We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

참고 : 윤리 문 : 동물 과목을 포함하는 절차는 함부르크 대학과 자를란 트 대학의 동물 복지위원회에 의해 승인되었다. 1. 준비 및 배아 조직의 고정 <ol><li> 배아를 해부하고, 동물을 희생하기 전에 조직의 후속 고정을위한 솔루션을 준비하는 데 필요한 모든 장비를 정렬합니다. 주의 : 항상 (pH 7.4까지 조정을 0.1 M 인산 완충 생리 식염수 (PBS)에 4 % PFA) 신선한 4 % 파라 포름 알데히드 (PFA) 용액을 제조 하였다. </li><li> 윤리적으로 승인 절차 시간이 초과 임신 여성 마우스를 안락사. </li><li> 플랫폼에 마우스를 전송합니다. 70 % 에탄올로 복부의 복부 측면을 적시고 복강을 노출 예리한 가위를 사용하여 수직 절개. </li><li> 배아 체인을 확인하고 신중하게 사용 무딘 집게를 잡아 당깁니다과 얼음처럼 차가운 PBS에 배치합니다. </li><li> 에서 개별 배아를 제거미세 가위와 집게를 사용하여 배아 체인. 배아 주위에 여분의 조직을 제거하고 얼음처럼 차가운 PBS로 씻어. </li><li> (PFA로 배아를 전송하기 전에) 작은 꼬리 생검을 가지고 성별 식별 및 추적 대립 유전자의 유전자형 PCR 용 꼬리 용해 버퍼에 품어. </li><li> 대부분의 측면에서 배아에서 시작 진탕 얼음 빙냉 4 % PFA를 포함하는 튜브에 각각 별도로 배아 옮긴다. </li><li> 일정한 진탕 E13.5의 연령이나 얼음에 1.5 시간 동안 젊은에서 배아를 만끽. 일정한 흔들림 얼음에 2.5 시간 동안 나이 E14.5 및 E15.5에서 배아를 만끽. </li><li> 배아 나이 E16.5 이상은, 목을 벨 및 PFA 용액에 머리를 담근 전에 외피를 제거합니다. E16.5 배아의 머리는 일정 흔들림 얼음에 4.5 시간 동안 담가 할 수 있습니다. </li><li> 적절한 고정 후, 얼음처럼 차가운 PBS와 배아를 세 번 씻는다. 그들이 가라 앉을 때까지 4 ° C에서 PBS 용액에 30 % 자당에 배아를 전송바닥에. </li></ol> 2. 동결 <ol><li> 냉동 프로세스를 시작하기 전에 필요한 모든 자료 정렬 : 극저온 금형, 극저온 장갑, 페더급 곤충학 집게, 마커 펜과 최적의 절단 온도 화합물을 OCT () </li><li> 영구 알콜 성 마커 극저온 금형 레이블 (조직, 날짜와 유전자형의 방향을 언급). 얼음 양동이에 짓 눌린 드라이 아이스 100 % 에탄올의 비자금을 준비합니다. 이소 펜탄을 포함하는 내부 유리 비커를 놓습니다. 이소 펜탄가 식을 때까지 10 분 동안 기다립니다. </li><li> 한편, 자당 용액으로부터 조직을 제거 실험실 물티슈를 사용하여 조직의 주위에 여분의 크로스를 닦아. 조직을 덮을 경우 OCT 미리 라벨링 크라이 금형에 조직을 전송. OCT에서 공기 방울을 피; 특히 조직의 주위에. </li><li> 조직의 손상을 방지하기 위해 페더급 곤충학의 집게를 사용하여 OCT에서 조직의 방향을. 극저온 몰 전송함으로써 시작 동결예비 냉각 욕에 펜탄 D. 제대로 고정되지 않으므로 OCT를에 이소 펜탄을 기울여야합니다. -80 ° C에서 알루미늄 호일과 가게에서 샘플을 감 쌉니다. </li></ol> 3. 냉동 절편 <ol><li> 저온 유지 장치를 사용하여 다섯 시리즈의 14 μm의 얇은 시리얼 섹션을 잘라 면역 (IF) 분석을 위해 SuperFrost® 플러스 유리 슬라이드에 수집합니다. 사용 할 때까지 -80 ° C에서 슬라이드를 저장합니다. </li></ol> Tyramide 신호 증폭 (TSA) 프로토콜을 사용하여 4. 추적기 시각화 <ol><li> 염색에 필요한 버퍼 및 시약을 준비합니다. 항상 갓 이용의 날에 트리스의 NaCl-트윈 (TNT) 버퍼를 준비합니다. <ol><li> 1 L.의 최종 부피까지 1 ml의 피펫을 사용하여 트윈 20의 500 μl를 추가 한 M 트리스 - 염산의 pH가 7.5, 5 M의 NaCl 30 ml의 DDH 2 O를 100 ml의를 사용하여 TNT 버퍼를 준비합니다. 천천히 트윈 20을 추가하고 모든 트윈 (20)에 있는지 확인하도록 여러 번 아래 피펫을 세척솔루션입니다. </li><li> 트리스 - 염화나트륨 블로킹 업 한 L.의 최종 부피의 pH 7.5, 5 M NaCl을 30 ml의 DDH 2 O 1 M 트리스 - 염산 100 ㎖를 사용하여 (TNB) 버퍼 것은 차단 시약 5g 추가 준비 (구비 천천히 버퍼에 조금씩 키트) 교반하면서. (이 30 ~ 60 분보다 오래 걸릴 안) 완전히 차단 시약을 용해 연속 교반하면서 55 ° C로 점차 솔루션을 가열. 균일 한 가열을 55 ℃에서 수조를 사용하여 달성했다. 이 솔루션은 우유를 나타납니다. 사용하기 전에 실온에 대한 해결책을 가져와. 장기간 저장을 위해 -20 ℃에서 분취 가기. </li><li> 분자 생물학 / HPLC 등급의 DMSO에 (키트와 함께 제공) 비오틴 tyramide 시약을 복원합니다. 이는 따라 키트 DMSO의 적당량 다를 수 사용된다. 4 ° C에서 원액을 저장합니다. 주 : 각 Cre 호텔 및 R26 대립 유전자 이형 동물 섹션은 회로 분석에 사용될 수있다. 사용의ections 음성 대조군을 각각 하나 Cre 호텔 또는 1 R26 대립 유전자를 운반하는 한배에서. 정확히 두 번 이형 동물의 슬라이드처럼 음성 대조군 슬라이드를 취급합니다. 또한, 이중 이형 동물로부터 하나의 제어를 포함하지만 슬라이드 TSA 시약 (비 증폭 제어) 뺀다. </li></ol></li><li> 날카로운 신선한 메스는 조직 섹션을 둘러싼 초과 OCT를 제거하고 PAP 펜으로 절 주위에 경계를 표시 사용. </li><li> 실온에서 2 ~ 3 분 (RT)에 대한 슬라이드를 건조시킵니다. 5 분마다 TNT와 RT 배에서 슬라이드를 씻으십시오. 내인성 퍼 옥시 다제 활성을 급냉 0.3 %에서 30 분 동안 빙냉 메탄올 중의 H 2 O 2 용액을 RT에서 슬라이드를 배양한다. </li><li> 5 분 PBS로 세척 배 RT 각. 조직 투과성으로 대한 PBS에서 0.5 % 트리톤 X-100에서 10 분 동안 품어. 5 분마다 TNT와 RT 배에서 슬라이드를 씻으십시오. </li><li> TNB와 블록 (30)에 대해 (슬라이드 당 200 ~ 300 μL 차단 솔루션)가습 실에서 실온에서 분. 모든 섹션이 완전히 TNB에 포함되어 있는지 확인합니다. 슬라이드 단계 사이에 건조시키지 마십시오. </li><li> 초과 차단 버퍼를 배출하고 추적 인식 차 항혈청 적용 RT 또는 밤새 4 ℃에서 2 시간 동안 TNB에 희석 (1 : GTT 15,000 토끼 방지 GFP : BL 1,000 염소 항 - WGA 1). 완전히 조직 절편 (슬라이드 당 200 ~ 300 μL)를 충당하기에 충분한 볼륨을 사용하십시오. 참고 : 여기에 추천 차 항혈청 희석 조정해야 할 수 있습니다. </li><li> 5 분 교반 각각 TNT와 RT 배에서 슬라이드를 씻으십시오. </li><li> (: 반 WGA 500 말 방지 염소 IgG를, 1 : 실온에서 1 시간 동안 TNB에 방지 GFP 5,000 염소 항 - 토끼 IgG의 1) 첫 번째 항혈청의 호스트를 인식 바이오틴 차 항혈청과 섹션을 품어. </li><li> 5 분 교반 각각 실온에서 TNT 씻을 배. 100 스트렙 타비 딘 (SA) 컨쥬 게이트 고추 냉이 퍼 옥시 다제 (SA-HRP 제공 위스콘신 : 1을 품어가습 챔버 내에서 30 분 동안 실온에서 TNB의 키트) 토륨. 5 분마다 TNT와 RT 배에서 슬라이드를 씻으십시오. 한편 TSA를 해동. </li><li> (키트와 함께 제공, BL의 시각화 및 GTT에 대한 TSA + 키트 TSA 키트를 사용) TSA 증폭 희석제에 TSA 1:50 희석. RT에서 정확하게 10 분 동안 희석 TSA의 조직 섹션을 품어. 미래 실험 나머지 희석 TSA 시약을 사용하지 않는 이상적 이전 세정 단계 동안, 사용 직전에 희석 TSA; 항상 신선한 준비합니다. </li><li> 5 분 교반 각각 TNT와 RT 배에서 슬라이드를 씻으십시오. 실온에서 30 분 동안 TNB 500 알렉사 Fluor® 546 스트렙 타비 딘 복합체 : 1 품​​어. 5 분 교반 각각 TNT와 RT 배에서 슬라이드를 씻으십시오. </li><li> 핵 염색 RT에서 PBS에 5 % bisbenzimide 용액에서 10 분 동안 품어. 5 분 교반 각각 TNT와 RT 배에서 슬라이드를 씻으십시오. Fluromount G로 마운트하고 표면 형광 또는 공 초점 현미경을 수행합니다. <em&gt; 문제 해결 : 트레이서 전송의 효능 (사용 Cre 호텔 드라이버 라인으로 결정) 생산 세포에 ROSA26 궤적의 발현 량에 의존하고, 신경 회로 (트레이서, 수렴 등의 제조 뉴런의 예 번호)를 분석 할 것이다. 따라서 여기에 추천 차 항혈청 희석이 부족하거나 과도한 신호를 방지하기 위해 조정해야 할 수 있습니다. 배경은 항상 적절한 제어 슬라이드 (위 참조)를 사용하여 분석해야한다. </li></ol> 배아 섹션 5. τlacZ 염색 <ol><li> 염색에 필요한 버퍼 및 시약을 준비합니다. 항상 신선하게 사용하기 전에 LacZ를 버퍼 C를 준비합니다. <ol><li> 1 ㎖의 70 % 디메틸 포름 아미드 (DMF)에 X-gal을 40 g을 첨가하여, 5- 브로 모 -4- 클로로 -3- 인돌 릴 - β-D-갈 락토 (X-GAL) 스톡 용액 (40 ㎎ / ㎖)을 준비한다. 장기간 저장을 위해 -20 ℃에서 알루미늄 호일 및 저장소와 커버. </li><li> 준비 니트로 블루 테트라 졸리움 (NBT) 성1 ㎖의 70 % DMF에 NBT의 50g을 첨가하여 옥랑 수용액 (50 ㎎ / ㎖). 장기간 저장을 위해 -20 ℃에서 알루미늄 호일 및 저장소와 커버. </li><li> LacZ의 25 % 글루 타르 알데히드의 80 μL, 4 % 5 ㎖ PFA, 1 M의 20 μl를 이용하여의 MgCl 2, 500 mM의 EGTA 100 ㎕, 마지막에 1 M 인산 완충액 pH 7.4 ml의 DDH 2 O 닫 정착액 준비 10 ㎖의 부피. </li><li> LacZ를 500 mM의 EGTA 5 ㎖, 500 ml의 최종 부피 50 ㎖의 DDH 포스페이트 완충액 pH 7.4 중 1 M, 2 O, 1 M의 MgCl 2의 1 ml를 사용하여 버퍼 준비한다. </li><li> 1 ml의 1 M 중의 MgCl 2, 500 mM의 EGTA 5 ㎖, 5 ml의 1 % 소듐 데 옥시 콜레이트, 10 % NP-40을 100 ㎖, 50 일 M 인산염 완충액 pH 7.4 ml의 DDH 2 O를 사용 LacZ의 버퍼 B를 준비 500 ml의 최종 부피까지. </li><li> NBT 원액 10 μL와 LacZ를 버퍼 B. 1 ㎖에 X-여자 원액의 12.5 μL 사용 직전에 신선한 확인하고 알루미늄 호일로 커버를 추가하여 LacZ를 버퍼 C를 준비합니다. </li></OL&gt; </li><li> (한편 PAP 펜으로 슬라이드를 준비) 적어도 10 ~ 15 분 동안 실온에서 슬라이드를 건조시킵니다. </li><li> LacZ를 가진 부분은 화학 퓸 후드 안쪽 습윤 챔버에서 상온에서 2 분간 정착액 수정. PBS로 3 회 씻어 2 mM의의 MgCl 2 보충. </li><li> LacZ를 가진 슬라이드 RT에서 10 분마다 3 회 씻어 버퍼 LacZ를 버퍼 A.와 슬라이드를 헹군다. 5 분마다 LacZ를 버퍼 B와 과정을 2 회 반복한다. 가습 실에서 6 시간 또는 하룻​​밤 30 ~ 37 ° C에서 LacZ를 버퍼 C에서 슬라이드를 품어. 참고 : LacZ를 버퍼 C의 충분한 양을 추가; 슬라이드는 배양 중에 건조하지 않아야합니다. </li><li> 적절한 배양 후 PBS로 슬라이드를 2 mM의의 MgCl 2 보충 씻는다. 간단히 DDH 2 O.로 섹션을 씻어 메이어의 글리신 젤라틴 커버 슬립. 미분 간섭 대비 (DIC) 촬상 셋업 장착 광학 현미경에 적합. </li></ol> 6. Gend어 및 트레이서 유전자형 <ol><li> 1 M 트리스 - 염산의 pH가 8.5, 500 mM의 EGTA 100 ㎕를 1 ml에 사용 꼬리 용해 버퍼를 준비, 10 % SDS 200 μl의 5 M의 NaCl과 DDH 2 O의 400 μl를 10 ml의 최종 볼륨을 확인합니다. </li><li> 꼬리 생검을 포함하는 각 에펜 도르프 튜브에 꼬리 용해 버퍼 500 μl를 추가합니다. 100 mg / ml의 최종 농도로 단백질 분해 효소 K를 추가한다. 55 ° C에서 진탕 기에서 밤새 품어. </li><li> 실온에서 10 분 동안 17,000 XG에 원심 분리기 샘플. 새로운 원심 분리기 튜브에 뜨는을 전송합니다. 상층 액에 이소프로판올 500 μl를 추가합니다. 상하 반전 튜브하여 적어도 5 분 동안 혼합한다. </li><li> 실온에서 5 분 동안 17,000 XG에서 원심 분리기에 스핀. 상층 액을 붓고. 70 % 에탄올 200 μl를 추가합니다. 적어도 5 분 동안 흔들어. </li><li> 5 분 동안 17,000 XG에 원심 분리기. Pipetman (부어하지 않음)과 상층 액을 제거합니다. 15 ~ 30 분 동안 따뜻한 챔버 (37 ° C)에서 펠렛을 건조. </li><li> 100 μL에 재현 탁 펠릿와이드 보어 필터링 정보를 사용하여 낮은 TE 산도 8.0 또는 물. 적절한 용해 밤새 C 1 시간 동안 37 °에서 55 ° C에 넣습니다. 4 ℃에서 보관하십시오. </li><li> PCR 반응 (꼬리 DNA 1 μL, 각각의 프라이머의 2.5 μL DMSO 오후 10, 25 각각의 dNTP의 μM 및 1M 베타를 포함하는 50 ㎕의 반응 혼합물)에 대한 DNA 1 μl를 사용합니다. 유전자형과 성 식별을위한 PCR 프라이머는 재료 표에 나열되어 있습니다. </li></ol>

<ol>
	<li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals.">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li><li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+approaches+to+neural+circuits+in+the+mouse.">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li><li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+half+century+of+experimental+neuroanatomical+tracing.">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li><li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus.">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li><li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero.">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li><li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+approach+to+trace+neural+circuits.">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li><li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice.">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li><li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54.">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li><li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GPR54+gene+as+a+regulator+of+puberty.">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li><li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons.">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li><li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice.">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67 (2005).</li><li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene.">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li><li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-activated+site-specific+recombination+in+mice.">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li></ol>

No conflict of interest declared.

유 전적으로 정의 뉴런 집단의 신경 회로를 추적 트랜스 transsynaptic 트레이서로 표현하면 트레이서 neurotopic 바이러스 또는 정위 주사에 비해 몇 가지 장점을 가지고있다. 먼저, 추적기 내인성 단백질로서 생산하고, 따라서 임의의 면역 반응을 유도하지 않으며 선택적 신경 통로 재현성을 다른 동물에서 분석 될 수있다. 이 비 침습적 방법이기 때문에 둘째, 자궁 내, 예를 들어, 정위 주사 쉽?...

해부학 경로 추적은 뇌와 행동 한 관계를 해독하는데 가장 일반적으로 사용되는 도구 중 하나이다. 신경 회로 추적 기술의 발전은 마우스 2 유전자 확인 된 신경 세포 집단에서 신경 회로를 추적 할 수있는 기능 신경 과학자을 수여했다. 이러한 기술적 인 발전에도 불구하고 그것은 특히 배아 성숙 중에 신경 회로의 형성을 해명 도전 남아있다. 현재까지 개발 된 추적 방법 중 대부분 transsynaptic 트레이서 정위 주사 또는 신경성 유전자 변형 바이러스 (도 1) 2,3- 기반으로하기 때문이다. 이러한 기술은 연결 공간 및 시간 해상도, 이러한 현상 뇌, 주사 부위에서 대부분의 impor 주사 부위의 재현성, 잠재적으로 염증 기술적 도전 탐침 주사와 같은 몇몇의 본질적인 한계를 달성하면서신경성 바이러스로 인한 tantly 세포 독성은 4 개 사용을 제한한다. 다른 방법은 유전자 변형 생쥐에서 유전자와 transsynaptic 추적자을 표현하는 것입니다. 우리는 최근에이 기술을 수정 및 유전자 확인 된 신경 세포 인구 5의 신경 회로를 매핑하는 이진 유전 transsynaptic 추적 시스템을 개발했다. Cre 호텔 - 중재 후 우리의 실험 전략은 양방향 추적 보리 렉틴 (BL) 6 ROSA (26) 현장에서 GFP (GTT) (7)에 융합 역행 추적 파상풍 독소 조각 C를 표현하는 두 개의 새로운 녹아웃 마우스 균주를 기반으로 재조합. 여기에서 우리는 선택적으로 kisspeptin을 생산 신경 세포 BL과 GTT, 생식 축 8,9의 성숙을 조절에 관여하는 신경 펩타이드을 표현하는이 마우스 균주를 사용했다. 우리는이 기술 키스의 개발 및 성숙을 시각화하기에 적합 함을 입증여성 마우스의 뇌 (5)의 배아 개발하는 동안 peptin 신경 회로. 번식 전략 R26-BL-IRES-τlacZ (BIZ) 및 R26-GFP-TTC (GTT) 추적 선 노크 재조합 ROSA26 대립 유전자를 전달 계통 5이다. R26-BIZ 및 R26-GTT의 대립으로 인해 두에 loxP 사이트 (5)에 의해 측면 강한 전사 정지 신호의 존재에 전사적으로 침묵. BIZ과 GTT 유전자의 발현은 전사 정지 신호의 Cre 호텔 - 매개 제거에 의해 활성화된다. BIZ-R26 및 R26-GTT 대립 단순히 치운다 드라이버 라인과 교차하여 독립적으로 사용될 수있다. 각각의 Cre 호텔 및 R26 대립 유전자에 대한 분석 동물 이형을 사용할 수있다. 하나 또는 하나 Cre 호텔 R26 대립 유전자를 운반 한배 새끼는 각각 대조군으로 사용되어야한다. 대안 적으로, t를 생성 할 수도있다노크에 riple Cre 호텔, R26-BIZ 및 R26-GTT 대립 유전자를 운반하는 동물, 그러나 이것은 하나의 추가 크로스가 필요합니다.

<table border="0" cellpadding="0" cellspacing="0" width="721">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:219px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bisbenzimide (Hoechst 33258 dye)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">14530-100MG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">32205-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryo mold (Peel-a-way)</td>
			<td style="width:219px;">Polyscience Inc.</td>
			<td style="width:119px;">18646A-1</td>
			<td>22mm x 22mm x 20mm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DMSO</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D8418-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Dimethyl Formamide (DMF)</td>
			<td style="width:219px;">VWR Chemicals</td>
			<td style="width:119px;">23470,293</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EGTA</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3054.3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fluoromount G</td>
			<td style="width:219px;">Southern Biotech</td>
			<td style="width:119px;">0100-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glutaraldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">G5882-50ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hydrogen peroxide</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">34988-7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Isopentane (Methyl 2-butane)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">M32631-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kaiser&#39;s Glycine gelatin</td>
			<td style="width:219px;">Merck</td>
			<td style="width:119px;">1092420100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Methanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">494437-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">MgCl2</td>
			<td style="width:219px;">Sigma</td>
			<td>M2670-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NaCl</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">HN00.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NBT</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">298-83-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Nonidet P40 substitute</td>
			<td style="width:219px;">Fluka</td>
			<td style="width:119px;">743.85</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">OCT</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">14020108926</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PAP pen</td>
			<td style="width:219px;">Dako</td>
			<td style="width:119px;">S2002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Parafarmaldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">P6148-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium deoxycholate</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D6750-25G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sucrose</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">S7903-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Superfrost slides</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">FT4981GLPLUS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL700</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA plus kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL749A001KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">AE15.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Triton-X 100</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3051.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tween 20</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">9127.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">X-gal</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">2315.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryostat</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">na</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Light microscope equipped with DIC imaging&#160;</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Fluroscence microscope</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Photoshop</td>
			<td style="width:219px;">Adobe</td>
			<td style="width:119px;">PS6</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Goat anti-WGA (recognizes BL)</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">AS-2024</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylayted horse anti-goat IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-9500&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated goat anti-rabbit IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-1000&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Rabbit anti-GFP (recognizes GTT)</td>
			<td style="width:219px;">Invitrogen</td>
			<td style="width:119px;">A11122</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rabbit anti-GnRH</td>
			<td style="width:219px;">Affinity Bio Reagent</td>
			<td style="width:119px;">PA1-121</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dylight488-donkey anti-rabbit IgG</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">SA5-10038</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SA-Alexa Fluor 546</td>
			<td style="width:219px;">Life Technologies</td>
			<td>S-11225</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Primers</td>
			<td style="width:219px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Fwd (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;ATGAAGATGATGAGCACCAG 
			GGC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Rev&#160; (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;AGCCCTCGCCGCAGAACTC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Fwd&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCGATGCAACGAGTGATGAG 
			GTTCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Rev&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCAGGCTAAGTGCCTTCTCTAC 
			ACCTGC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Fwd&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">AGCAAGGGCGAGGAGCTGTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Rev&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCTTGTAGTTGCCGTCGTCCT 
			TGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Fwd (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">TGAAGCTTTTGGCTTTGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Rev&#160; (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCGCTGCCAAATTCTTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ROSA26 Fwd</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">ROSA26 Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">GCAGATGGAGCGGGAGAAAT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">SA Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
	</tbody>
</table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

이 섹션에서는 R26-BIZ (B L- I RES-τlac의 Z)과 R26-GTT (G FP-TT C) 대립 유전자와 협력을 얻을 수있다 대표적인 결과를 보여줍니다. 여기에서 우리는 생식 축 조절 신경 회로의 성숙을 분석 R26-BIZ 및 R26-GTT 대립 유전자를 사용합니다. 척추 동물의 복제를 중앙에서 성선 자극 호르몬 방출 호르몬 (GnRH에)을 분비하는 시상 하부의 신경 세포의 작은 부분 집합에 의해 제어된?...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

배아 마우스의 뇌에 추적 조건부 유전 Transsynaptic

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.6K 조회수.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

비디오: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Manual Drainage of the Zebrafish Embryonic Brain Ventricles

Cerebrospinal fluid (CSF) is a protein rich fluid contained within the brain ventricles. It is present during early vertebrate embryonic development and persists throughout life. Adult CSF is thought to cushion the brain, remove waste, and carry secreted molecules1,2. In the adult and older embryo, the majority of CSF is made by the choroid plexus, a series of highly vascularized secretory regions located adjacent to the brain ventricles3-5. In zebrafish, the choroid plexus is fully formed at 144 hours post fertilization (hpf)6. Prior to this, in both zebrafish and other vertebrate embryos including mouse, a significant amount of embryonic CSF (eCSF) is present . These data and studies in chick suggest that the neuroepithelium is secretory early in development and may be the major source of eCSF prior to choroid plexus development7.
eCSF contains about three times more protein than adult CSF, suggesting that it may have an important role during development8,9. Studies in chick and mouse demonstrate that secreted factors in the eCSF, fluid pressure, or a combination of these, are important for neurogenesis, gene expression, cell proliferation, and cell survival in the neuroepithelium10-20. Proteomic analyses of human, rat, mouse, and chick eCSF have identified many proteins that may be necessary for CSF function. These include extracellular matrix components, apolipoproteins, osmotic pressure regulating proteins, and proteins involved in cell death and proliferation21-24. However, the complex functions of the eCSF are largely unknown.
We have developed a method for removing eCSF from zebrafish brain ventricles, thus allowing for identification of eCSF components and for analysis of the eCSF requirement during development. Although more eCSF can be collected from other vertebrate systems with larger embryos, eCSF can be collected from the earliest stages of zebrafish development, and under genetic or environmental conditions that lead to abnormal brain ventricle volume or morphology. Removal and collection of eCSF allows for mass spectrometric analysis, investigation of eCSF function, and reintroduction of select factors into the ventricles to assay their function. Thus the accessibility of the early zebrafish embryo allows for detailed analysis of eCSF function during development.

We present a method to collect cerebrospinal fluid (CSF) and to create a system which lacks CSF within the embryonic zebrafish brain ventricular system. This allows for further examination of CSF composition and its requirement during embryonic brain development.

Zebrafish 배아 뇌 심실의 수동 배수

Cerebrospinal fluid  (CSF) is a protein rich fluid contained within the brain ventricles. It is  present during early vertebrate embryonic development and ...

연구

신경과학

Selective Tracing of Auditory Fibers in the Avian Embryonic Vestibulocochlear Nerve

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling of auditory axons within the VIIIth cranial nerve would enhance the study of central auditory circuit development. This approach is challenging because multiple sensory organs of the inner ear contribute to the VIIIth nerve 1. Moreover, markers that reliably distinguish auditory versus vestibular groups of axons within the avian VIIIth nerve have yet to be identified. Auditory and vestibular pathways cannot be distinguished functionally in early embryos, as sensory-evoked responses are not present before the circuits are formed. Centrally projecting VIIIth nerve axons have been traced in some studies, but auditory axon labeling was accompanied by labeling from other VIIIth nerve components 2,3. Here, we describe a method for anterograde tracing from the acoustic ganglion to selectively label auditory axons within the developing VIIIth nerve. First, after partial dissection of the anterior cephalic region of an 8-day chick embryo immersed in oxygenated artificial cerebrospinal fluid, the cochlear duct is identified by anatomical landmarks. Next, a fine pulled glass micropipette is positioned to inject a small amount of rhodamine dextran amine into the duct and adjacent deep region where the acoustic ganglion cells are located. Within thirty minutes following the injection, auditory axons are traced centrally into the hindbrain and can later be visualized following histologic preparation. This method provides a useful tool for developmental studies of peripheral to central auditory circuit formation.

Here we describe a microdissection technique followed by fluorescent dye injection into the acoustic ganglion of early chick embryos for selective tracing of auditory axon fibers in the nerve and hindbrain.

조류 배아 Vestibulocochlear 신경 청각 섬유의 선택적 추적

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling ...

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

마우스 척추 조건부 유전자 조작을위한 바이러스 성 벡터의 Stereotaxic 주입

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

Angiogenesis is the complex process of new blood vessel formation defined by the sprouting of new blood vessels from a pre-existing vessel network. Angiogenesis plays a key role not only in normal development of organs and tissues, but also in many diseases in which blood vessel formation is dysregulated, such as cancer, blindness and ischemic diseases. In adult life, blood vessels are generally quiescent so angiogenesis is an important target for novel drug development to try and regulate new vessel formation specifically in disease. In order to better understand angiogenesis and to develop appropriate strategies to regulate it, models are required that accurately reflect the different biological steps that are involved. The mouse neonatal retina provides an excellent model of angiogenesis because arteries, veins and capillaries develop to form a vascular plexus during the first week after birth. This model also has the advantage of having a two-dimensional (2D) structure making analysis straightforward compared with the complex 3D anatomy of other vascular networks. By analyzing the retinal vascular plexus at different times after birth, it is possible to observe the various stages of angiogenesis under the microscope. This article demonstrates a straightforward procedure for analyzing the vasculature of a mouse retina using fluorescent staining with isolectin and vascular specific antibodies.

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

The neonatal murine retina provides a well characterized physiological model of angiogenesis, which permits investigations of the roles of different genes or drugs that modulate angiogenesis in an in vivo context. Immunofluorescent staining to accurately visualize the vascular plexus is pivotal to the success of these types of studies.

혈관을 조사하기 위해 신생아 마우스 망막의 전체 마운트 면역 형광 염색<em&gt; 생체 내</em

Angiogenesis  is the complex process of new blood vessel formation defined by the sprouting  of new blood vessels from a pre-existing vessel network. ...

Transsynaptic Tracing from Peripheral Targets with Pseudorabies Virus Followed by Cholera Toxin and Biotinylated Dextran Amines Double Labeling

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This approach has been most extensively used in the brain by utilizing the swine pathogen pseudorabies virus (PRV)1. PRV does not infect great apes, including humans, so it is most commonly used in studies on small mammals, especially rodents. The pseudorabies strain PRV152 expresses the enhanced green fluorescent protein (eGFP) reporter gene and only crosses functional synapses retrogradely through the hierarchical sequence of synaptic connections away from the infection site2,3. Other PRV strains have distinct microbiological properties and may be transported in both directions (PRV-Becker and PRV-Kaplan)4,5&#160;.&#160;This protocol will deal exclusively with PRV152. By delivering the virus at a peripheral site, such as muscle, it is possible to limit the entry of the virus into the brain through a specific set of neurons. The resulting pattern of eGFP signal throughout the brain then resolves the neurons that are connected to the initially infected cells. As the distributed nature of transsynaptic tracing with pseudorabies virus makes interpreting specific connections within an identified network difficult, we present a sensitive and reliable method employing biotinylated dextran amines (BDA) and cholera toxin subunit b (CTb) for confirming the connections between cells identified using PRV152. Immunochemical detection of BDA and CTb with peroxidase and DAB (3, 3&#39;-diaminobenzidine) was chosen because they are effective at revealing cellular processes including distal dendrites6-11.

Transsynaptic tracing has become a powerful tool for analyzing central efferents regulating peripheral targets through multi-synaptic circuits. Here we present a protocol that exploits the transsynaptic pseudorabies virus to identify and localize a functional brain circuit, followed by classical tract tracing techniques to validate specific connections in the circuit between identified groups of neurons.

Transsynaptic는 콜레라 독소와 바이오틴 덱스 트란 아민 두 번 라벨로 이어 (僞) 바이러스에 주변 대상에서 추적

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

배아 전뇌에서 내피 세포의 분리 및 문화

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow for an in-depth characterization to identify pathways involved in these events. Cerebellar granule neurons (CGNs) that are derived from the developing cerebellum are an ideal model system that allows for morphological analyses. Here, we describe a method of how to genetically manipulate CGNs and how to study axono- and dendritogenesis of individual neurons. With this method the effects of RNA interference, overexpression or small molecules can be compared to control neurons. In addition, the rodent cerebellar cortex is an easily accessible in vivo system owing to its predominant postnatal development. We also present an in vivo electroporation technique to genetically manipulate the developing cerebella and describe subsequent cerebellar analyses to assess neuronal morphology and migration.

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Neuronal morphogenesis and migration are crucial events underlying proper brain development. Here, we describe methods to genetically manipulate cultured cerebellar granule neurons and the developing cerebellum for the assessment of morphology and migratory characteristics of neurons.

소뇌 과립 신경 세포의 유전자 조작<em&gt; 체외</em&gt;와<em&gt; 생체</em&gt; 신경 세포의 형태와 마이그레이션을 연구하는

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow ...

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this information to the brain. As such, determining how olfactory information is transferred to the brain, modifying both perception and behavior, merits investigation. Interestingly, there is emerging evidence that cellular transduction and transcriptional factors are involved in the diversification of olfactory receptor neuron. Here we provide a robust whole mount immunological labeling method to assay in vivo olfactory receptor neuron organization. Using this method, we identified all olfactory receptor neurons with anti-ELAV antibody, a known pan-neural marker and Or49a-mCD8::GFP, an olfactory receptor neuron specifically expressed in Nba neuron using anti-GFP antibody.

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Herein we describe the process of whole mount immunostaining of Drosophila antennae, which enables us to better understand the molecular mechanisms involved in the diversification of olfactory receptor neurons (ORN)s.

에있는 후각 수용체 뉴런의 전체 마운트 Immunolabeling<em&gt; 초파리</em&gt; 안테나

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

개발 마우스 배아의 피질 유사 분열의 라이브 영상

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the ...

Laser-guided Neuronal Tracing In Brain Explants

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake through electroporation in brain explants with targeted laser illumination and matching filter goggles during the procedure. The described technique of in vitro electroporation by itself yields relatively good visual control for targetting certain areas of the brain. By combining it with laser excitation of fluorescent genetic markers and their read-out through band-passing filter goggles, which can pick up the emissions of the genetically labeled cells/nuclei and the fluorescent tracing dye, a researcher can substantially increase the accuracy of injections by finding the area of interest and controlling for the dye-spread/uptake in the injection area much more efficiently. In addition, the laser illumination technique allows to study the functionality of a given neurocircuit by providing information about the type of neurons projecting to a certain area in cases where the GFP expression is linked to the type of transmitter expressed by a subpopulation of neurons.

We describe a technique to label neurons and their processes via anterograde or retrograde tracer injections into brain nuclei using an in vitro preparation. We modified an existing method of in vitro tracer electroporation by taking advantage of fluorescently labeled mouse mutants and basic optical equipment in order to increase labeling accuracy.

레이저 유도 신경 세포의 추적에서 뇌 외식

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake ...