We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

NOTA: Declaración de Ética: Los procedimientos que implican sujetos animales fueron aprobados por el Comité de Bienestar Animal de la Universidad de Hamburgo y la Universidad de Saarland. 1. Preparación y fijación de tejido embrionario <ol><li> Organizar todos los equipos necesarios para diseccionar los embriones y preparar soluciones para la posterior fijación de los tejidos antes de sacrificar a los animales. NOTA: Siempre preparar una solución fresca 4% de paraformaldehído (PFA) (4% PFA en 0,1 M tampón fosfato salino (PBS), ajustar el pH a 7,4). </li><li> La eutanasia cronometrado ratón hembra embarazada con un procedimiento éticamente aprobado. </li><li> Transferir el ratón sobre una plataforma. Humedezca la cara ventral del abdomen con etanol al 70% y hacer una incisión vertical con unas tijeras afiladas para exponer la cavidad abdominal. </li><li> Identificar la cadena embrionario y tire de ella con cuidado aplicando fórceps romos y colocarlo en helado de PBS. </li><li> Retire los embriones individuales dela cadena de embriones utilizando finas tijeras y pinzas. Quitar el tejido extra alrededor de los embriones y lávelos con helado de PBS. </li><li> Tomar una pequeña biopsia de cola (antes de transferir el embrión en PFA) y se incuba en tampón de lisis de la cola para la identificación de género y genotipado alelo trazador PCR. </li><li> Iniciar en el embrión en el lado más lateral y transferir cada embrión por separado en un tubo que contiene helado 4% PFA en el hielo en una coctelera. </li><li> Remojar los embriones a la edad de E13.5 o menos durante 1,5 h en hielo con agitación constante. Remojar los embriones en E14.5 E15.5 edad y durante 2,5 horas en hielo con agitación constante. </li><li> Por E16.5 embriones edad o más, decapitar y quitar la piel exterior antes de remojar la cabeza en una solución de PFA. Jefes de embriones E16.5 pueden ser remojados durante 4,5 horas en hielo con agitación constante. </li><li> Después de la fijación apropiada, lavar los embriones tres veces con PBS enfriado con hielo. La transferencia de los embriones en 30% de sacarosa en solución de PBS a 4 ° C hasta que se hundena la parte inferior. </li></ol> 2. Congelación <ol><li> Organizar todos los materiales necesarios antes de iniciar el proceso de congelación: crio-moho, crio-guantes, pinzas entomología peso pluma, rotulador y compuestas temperatura óptima de corte (OCT) </li><li> Etiquetar el molde crio con un marcador permanente resistente al alcohol (mencionar la orientación del tejido, la fecha y genotipo). Preparar un granizado de hielo seco triturado y etanol al 100% en un cubo de hielo. Coloque un vaso de vidrio en el interior contiene isopentano. Espere 10 minutos para el isopentano se enfríe. </li><li> Mientras tanto eliminar el tejido de la solución de sacarosa, limpie el exceso de sacarosa en todo el tejido utilizando toallitas de laboratorio. Transferir el tejido en un crio-molde previamente etiquetado con suficiente octubre para cubrir el tejido. Evite las burbujas de aire en los PTU; especialmente alrededor del tejido. </li><li> Oriente el tejido en octubre utilizando pinzas entomología peso pluma para evitar daños en los tejidos. Iniciar la congelación mediante la transferencia de la crio-mold en el baño de isopentano enfriado previamente. No salpique isopentano en el octubre, ya que no se congele correctamente. Envuelva las muestras en papel de aluminio y guardar a -80 ° C. </li></ol> 3. cryosectioning <ol><li> Cortar 14 m de serie de secciones delgadas en serie de cinco usando un criostato y recoger en portaobjetos de vidrio SuperFrost® Plus para inmunofluorescencia análisis (SI). Guarde las diapositivas a -80 ° C hasta su utilización. </li></ol> 4. trazador visualización utilizando el protocolo (TSA) tiramida amplificación de señal <ol><li> Preparar los tampones y reactivos necesarios para la tinción. Siempre recién preparar el tampón Tris-NaCl-Tween (TNT) en el día de uso. <ol><li> Preparar tampón TNT utilizando 100 ml de M Tris-HCl 1 pH 7,5, 30 ml de NaCl 5 M y ddH 2 O hasta un volumen final de 1 L. Añadir 500 l de Tween 20 utilizando una pipeta de 1 ml. Añadir el Tween 20 lentamente y lave la pipeta hacia arriba y abajo varias veces para asegurarse de que todo está en Tween 20solución. </li><li> Prepare Tris-NaCl-bloqueo (TNB) buffer usando 100 ml de M Tris-HCl 1 pH 7,5, 30 ml de NaCl 5 M y ddH 2 O hasta un volumen final de 1 L. Añadir 5 g de reactivo de bloqueo (proporcionado con el kit) lentamente en pequeños incrementos a la memoria intermedia mientras se agitaba. Calentar la solución gradualmente a 55 ° C con agitación continua para disolver completamente el reactivo de bloqueo (esto no debería llevar más de 30 a 60 min). Para conseguir un calentamiento homogéneo utilizar un baño de agua a 55 ° C. La solución aparecerá lechoso. Llevar la solución a temperatura ambiente antes de usar. Alícuota y almacenar a -20 ° C para el almacenamiento a largo plazo. </li><li> Reconstituir el reactivo tiramida biotina (suministrado con el kit) en Biología Molecular / grado HPLC DMSO. Dependiendo de qué kit se utiliza la cantidad apropiada de DMSO puede variar. La solución madre, a 4 ° C. NOTA: Las secciones de los animales heterocigotos para los alelos respectivos Cre y R26 pueden ser utilizados para el análisis de circuitos. Uso sreflexiones de los compañeros de camada que llevan uno Cre o un alelo R26, respectivamente, como controles negativos. Tratar portaobjetos controles negativos exactamente como diapositivas de animales dobles heterocigotos. Además, incluyen una corredera de control de un animal heterocigota doble, pero dejar de lado el reactivo TSA (control sin amplificar). </li></ol></li><li> Con un bisturí afilado fresco eliminar el exceso de octubre en torno a los cortes de tejido y marca la frontera alrededor de las secciones con un lápiz PAP. </li><li> Secar los portaobjetos durante 2-3 min a temperatura ambiente (RT). Se lavan los portas a TA 3x con TNT durante 5 minutos cada uno. Incubar los portaobjetos a TA durante 30 min en 0,3% de H 2 O 2 solución en metanol enfriado con hielo para apagar la actividad de la peroxidasa endógena. </li><li> Lavar 3x con PBS durante 5 min cada uno a TA. Incubar durante 10 min en 0,5% de Triton X-100 en PBS para la permeabilización del tejido. Se lavan los portas a TA 3x con TNT durante 5 minutos cada uno. </li><li> Bloquear con TNB (solución de bloqueo, 200-300 l por diapositiva) para 30min a RT en una cámara humidificada. Asegúrese de que todas las secciones están completamente cubiertas por TNB. No deje que los portaobjetos se sequen entre los pasos. </li><li> Escurrir el exceso de tampón de bloqueo y aplicar el antisuero primario reconocer el trazador (1: 1000 de cabra anti-WGA para BL, 1: 15.000 de conejo anti-GFP para GTT) diluido en TNB durante 2 horas a RT o durante la noche a 4 ° C. Asegúrese de utilizar un volumen suficiente para cubrir completamente la sección de tejido (200-300 l por diapositiva). NOTA: Las diluciones de antisueros primarios recomendados aquí pueden tener que ser ajustada. </li><li> Se lavan los portas a TA 3x con TNT durante 5 minutos cada uno con agitación. </li><li> Se incuban las secciones con antisuero secundario biotinilado que reconocen el anfitrión de la primera antisuero (1: 500 caballo anti-IgG de cabra anti-WGA, 1: 5.000 de cabra anti-IgG de conejo anti-GFP en TNB durante 1 hora a temperatura ambiente). </li><li> Lavar 3 veces con TNT a TA durante 5 min cada uno con agitación. Incubar en 1: 100 de estreptavidina (SA) y conjugado con peroxidasa de rábano picante (SA-HRP, wi proporcionadoth el kit) en TNB durante 30 min a RT en una cámara humidificada. Se lavan los portas a TA 3x con TNT durante 5 minutos cada uno. Mientras tanto descongelar la TSA. </li><li> Diluir 1:50 en TSA TSA diluyente de amplificación (suministrado con el kit, que utilicen el kit TSA para la visualización de BL y el kit TSA + para GTT). Incubar las secciones de tejido en diluido TSA precisamente por 10 min a RT. Diluir TSA justo antes de su uso, idealmente durante la etapa de lavado anterior, no utilice ningún restante diluida reactivo TSA para futuros experimentos; prepare siempre fresco. </li><li> Se lavan los portas a TA 3x con TNT durante 5 minutos cada uno con agitación. Incubar con 1: 500 Alexa Fluor® 546 de estreptavidina conjugada en TNB durante 30 min a RT. Se lavan los portas a TA 3x con TNT durante 5 minutos cada uno con agitación. </li><li> Incubar durante 10 min en solución bisbenzimide 5% en PBS a RT para la tinción nuclear. Se lavan los portas a TA 3x con TNT durante 5 minutos cada uno con agitación. Montar con Fluromount G y realizar epifluorescencia o microscopía confocal. <em&gt; Solución de problemas: La eficacia de la transferencia de trazador dependerá del nivel de expresión del locus ROSA26 en las células productoras (determinado por la línea de conductor Cre utilizado) y en el circuito neural analizado (por ejemplo, número de neuronas que producen el trazador, la convergencia etc.). Por lo tanto las diluciones de antisueros primarios recomendados aquí pueden tener que ajustarse para evitar que la señal baja o exceso. Antecedentes siempre debe ser analizado utilizando portaobjetos de control apropiados (véase más arriba). </li></ol> 5. τlacZ tinción de secciones embrionarias <ol><li> Preparar los tampones y reactivos necesarios para la tinción. Siempre recién preparar el tampón de LacZ C antes de su uso. <ol><li> Preparar 5-bromo-4-cloro-3-indolil-β-D-galactopiranósido (X-gal) solución madre (40 mg / ml) mediante la adición de 40 g de X-gal a 1 ml 70% de dimetilformamida (DMF). Cubra con papel aluminio y almacenar a -20 ° C para el almacenamiento a largo plazo. </li><li> Preparar nitro azul tetrazolio (NBT) stock solución (50 mg / ml) mediante la adición de 50 g de NBT a 1 ml 70% de DMF. Cubra con papel aluminio y almacenar a -20 ° C para el almacenamiento a largo plazo. </li><li> Prepare LacZ fijador utilizando 80 l de glutaraldehído al 25%, 5 ml de PFA al 4%, 20 l de 1 M de MgCl 2, 100 l de EGTA 500 ​​mM, 1 ml de 1 M de tampón fosfato pH 7,4 y ddH 2 O hasta una final volumen de 10 ml. </li><li> Prepare LacZ tampón A utilizando 1 ml de 1 M de MgCl 2, 5 ml de EGTA 500 ​​mM, 50 ml de 1 M tampón fosfato pH 7,4 y ddH 2 O hasta un volumen final de 500 ml. </li><li> Preparar tampón B LacZ usando 1 ml de 1 M de MgCl 2, 5 ml de EGTA 500 ​​mM, 5 ml de 1% de desoxicolato de sodio, 100 ml de 10% de NP-40, 50 ml de tampón de fosfato 1 M pH 7,4 y ddH 2 O hasta un volumen final de 500 ml. </li><li> Prepare el buffer de LacZ C mediante la adición de 10 l de solución de NBT y 12,5 l de X-gal solución madre a 1 ml de tampón LacZ B. Hacer fresco justo antes de su uso y cubrir con papel de aluminio. </li></ol&gt; </li><li> Seque las diapositivas a TA al menos durante 10-15 minutos (mientras tanto preparar las diapositivas con un lápiz PAP). </li><li> Fije la sección con LacZ fijador durante 2 minutos a temperatura ambiente en una cámara húmeda en el interior una sustancia química del humo del capó. Lavar 3 veces con PBS suplementado con 2 mM MgCl2. </li><li> Enjuagar los portaobjetos con tampón LacZ A. Lave los portaobjetos con LacZ tampón A 3 veces durante 10 minutos cada uno a temperatura ambiente. Lavar 2 veces con tampón LacZ B durante 5 minutos cada uno. Incubar los portaobjetos en tampón LacZ C a 30-37 ° C durante 6 horas o toda la noche en una cámara húmeda. NOTA: Añadir suficiente volumen de tampón LacZ C; diapositivas no debe secarse durante la incubación. </li><li> Después de la incubación adecuada lavan los portaobjetos con PBS suplementado con 2 mM MgCl2. Enjuague secciones brevemente con ddH 2 O. Cubreobjetos con glicina gelatina de Mayer. Adecuado para un microscopio de luz equipado con un contraste de interferencia diferencial (DIC) de formación de imágenes set-up. </li></ol> 6. Gender y trazador Genotipado <ol><li> Preparar la cola tampón de lisis usando 1 ml de M Tris-HCl pH 8,5 1, 100 l de EGTA 500 ​​mM, 200 l de 10% SDS, 400 l de NaCl 5 M y ddH 2 O para hacer un volumen final de 10 ml. </li><li> Añadir 500 l de tampón de lisis de la cola a cada tubo Eppendorf que contiene una biopsia de la cola. Añadir proteinasa K a una concentración final de 100 mg / ml. Incubar toda la noche en un agitador a 55 ° C. </li><li> Centrifugar las muestras a 17.000 xg durante 10 min a TA. Transferir el sobrenadante a un nuevo tubo de centrífuga. Añadir 500 l de isopropanol al sobrenadante. Mezclar durante al menos 5 min invirtiendo los tubos arriba y hacia abajo. </li><li> Girar en centrifugar a 17.000 xg durante 5 min a TA. Retirar el sobrenadante. Añadir 200 l de etanol al 70%. Agitar durante al menos 5 min. </li><li> Se centrifuga a 17.000 xg durante 5 min. Aspirar el sobrenadante con una Pipetman (no vierta apagado). Secar el precipitado en una cámara caliente (37 ° C) durante 15-30 min. </li><li> Resuspender pellet en 100 lde bajo TE pH 8,0 o agua usando puntas de ancho de ánima se filtró. Ponga en 55 ° C durante 1 hora y a 37 ° C durante la noche para disolución adecuada. Almacenar a 4 ° C. </li><li> Utilice 1 l de ADN para la reacción de PCR (mezcla de reacción 50 l que contiene 1 l de ADN de la cola, 2,5 l DMSO, 22:00 de cada cebador, 25 M de cada dNTP, y betaína 1M). Cebadores de PCR para genotipificación y la identificación de género se enumeran en la tabla de Materiales. </li></ol>

<ol>
	<li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals.">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li><li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+approaches+to+neural+circuits+in+the+mouse.">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li><li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+half+century+of+experimental+neuroanatomical+tracing.">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li><li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus.">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li><li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero.">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li><li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+approach+to+trace+neural+circuits.">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li><li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice.">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li><li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54.">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li><li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GPR54+gene+as+a+regulator+of+puberty.">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li><li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons.">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li><li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice.">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67 (2005).</li><li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene.">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li><li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-activated+site-specific+recombination+in+mice.">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li></ol>

No conflict of interest declared.

Expresando trazadores transsynaptic como transgenes para rastrear los circuitos neurales de poblaciones neuronales definidas genéticamente tiene varias ventajas en comparación con la inyección estereotáxica de trazadores o virus neurotopic. En primer lugar, el trazador se produce como una proteína endógena y por lo tanto no provoca ninguna respuesta inmune y una vía neural selectiva puede ser analizada en diferentes animales con alta reproducibilidad. En segundo lugar, porque este es un método no invasivo que se...

Rastreo de ruta anatómica es una de las herramientas más comúnmente utilizadas para descifrar la relación entre el cerebro y el comportamiento 1. El avance en las tecnologías de circuitos neuronales rastreo ha otorgado neurocientíficos con la capacidad de rastrear los circuitos neuronales de poblaciones de neuronas identificadas genéticamente en ratones 2. A pesar de estos avances técnicos que sigue siendo un reto para desentrañar la formación de circuitos neuronales especialmente durante la maduración embrionaria. Esto es porque la mayoría de los métodos de rastreo desarrolladas hasta la fecha se basan en la inyección estereotáxica de trazadores transsynaptic o virus neurotróficos modificados genéticamente (Figura 1) 2,3. Si bien estas técnicas de lograr la resolución espacial y temporal de la conectividad, varias limitaciones inherentes, tales como inyecciones de trazadores técnicamente desafiantes en el cerebro en desarrollo, la reproducibilidad de la sitio de la inyección, inflamación potencial en el sitio de la inyección y lo más importante citotoxicidad causada por los virus neurotróficos limitar su uso 4. Un método alternativo consiste en expresar los trazadores transsynaptic como transgenes en ratones genéticamente alterados. Recientemente hemos modificado esta técnica y ha desarrollado un sistema de rastreo transsynaptic genética binaria para mapear los circuitos neurales de una población neuronal identificado genéticamente 5. Nuestra estrategia experimental se basa en dos nuevas cepas de ratón knock-in, que expresan ya sea la lectina de cebada trazador bidireccional (BL) 6 o el trazador retrógrado fragmento de la toxina tetánica C fusionado a GFP (GTT) 7 desde el locus ROSA 26 después mediada por Cre recombinación. Aquí hemos utilizado estas cepas de ratón para expresar selectivamente BL y GTT en las neuronas que producen kisspectina, un neuropéptido que está implicada en la regulación de la maduración del eje reproductivo 8,9. Se demuestra que esta técnica es adecuado para visualizar el desarrollo y maduración del besocircuitos neuronales peptina durante el desarrollo embrionario del cerebro del ratón hembra 5. Estrategia de cría El R26-BL-IRES-τlacZ (BIZ) y los R26-GFP-TTC (GTT) líneas trazadoras son ronda en cepas 5 que llevan alelos ROSA26 recombinantes. El R26-BIZ y los alelos R26-GTT son transcripcionalmente silencioso debido a la presencia de una fuerte señal de parada transcripcional, que está flanqueado por dos sitios loxP 5. Expresión del transgén BIZ GTT y se activa por la eliminación mediada por Cre de la señal de parada transcripcional. Los alelos R26 y R26-BIZ-GTT se pueden utilizar independientemente con sólo cruzar con una línea piloto Cre. Para los animales de análisis de heterocigotos para los alelos respectivos Cre y R26 pueden ser utilizados. Littermates que llevan uno Cre o un alelo R26, respectivamente, deben ser utilizados como controles. Alternativamente, también es posible generar tRiple ronda en animales portadores de los alelos Cre, R26 y R26-BIZ-GTT, sin embargo esto requerirá una cruz adicional.

<table border="0" cellpadding="0" cellspacing="0" width="721">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:219px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bisbenzimide (Hoechst 33258 dye)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">14530-100MG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">32205-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryo mold (Peel-a-way)</td>
			<td style="width:219px;">Polyscience Inc.</td>
			<td style="width:119px;">18646A-1</td>
			<td>22mm x 22mm x 20mm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DMSO</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D8418-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Dimethyl Formamide (DMF)</td>
			<td style="width:219px;">VWR Chemicals</td>
			<td style="width:119px;">23470,293</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EGTA</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3054.3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fluoromount G</td>
			<td style="width:219px;">Southern Biotech</td>
			<td style="width:119px;">0100-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glutaraldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">G5882-50ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hydrogen peroxide</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">34988-7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Isopentane (Methyl 2-butane)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">M32631-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kaiser&#39;s Glycine gelatin</td>
			<td style="width:219px;">Merck</td>
			<td style="width:119px;">1092420100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Methanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">494437-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">MgCl2</td>
			<td style="width:219px;">Sigma</td>
			<td>M2670-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NaCl</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">HN00.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NBT</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">298-83-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Nonidet P40 substitute</td>
			<td style="width:219px;">Fluka</td>
			<td style="width:119px;">743.85</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">OCT</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">14020108926</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PAP pen</td>
			<td style="width:219px;">Dako</td>
			<td style="width:119px;">S2002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Parafarmaldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">P6148-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium deoxycholate</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D6750-25G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sucrose</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">S7903-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Superfrost slides</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">FT4981GLPLUS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL700</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA plus kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL749A001KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">AE15.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Triton-X 100</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3051.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tween 20</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">9127.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">X-gal</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">2315.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryostat</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">na</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Light microscope equipped with DIC imaging&#160;</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Fluroscence microscope</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Photoshop</td>
			<td style="width:219px;">Adobe</td>
			<td style="width:119px;">PS6</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Goat anti-WGA (recognizes BL)</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">AS-2024</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylayted horse anti-goat IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-9500&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated goat anti-rabbit IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-1000&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Rabbit anti-GFP (recognizes GTT)</td>
			<td style="width:219px;">Invitrogen</td>
			<td style="width:119px;">A11122</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rabbit anti-GnRH</td>
			<td style="width:219px;">Affinity Bio Reagent</td>
			<td style="width:119px;">PA1-121</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dylight488-donkey anti-rabbit IgG</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">SA5-10038</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SA-Alexa Fluor 546</td>
			<td style="width:219px;">Life Technologies</td>
			<td>S-11225</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Primers</td>
			<td style="width:219px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Fwd (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;ATGAAGATGATGAGCACCAG 
			GGC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Rev&#160; (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;AGCCCTCGCCGCAGAACTC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Fwd&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCGATGCAACGAGTGATGAG 
			GTTCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Rev&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCAGGCTAAGTGCCTTCTCTAC 
			ACCTGC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Fwd&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">AGCAAGGGCGAGGAGCTGTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Rev&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCTTGTAGTTGCCGTCGTCCT 
			TGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Fwd (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">TGAAGCTTTTGGCTTTGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Rev&#160; (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCGCTGCCAAATTCTTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ROSA26 Fwd</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">ROSA26 Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">GCAGATGGAGCGGGAGAAAT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">SA Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
	</tbody>
</table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

Esta sección muestra los resultados representativos que se pueden obtener a trabajar con el R26-BIZ (B L I RES-τlac Z) y la R26-GTT (G FP-TT C) alelos. Aquí se utiliza el R26-BIZ y los alelos R26-GTT para analizar la maduración de los circuitos neuronales que regulan el eje reproductivo. La reproducción en los vertebrados está controlado por un pequeño grupo de neuronas en el hipotálamo, que secretan la hormona liberadora de gonadotropina (GnRH). Kisspepti...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

Condicional transsynaptic genética Seguimiento en el cerebro de embriones de ratón

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.6K vistas.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

Video: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Manual Drainage of the Zebrafish Embryonic Brain Ventricles

Cerebrospinal fluid (CSF) is a protein rich fluid contained within the brain ventricles. It is present during early vertebrate embryonic development and persists throughout life. Adult CSF is thought to cushion the brain, remove waste, and carry secreted molecules1,2. In the adult and older embryo, the majority of CSF is made by the choroid plexus, a series of highly vascularized secretory regions located adjacent to the brain ventricles3-5. In zebrafish, the choroid plexus is fully formed at 144 hours post fertilization (hpf)6. Prior to this, in both zebrafish and other vertebrate embryos including mouse, a significant amount of embryonic CSF (eCSF) is present . These data and studies in chick suggest that the neuroepithelium is secretory early in development and may be the major source of eCSF prior to choroid plexus development7.
eCSF contains about three times more protein than adult CSF, suggesting that it may have an important role during development8,9. Studies in chick and mouse demonstrate that secreted factors in the eCSF, fluid pressure, or a combination of these, are important for neurogenesis, gene expression, cell proliferation, and cell survival in the neuroepithelium10-20. Proteomic analyses of human, rat, mouse, and chick eCSF have identified many proteins that may be necessary for CSF function. These include extracellular matrix components, apolipoproteins, osmotic pressure regulating proteins, and proteins involved in cell death and proliferation21-24. However, the complex functions of the eCSF are largely unknown.
We have developed a method for removing eCSF from zebrafish brain ventricles, thus allowing for identification of eCSF components and for analysis of the eCSF requirement during development. Although more eCSF can be collected from other vertebrate systems with larger embryos, eCSF can be collected from the earliest stages of zebrafish development, and under genetic or environmental conditions that lead to abnormal brain ventricle volume or morphology. Removal and collection of eCSF allows for mass spectrometric analysis, investigation of eCSF function, and reintroduction of select factors into the ventricles to assay their function. Thus the accessibility of the early zebrafish embryo allows for detailed analysis of eCSF function during development.

We present a method to collect cerebrospinal fluid (CSF) and to create a system which lacks CSF within the embryonic zebrafish brain ventricular system. This allows for further examination of CSF composition and its requirement during embryonic brain development.

Drenaje Manual de los ventrículos del cerebro embrionario de pez cebra

Cerebrospinal fluid  (CSF) is a protein rich fluid contained within the brain ventricles. It is  present during early vertebrate embryonic development and ...

Investigación

Neurociencias

Selective Tracing of Auditory Fibers in the Avian Embryonic Vestibulocochlear Nerve

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling of auditory axons within the VIIIth cranial nerve would enhance the study of central auditory circuit development. This approach is challenging because multiple sensory organs of the inner ear contribute to the VIIIth nerve 1. Moreover, markers that reliably distinguish auditory versus vestibular groups of axons within the avian VIIIth nerve have yet to be identified. Auditory and vestibular pathways cannot be distinguished functionally in early embryos, as sensory-evoked responses are not present before the circuits are formed. Centrally projecting VIIIth nerve axons have been traced in some studies, but auditory axon labeling was accompanied by labeling from other VIIIth nerve components 2,3. Here, we describe a method for anterograde tracing from the acoustic ganglion to selectively label auditory axons within the developing VIIIth nerve. First, after partial dissection of the anterior cephalic region of an 8-day chick embryo immersed in oxygenated artificial cerebrospinal fluid, the cochlear duct is identified by anatomical landmarks. Next, a fine pulled glass micropipette is positioned to inject a small amount of rhodamine dextran amine into the duct and adjacent deep region where the acoustic ganglion cells are located. Within thirty minutes following the injection, auditory axons are traced centrally into the hindbrain and can later be visualized following histologic preparation. This method provides a useful tool for developmental studies of peripheral to central auditory circuit formation.

Here we describe a microdissection technique followed by fluorescent dye injection into the acoustic ganglion of early chick embryos for selective tracing of auditory axon fibers in the nerve and hindbrain.

Rastreo Selectivo de Fibras auditivo en el nervio vestíbulo coclear aviar embrionarias

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling ...

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Inyección estereotáxica de un vector viral para la manipulación genética condicional en la médula espinal de ratón

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

Angiogenesis is the complex process of new blood vessel formation defined by the sprouting of new blood vessels from a pre-existing vessel network. Angiogenesis plays a key role not only in normal development of organs and tissues, but also in many diseases in which blood vessel formation is dysregulated, such as cancer, blindness and ischemic diseases. In adult life, blood vessels are generally quiescent so angiogenesis is an important target for novel drug development to try and regulate new vessel formation specifically in disease. In order to better understand angiogenesis and to develop appropriate strategies to regulate it, models are required that accurately reflect the different biological steps that are involved. The mouse neonatal retina provides an excellent model of angiogenesis because arteries, veins and capillaries develop to form a vascular plexus during the first week after birth. This model also has the advantage of having a two-dimensional (2D) structure making analysis straightforward compared with the complex 3D anatomy of other vascular networks. By analyzing the retinal vascular plexus at different times after birth, it is possible to observe the various stages of angiogenesis under the microscope. This article demonstrates a straightforward procedure for analyzing the vasculature of a mouse retina using fluorescent staining with isolectin and vascular specific antibodies.

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

The neonatal murine retina provides a well characterized physiological model of angiogenesis, which permits investigations of the roles of different genes or drugs that modulate angiogenesis in an in vivo context. Immunofluorescent staining to accurately visualize the vascular plexus is pivotal to the success of these types of studies.

Todo el montaje de la tinción de inmunofluorescencia del Neonatal ratón Retina de investigar Angiogénesis<em&gt; En vivo</em

Angiogenesis  is the complex process of new blood vessel formation defined by the sprouting  of new blood vessels from a pre-existing vessel network. ...

Transsynaptic Tracing from Peripheral Targets with Pseudorabies Virus Followed by Cholera Toxin and Biotinylated Dextran Amines Double Labeling

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This approach has been most extensively used in the brain by utilizing the swine pathogen pseudorabies virus (PRV)1. PRV does not infect great apes, including humans, so it is most commonly used in studies on small mammals, especially rodents. The pseudorabies strain PRV152 expresses the enhanced green fluorescent protein (eGFP) reporter gene and only crosses functional synapses retrogradely through the hierarchical sequence of synaptic connections away from the infection site2,3. Other PRV strains have distinct microbiological properties and may be transported in both directions (PRV-Becker and PRV-Kaplan)4,5&#160;.&#160;This protocol will deal exclusively with PRV152. By delivering the virus at a peripheral site, such as muscle, it is possible to limit the entry of the virus into the brain through a specific set of neurons. The resulting pattern of eGFP signal throughout the brain then resolves the neurons that are connected to the initially infected cells. As the distributed nature of transsynaptic tracing with pseudorabies virus makes interpreting specific connections within an identified network difficult, we present a sensitive and reliable method employing biotinylated dextran amines (BDA) and cholera toxin subunit b (CTb) for confirming the connections between cells identified using PRV152. Immunochemical detection of BDA and CTb with peroxidase and DAB (3, 3&#39;-diaminobenzidine) was chosen because they are effective at revealing cellular processes including distal dendrites6-11.

Transsynaptic tracing has become a powerful tool for analyzing central efferents regulating peripheral targets through multi-synaptic circuits. Here we present a protocol that exploits the transsynaptic pseudorabies virus to identify and localize a functional brain circuit, followed by classical tract tracing techniques to validate specific connections in the circuit between identified groups of neurons.

Transináptico Seguimiento de Metas periféricos con Pseudorrabia Virus Seguido de la toxina del cólera y Biotinylated dextrano Aminas doble etiquetado

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Aislamiento y cultivo de células endoteliales del cerebro anterior embrionarias

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow for an in-depth characterization to identify pathways involved in these events. Cerebellar granule neurons (CGNs) that are derived from the developing cerebellum are an ideal model system that allows for morphological analyses. Here, we describe a method of how to genetically manipulate CGNs and how to study axono- and dendritogenesis of individual neurons. With this method the effects of RNA interference, overexpression or small molecules can be compared to control neurons. In addition, the rodent cerebellar cortex is an easily accessible in vivo system owing to its predominant postnatal development. We also present an in vivo electroporation technique to genetically manipulate the developing cerebella and describe subsequent cerebellar analyses to assess neuronal morphology and migration.

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Neuronal morphogenesis and migration are crucial events underlying proper brain development. Here, we describe methods to genetically manipulate cultured cerebellar granule neurons and the developing cerebellum for the assessment of morphology and migratory characteristics of neurons.

La manipulación genética de las neuronas cerebelosa gránulo<em&gt; In Vitro</em&gt; Y<em&gt; En Vivo</em&gt; Estudiar Neuronal Morfología y Migración

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow ...

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this information to the brain. As such, determining how olfactory information is transferred to the brain, modifying both perception and behavior, merits investigation. Interestingly, there is emerging evidence that cellular transduction and transcriptional factors are involved in the diversification of olfactory receptor neuron. Here we provide a robust whole mount immunological labeling method to assay in vivo olfactory receptor neuron organization. Using this method, we identified all olfactory receptor neurons with anti-ELAV antibody, a known pan-neural marker and Or49a-mCD8::GFP, an olfactory receptor neuron specifically expressed in Nba neuron using anti-GFP antibody.

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Herein we describe the process of whole mount immunostaining of Drosophila antennae, which enables us to better understand the molecular mechanisms involved in the diversification of olfactory receptor neurons (ORN)s.

Todo el montaje de Immunolabeling olfativa del receptor de las neuronas en el<em&gt; Drosophila</em&gt; Antena

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

Imágenes en vivo de la mitosis en el desarrollo de la corteza de embriones de ratón

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the ...

Laser-guided Neuronal Tracing In Brain Explants

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake through electroporation in brain explants with targeted laser illumination and matching filter goggles during the procedure. The described technique of in vitro electroporation by itself yields relatively good visual control for targetting certain areas of the brain. By combining it with laser excitation of fluorescent genetic markers and their read-out through band-passing filter goggles, which can pick up the emissions of the genetically labeled cells/nuclei and the fluorescent tracing dye, a researcher can substantially increase the accuracy of injections by finding the area of interest and controlling for the dye-spread/uptake in the injection area much more efficiently. In addition, the laser illumination technique allows to study the functionality of a given neurocircuit by providing information about the type of neurons projecting to a certain area in cases where the GFP expression is linked to the type of transmitter expressed by a subpopulation of neurons.

We describe a technique to label neurons and their processes via anterograde or retrograde tracer injections into brain nuclei using an in vitro preparation. We modified an existing method of in vitro tracer electroporation by taking advantage of fluorescently labeled mouse mutants and basic optical equipment in order to increase labeling accuracy.

Neuronal Tracing en explantes cerebrales guiadas por láser

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake ...