomplexes. Such heterogeneity hinders the accurate assessment of the self-assembly kinetics and adds to the difficulty in correlating their physical properties to transfection efficiencies or bioactivities. We present a novel convergence of nanophotonics (i.e. QD-FRET) and microfluidics to characterize the real-time kinetics of the nanocomplex self-assembly under laminar flow. QD-FRET provides a highly sensitive indication of the onset of molecular interactions and quantitative measure throughout the synthesis process, whereas microfluidics offers a well-controlled microenvironment to spatially analyze the process with high temporal resolution (~milliseconds). For the model system of polymeric nanocomplexes, two distinct stages in the self-assembly process were captured by this analytic platform. The kinetic aspect of the self-assembly process obtained at the microscale would be particularly valuable for microreactor-based reactions which are relevant to many micro- and nano-scale applications. Further, nanocomplexes may be customized through proper design of microfludic devices, and the resulting QD-FRET polymeric DNA nanocomplexes could be readily applied for establishing structure-function relationships. 

We present a novel and powerful integration of nanophotonics (QD-FRET) and microfluidics to investigate the formation of polyelectrolyte polyplexes, which is expected to provide better control and synthesis of uniform and customizable polyplexes for future nucleic acid-based therapeutics.

Die Kombination QD-FRET-und Mikrofluidik, um DNA Nanocomplex Self-Assembly in Real-Time Monitor

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically ...

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides (Figure 1). The growing product double-strand DNA (dsDNA) is extended with laminar flow and visualized by using an intercalating dye. Measuring the position of the growing DNA end in real time allows precise determination of replication rate (Figure 2). Furthermore, the length of completed DNA products reports on the processivity of replication. This experiment can be performed very easily and rapidly and requires only a fluorescence microscope with a reasonably sensitive camera.


This protocol demonstrates a simple single-molecule fluorescence microscopy technique for visualizing DNA replication by individual replisomes in real time.

Visualizing Einzel-Molekül-DNA-Replikation mit Fluoreszenz-Mikroskopie

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

Automated System für Single Molecule Fluorescence Messungen der Oberflächen-immobilisierten Biomoleküle

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. Linearized &lambda; DNA is modified to have a biotin on the end of one strand, and a digoxigenin moiety on the other end of the same strand. The biotinylated end is attached to a functionalized glass coverslip and the digoxigeninated end to a small bead. The assembly of these DNA-bead tethers on the surface of a flow cell allows a laminar flow to be applied to exert a drag force on the bead. As a result, the DNA is stretched close to and parallel to the surface of the coverslip at a force that is determined by the flow rate (Figure 1). The length of the DNA is measured by monitoring the position of the bead. Length differences between single- and double-stranded DNA are utilized to obtain real-time information on the activity of the replication proteins at the fork. Measuring the position of the bead allows precise determination of the rates and processivities of DNA unwinding and polymerization (Figure 2).

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system.

Direkte Beobachtung von Enzymen Replizieren DNA Mit einem Single-Molekül DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

Single-Molecule Imaging of Nuclear Transport

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the last decade. The investigation of molecular interactions with high temporal and spatial resolutions deep within cells has remained challenging due to the inherently weak signals arising from individual molecules. Recent works by Yang et al. demonstrated that narrow-field epifluorescence microscopy allows visualization of nucleocytoplasmic transport at the single molecule level. By the single molecule approach, important kinetics, such as nuclear transport time and efficiency, for signal-dependent and independent cargo molecules have been obtained. Here we described a protocol for the methodological approach with an improved spatiotemporal resolution of 0.4 ms and 12 nm. The improved resolution enabled us to capture transient active transport and passive diffusion events through the nuclear pore complexes (NPC) in semi-intact cells. We expect this method to be used in elucidating other binding and trafficking events within cells.

Single molecule microscopy approch provided novel insights into nuclear transport.

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the ...

Monitoring Kinase and Phosphatase Activities Through the Cell Cycle by Ratiometric FRET

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such probes typically consist of variants of CFP and YFP, intervened by a phosphorylatable sequence and a phospho-binding domain. Upon phosphorylation, the probe changes conformation, which results in a change of the distance or orientation between CFP and YFP, leading to a change in FRET efficiency (Fig 1). Several probes have been published during the last decade, monitoring the activity balance of multiple kinases and phosphatases, including reporters of PKA2, PKB3, PKC4, PKD5, ERK6, JNK7, Cdk18, Aurora B9 and Plk19. Given the modular design, additional probes are likely to emerge in the near future10. 
Progression through the cell cycle is affected by stress signaling pathways 11. Notably, the cell cycle is regulated differently during unperturbed growth compared to when cells are recovering from stress12.Time-lapse imaging of cells through the cell cycle therefore requires particular caution. This becomes a problem particularly when employing ratiometric imaging, since two images with a high signal to noise ratio are required to correctly interpret the results. Ratiometric FRET imaging of cell cycle dependent changes in kinase and phosphatase activities has predominately been restricted to sub-sections of the cell cycle8,9,13,14.
Here, we discuss a method to monitor FRET-based probes using ratiometric imaging throughout the human cell cycle. The method relies on equipment that is available to many researchers in life sciences and does not require expert knowledge of microscopy or image processing.

FRET-based reporters are increasingly used to monitor kinase and phosphatase activities in live cells. Here we describe a method on how to use FRET-based reporters to assess cell cycle-dependent changes in target phosphorylation.

Überwachung Kinase und Phosphatase-Aktivitäten durch den Zellzyklus durch Ratiometric FRET

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such ...

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage (CoTrAC)

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method makes it possible to count the numbers of protein molecules produced in one cell during sequential, five-minute time windows. It requires a fluorescence microscope with laser excitation power density of ~0.5 to 1 kW/cm2, which is sufficiently sensitive to detect single fluorescent protein molecules in live cells. The fluorescent reporter used in this method consists of three parts: a membrane targeting sequence, a fast-maturing, yellow fluorescent protein and a protease recognition sequence. The reporter is translationally fused to the N-terminus of a protein of interest. Cells are grown on a temperature-controlled microscope stage. Every five minutes, fluorescent molecules within cells are imaged (and later counted by analyzing fluorescence images) and subsequently photobleached so that only newly translated proteins are counted in the next measurement.
Fluorescence images resulting from this method can be analyzed by detecting fluorescent spots in each image, assigning them to individual cells and then assigning cells to cell lineages. The number of proteins produced within a time window in a given cell is calculated by dividing the integrated fluorescence intensity of spots by the average intensity of single fluorescent molecules. We used this method to measure expression levels in the range of 0-45 molecules in single 5 min time windows. This method enabled us to measure noise in the expression of the &lambda; repressor CI, and has many other potential applications in systems biology.

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage CoTrAC

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC), to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method has been used to follow the stochastic expression dynamics of a transcription factor, the &lambda; repressor CI 1.

Einzel-Molekül-Imaging der Genregulation<em&gt; In vivo</em&gt; Verwenden cotranslationalen Aktivierung durch Spaltung (CoTrAC)

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells ...

Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable.

Here we describe the instrumentation and methods for detecting single fluorescently-labeled protein molecules interacting with a single DNA molecule suspended between two optically trapped microspheres.

Die Kombination von Einzelmolekül-Imaging und Manipulation für das Studium der Protein-DNA-Wechselwirkungen

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method ...

FRET Imaging in Three-dimensional Hydrogels

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly employ two-dimensional (2D) culture, which does not mimic the three-dimensional (3D) cellular microenvironment. A method to perform quenched emission FRET imaging using conventional widefield epifluorescence microscopy of cells within a 3D hydrogel environment is presented. Here an analysis method for ratiometric FRET probes that yields linear ratios over the probe activation range is described. Measurement of intracellular cyclic adenosine monophosphate (cAMP) levels is demonstrated in chondrocytes under forskolin stimulation using a probe for EPAC1 activation (ICUE1) and the ability to detect differences in cAMP signaling dependent on hydrogel material type, herein a photocrosslinking hydrogel (PC-gel, polyethylene glycol dimethacrylate) and a thermoresponsive hydrogel (TR-gel). Compared with 2D FRET methods, this method requires little additional work. Laboratories already utilizing FRET imaging in 2D can easily adopt this method to perform cellular studies in a 3D microenvironment. It can further be applied to high throughput drug screening in engineered 3D microtissues. Additionally, it is compatible with other forms of FRET imaging, such as anisotropy measurement and fluorescence lifetime imaging (FLIM), and with advanced microscopy platforms using confocal, pulsed, or modulated illumination.

F&#246;rster resonance energy transfer (FRET) imaging is a powerful tool for real-time cell biology studies. Here a method for FRET imaging cells in physiologic three-dimensional (3D) hydrogel microenvironments using conventional epifluorescence microscopy is presented. An analysis for ratiometric FRET probes that yields linear ratios over the activation range is described.

FRET-Imaging im dreidimensionalen Hydrogelen

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly ...