We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

NOTE: Ethics Statement: Procedures involving animal subjects were approved by the animal welfare committee of the University of Hamburg and the University of Saarland.
1. Preparation and Fixation of Embryonic Tissue
<ol>
	<li>Arrange all the equipment needed to dissect out the embryos and prepare solutions for subsequent fixation of the tissue before sacrificing the animals. 
	NOTE: Always prepare a fresh 4% paraformaldehyde (PFA) solution (4% PFA in 0.1 M phosphate buffered saline (PBS), adjust pH to 7.4).</li>
	<li>Euthanize timed pregnant female mouse with an ethically approved procedure.</li>
	<li>Transfer the mouse onto a platform. Wet the ventral side of the abdomen with 70% ethanol and make a vertical incision using sharp scissors to expose the abdominal cavity.</li>
	<li>Identify the embryonic chain and pull it out carefully using blunt forceps and place it into ice-cold PBS.</li>
	<li>Remove the individual embryos from the embryonic chain using fine scissors and forceps. Remove extra tissue around the embryos and wash them in ice-cold PBS.</li>
	<li>Take a small tail biopsy (before transferring the embryo into PFA) and incubate it in tail lysis buffer for the gender identification and tracer allele genotyping PCR.</li>
	<li>Start from the embryo at the most lateral side and transfer each embryo separately into a tube containing ice-cold 4% PFA on ice on a shaker.</li>
	<li>Soak the embryos at the age of E13.5 or younger for 1.5 hr on ice with constant shaking. Soak the embryos at age E14.5 and E15.5 for 2.5 hr on ice with constant shaking.</li>
	<li>For embryos age E16.5 or older, decapitate and remove the outer skin before soaking the head in PFA solution. Heads of E16.5 embryos can be soaked for 4.5 hr on ice with constant shaking.</li>
	<li>After appropriate fixation, wash the embryos three times with ice-cold PBS. Transfer the embryos into 30% sucrose in PBS solution at 4 &#176;C until they sink to the bottom.</li>
</ol>
2. Freezing
<ol>
	<li>Arrange all the materials required before starting the freezing process: cryo-mold, cryo-gloves, featherweight entomology forceps, marker pen and optimal cutting temperature compound (O.C.T.)</li>
	<li>Label the cryo-mold with a permanent alcohol-resistant marker (mention the orientation of tissue, date and genotype). Prepare a slush of crushed dry ice and 100% ethanol in an ice bucket. Place a glass beaker inside containing isopentane. Wait for 10 min for the isopentane to cool down.</li>
	<li>Meanwhile remove the tissue from the sucrose solution, wipe off excess sucrose around the tissue using laboratory wipes. Transfer the tissue into a pre-labeled cryo-mold with sufficient O.C.T. to cover the tissue. Avoid any air bubbles in the O.C.T.; especially around the tissue.</li>
	<li>Orient the tissue in O.C.T. using featherweight entomology forceps to avoid tissue damage. Start freezing by transferring the cryo-mold into the pre-cooled isopentane bath. Do not splash isopentane into the O.C.T. as it will not freeze properly. Wrap the samples in aluminum foil and store at -80 &#176;C.</li>
</ol>
3. Cryosectioning
<ol>
	<li>Cut 14 &#181;m thin serial sections in series&#8217; of five using a cryostat and collect on SuperFrost&#174; Plus glass slides for immunofluorescence (IF) analysis. Store the slides at -80 &#176;C until utilized.</li>
</ol>
4. Tracer visualization Using the Tyramide Signal Amplification (TSA) Protocol
<ol>
	<li>Prepare the buffers and reagents required for staining. Always freshly prepare the Tris-NaCl-Tween (TNT) buffer on the day of use.
	<ol>
		<li>Prepare TNT buffer using 100 ml of 1 M Tris-HCl pH 7.5, 30 ml of 5 M NaCl and ddH2O up to a final volume of 1 L. Add 500 &#181;l of Tween 20 using a 1 ml pipette. Add the Tween 20 slowly and flush the pipette up and down several times to ensure that all Tween 20 is in solution.</li>
		<li>Prepare Tris-NaCl-Blocking (TNB) buffer using 100 ml of 1 M Tris-HCl pH 7.5, 30 ml of 5 M NaCl and ddH2O up to a final volume of 1 L. Add 5 g Blocking Reagent (provided with the kit) slowly in small increments to the buffer while stirring. Heat the solution gradually to 55 &#176;C with continuous stirring to completely dissolve the Blocking Reagent (this should not take longer than 30-60 min). To achieve homogenous heating use a water bath at 55 &#176;C. The solution will appear milky. Bring the solution to room temperature before using. Aliquot and store at -20 &#176;C for long-term storage.</li>
		<li>Reconstitute biotin tyramide reagent (provided with the kit) in Molecular Biology/HPLC-grade DMSO. Depending upon which kit is used the appropriate amount of DMSO may vary. Store the stock solution at 4 &#176;C. 
		NOTE: Sections from animals heterozygous for the respective Cre and R26 alleles can be used for circuit analysis. Use sections from littermates carrying one Cre or one R26 allele, respectively, as negative controls. Treat negative control slides exactly like slides from double heterozygous animals. In addition, include one control slide from a double heterozygous animal but leave out the TSA reagent (unamplified control).</li>
	</ol>
	</li>
	<li>Using a sharp fresh scalpel remove excess O.C.T. surrounding the tissue sections and mark the boundary around the sections with a PAP pen.</li>
	<li>Dry the slides for 2-3 min at room temperature (RT). Wash the slides at RT 3x with TNT for 5 min each. Incubate the slides at RT for 30 min in 0.3% H2O2 solution in ice-cold methanol to quench endogenous peroxidase activity.</li>
	<li>Wash 3x with PBS for 5 min each at RT. Incubate for 10 min in 0.5% Triton-X 100 in PBS for tissue permeabilization. Wash the slides at RT 3x with TNT for 5 min each.</li>
	<li>Block with TNB (blocking solution, 200-300 &#181;l per slide) for 30 min at RT in a humidified chamber. Make sure all the sections are completely covered by TNB. Do not let the slides dry out in between the steps.</li>
	<li>Drain off excess blocking buffer and apply the primary antiserum recognizing the tracer (1:1,000 goat anti-WGA for BL, 1:15,000 rabbit anti-GFP for GTT) diluted in TNB for 2 hr at RT or overnight at 4 &#176;C. Make sure to use enough volume to completely cover the tissue section (200-300 &#181;l per slide). 
	NOTE: The primary antisera dilutions recommended here may have to be adjusted.</li>
	<li>Wash the slides at RT 3x with TNT for 5 min each with agitation.</li>
	<li>Incubate the sections with biotinylated secondary antiserum recognizing the host of the first antiserum (1:500 horse anti-goat IgG for anti-WGA, 1:5,000 goat anti-rabbit IgG for anti-GFP in TNB for 1 hr at RT).</li>
	<li>Wash 3x with TNT at RT for 5 min each with agitation. Incubate in 1:100 streptavidin (SA)-conjugated horseradish peroxidase (SA-HRP, provided with the kit) in TNB for 30 min at RT in a humidified chamber. Wash the slides at RT 3x with TNT for 5 min each. Meanwhile thaw the TSA.</li>
	<li>Dilute TSA 1:50 in TSA amplification diluent (provided with the kit; use the TSA kit for the visualization of BL and the TSA+ kit for GTT). Incubate the tissue sections in diluted TSA for precisely 10 min at RT. Dilute TSA just before use, ideally during the previous washing step, do not use any remaining diluted TSA reagent for future experiments; always prepare fresh.</li>
	<li>Wash the slides at RT 3x with TNT for 5 min each with agitation. Incubate with 1:500 Alexa Fluor&#174; 546 streptavidin conjugate in TNB for 30 min at RT. Wash the slides at RT 3x with TNT for 5 min each with agitation.</li>
	<li>Incubate for 10 min in 5% bisbenzimide solution in PBS at RT for nuclear staining. Wash the slides at RT 3x with TNT for 5 min each with agitation. Mount with Fluromount G and perform epifluorescence or confocal microscopy. 
	Troubleshooting: Efficacy of tracer transfer will depend on the expression level of the ROSA26 locus in the producing cells (determined by the Cre driver line used) and on the neural circuit analyzed (e.g. number of neurons producing the tracer, convergence etc.). Therefore the primary antisera dilutions recommended here may have to be adjusted to prevent low or excess signal. Background should always be analyzed using appropriate control slides (see above).</li>
</ol>
5. &#964;lacZ Staining for Embryonic Sections
<ol>
	<li>Prepare the buffers and reagents required for staining. Always freshly prepare the LacZ buffer C before use.
	<ol>
		<li>Prepare 5-bromo-4-chloro-3-indolyl-&#946;-D-galactopyranoside (X-gal) stock solution (40 mg/ml) by adding 40 g of X-gal to 1 ml 70% dimethylformamide (DMF). Cover with aluminium foil and store at -20 &#176;C for long-term storage.</li>
		<li>Prepare nitro blue tetrazolium (NBT) stock solution (50 mg/ml) by adding 50 g of NBT to 1 ml 70% DMF. Cover with aluminium foil and store at -20 &#176;C for long-term storage.</li>
		<li>Prepare LacZ fixative using 80 &#181;l of 25% glutaraldehyde, 5 ml of 4% PFA, 20 &#181;l of 1 M MgCl2, 100 &#181;l of 500 mM EGTA, 1 ml of 1 M phosphate buffer pH 7.4 and ddH2O up to a final volume of 10 ml.</li>
		<li>Prepare LacZ buffer A using 1 ml of 1 M MgCl2, 5 ml of 500 mM EGTA, 50 ml of 1 M phosphate buffer pH 7.4 and ddH2O up to a final volume of 500 ml.</li>
		<li>Prepare LacZ buffer B using 1 ml of 1 M MgCl2, 5 ml of 500 mM EGTA, 5 ml of 1% sodium deoxycholate, 100 ml of 10% NP-40, 50 ml of 1 M phosphate buffer pH 7.4 and ddH2O up to a final volume of 500 ml.</li>
		<li>Prepare LacZ buffer C by adding 10 &#181;l of NBT stock solution and 12.5 &#181;l of X-gal stock solution to 1 ml of LacZ buffer B. Make fresh just before use and cover with aluminium foil.</li>
	</ol>
	</li>
	<li>Dry the slides at RT at least for 10-15 min (meanwhile prepare the slides with a PAP pen).</li>
	<li>Fix the section with LacZ fixative for 2 min at room temperature in a humidified chamber inside a chemical fume-hood. Wash 3 times with PBS supplemented with 2 mM MgCl2.</li>
	<li>Rinse the slides with LacZ buffer A. Wash the slides with LacZ buffer A 3 times for 10 min each at RT. Wash 2 times with LacZ buffer B for 5 min each. Incubate the slides in LacZ buffer C at 30-37 &#176;C for 6 hr or overnight in a humidified chamber. 
	NOTE: Add sufficient volume of LacZ buffer C; slides should not dry out during incubation.</li>
	<li>After appropriate incubation wash the slides with PBS supplemented with 2 mM MgCl2. Rinse sections briefly with ddH2O. Coverslip with Mayer&#8217;s glycine gelatin. Suitable for a light microscope equipped with a differential interference contrast (DIC) imaging set-up.</li>
</ol>
6. Gender and Tracer Genotyping
<ol>
	<li>Prepare tail lysis buffer using 1 ml of 1 M Tris-HCl pH 8.5, 100 &#181;l of 500 mM EGTA, 200 &#181;l of 10% SDS, 400 &#181;l of 5 M NaCl and ddH2O to make up a final volume of 10 ml.</li>
	<li>Add 500 &#181;l of tail lysis buffer to each Eppendorf tube containing a tail biopsy. Add proteinase K to a final concentration of 100 mg/ml. Incubate overnight on a shaker at 55 &#176;C.</li>
	<li>Centrifuge samples at 17,000 x g for 10 min at RT. Transfer the supernatant to a new centrifuge tube. Add 500 &#181;l of isopropanol to the supernatant. Mix for at least 5 min by inverting the tubes up and down.</li>
	<li>Spin in centrifuge at 17,000 x g for 5 min at RT. Pour off the supernatant. Add 200 &#181;l of 70% ethanol. Shake for at least 5 min.</li>
	<li>Centrifuge at 17,000 x g for 5 min. Remove supernatant with a Pipetman (do not pour off). Dry the pellet in a warm chamber (37 &#176;C) for 15-30 min.</li>
	<li>Resuspend pellet in 100 &#181;l of low TE pH 8.0 or water using wide-bore filtered tips. Put in 55 &#176;C for 1 hr and at 37 &#176;C overnight for proper dissolving. Store at 4 &#176;C.</li>
	<li>Use 1 &#181;l of DNA for PCR reaction (50 &#956;l reaction mixture containing 1 &#956;l of tail DNA, 2.5 &#956;l DMSO, 10 pM of each primer, 25 &#956;M of each dNTP, and 1M betaine). PCR primers for genotyping and gender identification are listed in the Materials table.</li>
</ol>

<ol>
	<li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals.">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li><li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+approaches+to+neural+circuits+in+the+mouse.">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li><li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+half+century+of+experimental+neuroanatomical+tracing.">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li><li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus.">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li><li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero.">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li><li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+approach+to+trace+neural+circuits.">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li><li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice.">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li><li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54.">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li><li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GPR54+gene+as+a+regulator+of+puberty.">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li><li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons.">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li><li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice.">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67 (2005).</li><li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene.">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li><li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-activated+site-specific+recombination+in+mice.">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li></ol>

No conflict of interest declared.

Expressing transsynaptic tracers as transgenes to trace the neural circuits of genetically defined neuronal populations has several advantages compared to the stereotaxic injection of tracers or neurotopic viruses. First, the tracer is produced as an endogenous protein and therefore does not elicit any immune response and a selective neural pathway can be analyzed in different animals with high reproducibility. Second, because this is a non-invasive method it can be utilized to trace the circuits from neurons not easily ...

Anatomical path tracing is one of the most commonly utilized tools to decipher the relationship between brain and behavior1. Advancement in neural circuit tracing technologies has bestowed neuroscientists with the ability to trace neural circuits from genetically identified neuron populations in mice2. In spite of these technical advancements it remains challenging to unravel the formation of neural circuits especially during embryonic maturation. This is because most of the tracing methods developed to date are based upon stereotaxic injection of transsynaptic tracers or genetically modified neurotropic viruses (Figure 1)2,3. While these techniques achieve spatial and temporal resolution of connectivity, several inherent limitations such as technically challenging tracer injections into the developing brain, the reproducibility of the site of injection, potential inflammation at the injection site and most importantly cytotoxicity caused by neurotropic viruses limit their use4.
An alternative method is to express the transsynaptic tracers as transgenes in genetically altered mice. We have recently modified this technique and developed a binary genetic transsynaptic tracing system to map the neural circuits of any genetically identified neuronal population5. Our experimental strategy is based on two new knock-in mouse strains, which express either the bidirectional tracer barley lectin (BL)6 or the retrograde tracer Tetanus Toxin fragment C fused to GFP (GTT)7 from the ROSA26 locus after Cre-mediated recombination. Here we used these mouse strains to selectively express BL and GTT in neurons that produce kisspeptin, a neuropeptide that is implicated in regulating the maturation of the reproductive axis8,9. We demonstrate that this technique is suitable to visualize the development and maturation of kisspeptin neural circuitry during embryonic development of the female mouse brain5.
Breeding strategy
The R26-BL-IRES-&#964;lacZ (BIZ) and the R26-GFP-TTC (GTT) tracer lines are knock-in strains5 that carry recombinant ROSA26 alleles. The R26-BIZ and the R26-GTT alleles are transcriptionally silent due to the presence of a strong transcriptional stop signal, which is flanked by two loxP sites5. Expression of the BIZ and GTT transgene is activated by Cre-mediated removal of the transcriptional stop signal. The R26-BIZ and R26-GTT alleles can be used independently by simply crossing with a Cre driver line. For analysis animals heterozygous for the respective Cre and R26 alleles can be used. Littermates carrying one Cre or one R26 allele, respectively, should be used as controls. Alternatively, it is also possible to generate triple knock-in animals carrying the Cre, R26-BIZ and R26-GTT alleles, however this will require one additional cross.

<table border="0" cellpadding="0" cellspacing="0" width="721">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:219px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bisbenzimide (Hoechst 33258 dye)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">14530-100MG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">32205-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryo mold (Peel-a-way)</td>
			<td style="width:219px;">Polyscience Inc.</td>
			<td style="width:119px;">18646A-1</td>
			<td>22mm x 22mm x 20mm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DMSO</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D8418-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Dimethyl Formamide (DMF)</td>
			<td style="width:219px;">VWR Chemicals</td>
			<td style="width:119px;">23470,293</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EGTA</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3054.3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fluoromount G</td>
			<td style="width:219px;">Southern Biotech</td>
			<td style="width:119px;">0100-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glutaraldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">G5882-50ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hydrogen peroxide</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">34988-7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Isopentane (Methyl 2-butane)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">M32631-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kaiser&#39;s Glycine gelatin</td>
			<td style="width:219px;">Merck</td>
			<td style="width:119px;">1092420100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Methanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">494437-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">MgCl2</td>
			<td style="width:219px;">Sigma</td>
			<td>M2670-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NaCl</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">HN00.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NBT</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">298-83-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Nonidet P40 substitute</td>
			<td style="width:219px;">Fluka</td>
			<td style="width:119px;">743.85</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">OCT</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">14020108926</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PAP pen</td>
			<td style="width:219px;">Dako</td>
			<td style="width:119px;">S2002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Parafarmaldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">P6148-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium deoxycholate</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D6750-25G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sucrose</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">S7903-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Superfrost slides</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">FT4981GLPLUS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL700</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA plus kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL749A001KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">AE15.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Triton-X 100</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3051.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tween 20</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">9127.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">X-gal</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">2315.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryostat</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">na</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Light microscope equipped with DIC imaging&#160;</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Fluroscence microscope</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Photoshop</td>
			<td style="width:219px;">Adobe</td>
			<td style="width:119px;">PS6</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Goat anti-WGA (recognizes BL)</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">AS-2024</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylayted horse anti-goat IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-9500&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated goat anti-rabbit IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-1000&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Rabbit anti-GFP (recognizes GTT)</td>
			<td style="width:219px;">Invitrogen</td>
			<td style="width:119px;">A11122</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rabbit anti-GnRH</td>
			<td style="width:219px;">Affinity Bio Reagent</td>
			<td style="width:119px;">PA1-121</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dylight488-donkey anti-rabbit IgG</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">SA5-10038</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SA-Alexa Fluor 546</td>
			<td style="width:219px;">Life Technologies</td>
			<td>S-11225</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Primers</td>
			<td style="width:219px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Fwd (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;ATGAAGATGATGAGCACCAG 
			GGC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Rev&#160; (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;AGCCCTCGCCGCAGAACTC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Fwd&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCGATGCAACGAGTGATGAG 
			GTTCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Rev&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCAGGCTAAGTGCCTTCTCTAC 
			ACCTGC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Fwd&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">AGCAAGGGCGAGGAGCTGTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Rev&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCTTGTAGTTGCCGTCGTCCT 
			TGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Fwd (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">TGAAGCTTTTGGCTTTGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Rev&#160; (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCGCTGCCAAATTCTTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ROSA26 Fwd</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">ROSA26 Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">GCAGATGGAGCGGGAGAAAT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">SA Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
	</tbody>
</table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

This section shows representative results that can be obtained working with the R26-BIZ (BL-IRES-&#964;lacZ) and the R26-GTT (GFP-TTC) alleles. Here we use the R26-BIZ and the R26-GTT alleles to analyze the maturation of the neural circuits regulating the reproductive axis. Reproduction in vertebrates is centrally controlled by a small subset of neurons in the hypothala...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.6K Views.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

Video: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Manual Drainage of the Zebrafish Embryonic Brain Ventricles

Cerebrospinal fluid (CSF) is a protein rich fluid contained within the brain ventricles. It is present during early vertebrate embryonic development and persists throughout life. Adult CSF is thought to cushion the brain, remove waste, and carry secreted molecules1,2. In the adult and older embryo, the majority of CSF is made by the choroid plexus, a series of highly vascularized secretory regions located adjacent to the brain ventricles3-5. In zebrafish, the choroid plexus is fully formed at 144 hours post fertilization (hpf)6. Prior to this, in both zebrafish and other vertebrate embryos including mouse, a significant amount of embryonic CSF (eCSF) is present . These data and studies in chick suggest that the neuroepithelium is secretory early in development and may be the major source of eCSF prior to choroid plexus development7.
eCSF contains about three times more protein than adult CSF, suggesting that it may have an important role during development8,9. Studies in chick and mouse demonstrate that secreted factors in the eCSF, fluid pressure, or a combination of these, are important for neurogenesis, gene expression, cell proliferation, and cell survival in the neuroepithelium10-20. Proteomic analyses of human, rat, mouse, and chick eCSF have identified many proteins that may be necessary for CSF function. These include extracellular matrix components, apolipoproteins, osmotic pressure regulating proteins, and proteins involved in cell death and proliferation21-24. However, the complex functions of the eCSF are largely unknown.
We have developed a method for removing eCSF from zebrafish brain ventricles, thus allowing for identification of eCSF components and for analysis of the eCSF requirement during development. Although more eCSF can be collected from other vertebrate systems with larger embryos, eCSF can be collected from the earliest stages of zebrafish development, and under genetic or environmental conditions that lead to abnormal brain ventricle volume or morphology. Removal and collection of eCSF allows for mass spectrometric analysis, investigation of eCSF function, and reintroduction of select factors into the ventricles to assay their function. Thus the accessibility of the early zebrafish embryo allows for detailed analysis of eCSF function during development.

We present a method to collect cerebrospinal fluid (CSF) and to create a system which lacks CSF within the embryonic zebrafish brain ventricular system. This allows for further examination of CSF composition and its requirement during embryonic brain development.

Cerebrospinal fluid  (CSF) is a protein rich fluid contained within the brain ventricles. It is  present during early vertebrate embryonic development and ...

Selective Tracing of Auditory Fibers in the Avian Embryonic Vestibulocochlear Nerve

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling of auditory axons within the VIIIth cranial nerve would enhance the study of central auditory circuit development. This approach is challenging because multiple sensory organs of the inner ear contribute to the VIIIth nerve 1. Moreover, markers that reliably distinguish auditory versus vestibular groups of axons within the avian VIIIth nerve have yet to be identified. Auditory and vestibular pathways cannot be distinguished functionally in early embryos, as sensory-evoked responses are not present before the circuits are formed. Centrally projecting VIIIth nerve axons have been traced in some studies, but auditory axon labeling was accompanied by labeling from other VIIIth nerve components 2,3. Here, we describe a method for anterograde tracing from the acoustic ganglion to selectively label auditory axons within the developing VIIIth nerve. First, after partial dissection of the anterior cephalic region of an 8-day chick embryo immersed in oxygenated artificial cerebrospinal fluid, the cochlear duct is identified by anatomical landmarks. Next, a fine pulled glass micropipette is positioned to inject a small amount of rhodamine dextran amine into the duct and adjacent deep region where the acoustic ganglion cells are located. Within thirty minutes following the injection, auditory axons are traced centrally into the hindbrain and can later be visualized following histologic preparation. This method provides a useful tool for developmental studies of peripheral to central auditory circuit formation.

Here we describe a microdissection technique followed by fluorescent dye injection into the acoustic ganglion of early chick embryos for selective tracing of auditory axon fibers in the nerve and hindbrain.

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling ...

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

Angiogenesis is the complex process of new blood vessel formation defined by the sprouting of new blood vessels from a pre-existing vessel network. Angiogenesis plays a key role not only in normal development of organs and tissues, but also in many diseases in which blood vessel formation is dysregulated, such as cancer, blindness and ischemic diseases. In adult life, blood vessels are generally quiescent so angiogenesis is an important target for novel drug development to try and regulate new vessel formation specifically in disease. In order to better understand angiogenesis and to develop appropriate strategies to regulate it, models are required that accurately reflect the different biological steps that are involved. The mouse neonatal retina provides an excellent model of angiogenesis because arteries, veins and capillaries develop to form a vascular plexus during the first week after birth. This model also has the advantage of having a two-dimensional (2D) structure making analysis straightforward compared with the complex 3D anatomy of other vascular networks. By analyzing the retinal vascular plexus at different times after birth, it is possible to observe the various stages of angiogenesis under the microscope. This article demonstrates a straightforward procedure for analyzing the vasculature of a mouse retina using fluorescent staining with isolectin and vascular specific antibodies.

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

The neonatal murine retina provides a well characterized physiological model of angiogenesis, which permits investigations of the roles of different genes or drugs that modulate angiogenesis in an in vivo context. Immunofluorescent staining to accurately visualize the vascular plexus is pivotal to the success of these types of studies.

Angiogenesis  is the complex process of new blood vessel formation defined by the sprouting  of new blood vessels from a pre-existing vessel network. ...

Transsynaptic Tracing from Peripheral Targets with Pseudorabies Virus Followed by Cholera Toxin and Biotinylated Dextran Amines Double Labeling

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This approach has been most extensively used in the brain by utilizing the swine pathogen pseudorabies virus (PRV)1. PRV does not infect great apes, including humans, so it is most commonly used in studies on small mammals, especially rodents. The pseudorabies strain PRV152 expresses the enhanced green fluorescent protein (eGFP) reporter gene and only crosses functional synapses retrogradely through the hierarchical sequence of synaptic connections away from the infection site2,3. Other PRV strains have distinct microbiological properties and may be transported in both directions (PRV-Becker and PRV-Kaplan)4,5&#160;.&#160;This protocol will deal exclusively with PRV152. By delivering the virus at a peripheral site, such as muscle, it is possible to limit the entry of the virus into the brain through a specific set of neurons. The resulting pattern of eGFP signal throughout the brain then resolves the neurons that are connected to the initially infected cells. As the distributed nature of transsynaptic tracing with pseudorabies virus makes interpreting specific connections within an identified network difficult, we present a sensitive and reliable method employing biotinylated dextran amines (BDA) and cholera toxin subunit b (CTb) for confirming the connections between cells identified using PRV152. Immunochemical detection of BDA and CTb with peroxidase and DAB (3, 3&#39;-diaminobenzidine) was chosen because they are effective at revealing cellular processes including distal dendrites6-11.

Transsynaptic tracing has become a powerful tool for analyzing central efferents regulating peripheral targets through multi-synaptic circuits. Here we present a protocol that exploits the transsynaptic pseudorabies virus to identify and localize a functional brain circuit, followed by classical tract tracing techniques to validate specific connections in the circuit between identified groups of neurons.

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow for an in-depth characterization to identify pathways involved in these events. Cerebellar granule neurons (CGNs) that are derived from the developing cerebellum are an ideal model system that allows for morphological analyses. Here, we describe a method of how to genetically manipulate CGNs and how to study axono- and dendritogenesis of individual neurons. With this method the effects of RNA interference, overexpression or small molecules can be compared to control neurons. In addition, the rodent cerebellar cortex is an easily accessible in vivo system owing to its predominant postnatal development. We also present an in vivo electroporation technique to genetically manipulate the developing cerebella and describe subsequent cerebellar analyses to assess neuronal morphology and migration.

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Neuronal morphogenesis and migration are crucial events underlying proper brain development. Here, we describe methods to genetically manipulate cultured cerebellar granule neurons and the developing cerebellum for the assessment of morphology and migratory characteristics of neurons.

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow ...

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this information to the brain. As such, determining how olfactory information is transferred to the brain, modifying both perception and behavior, merits investigation. Interestingly, there is emerging evidence that cellular transduction and transcriptional factors are involved in the diversification of olfactory receptor neuron. Here we provide a robust whole mount immunological labeling method to assay in vivo olfactory receptor neuron organization. Using this method, we identified all olfactory receptor neurons with anti-ELAV antibody, a known pan-neural marker and Or49a-mCD8::GFP, an olfactory receptor neuron specifically expressed in Nba neuron using anti-GFP antibody.

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Herein we describe the process of whole mount immunostaining of Drosophila antennae, which enables us to better understand the molecular mechanisms involved in the diversification of olfactory receptor neurons (ORN)s.

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the ...

Laser-guided Neuronal Tracing In Brain Explants

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake through electroporation in brain explants with targeted laser illumination and matching filter goggles during the procedure. The described technique of in vitro electroporation by itself yields relatively good visual control for targetting certain areas of the brain. By combining it with laser excitation of fluorescent genetic markers and their read-out through band-passing filter goggles, which can pick up the emissions of the genetically labeled cells/nuclei and the fluorescent tracing dye, a researcher can substantially increase the accuracy of injections by finding the area of interest and controlling for the dye-spread/uptake in the injection area much more efficiently. In addition, the laser illumination technique allows to study the functionality of a given neurocircuit by providing information about the type of neurons projecting to a certain area in cases where the GFP expression is linked to the type of transmitter expressed by a subpopulation of neurons.

We describe a technique to label neurons and their processes via anterograde or retrograde tracer injections into brain nuclei using an in vitro preparation. We modified an existing method of in vitro tracer electroporation by taking advantage of fluorescently labeled mouse mutants and basic optical equipment in order to increase labeling accuracy.

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake ...