Name: conditional genetic transsynaptic tracing in the embryonic mouse brain
Uploaded: 2014-12-22T14:00:00.000+00:00
Duration: 11 min 3 s
Description: Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

HINWEIS: Ethikerklärung: Verfahren unter Verwendung tierischer Probanden wurden von der Tierschutzkommission der Universität Hamburg und der Universität des Saarlandes genehmigt. 1. Vorbereitung und Fixierung von embryonalem Gewebe <ol><li> Vereinbaren Sie alle mussten sezieren die Embryonen und die Lösungen für die anschließende Fixierung des Gewebes vor dem Töten der Tiere Ausrüstung. HINWEIS: Immer eine frische 4% Paraformaldehyd (PFA) Lösung (4% PFA in 0,1 M phosphatgepufferter Kochsalzlösung (PBS), pH-Wert auf 7,4). </li><li> Euthanize zeitlich schwangere Frau Maus mit einer ethisch genehmigten Verfahren. </li><li> Übertragen Sie die Maus auf eine Plattform. Befeuchten Sie die Bauchseite des Bauches mit 70% Ethanol und einen vertikalen Schnitt mit scharfen Schere, um die Bauchhöhle aus. </li><li> Identifizieren Sie die embryonalen Kette und ziehen Sie sie vorsichtig mit stumpfen Pinzette und legen Sie sie in eiskaltem PBS. </li><li> Holen Sie die einzelnen Embryonen ausdie embryonalen Kette mit einer feinen Schere und Pinzette. Entfernen Sie die zusätzlichen Gewebe um die Embryonen und waschen Sie sie in eiskaltem PBS. </li><li> Nehmen Sie eine kleine Schwanzbiopsie (vor der Übertragung des Embryos in PFA) und Inkubation in Schwanz Lysepuffer für die Geschlechteridentifikation und Tracer-Allel Genotypisierung PCR. </li><li> Starten Sie aus dem Embryo am meisten lateralen Seite und übertragen jedes Embryo getrennt in ein Röhrchen mit eiskaltem 4% PFA auf Eis auf einem Schüttler. </li><li> Weichen Sie die Embryonen im Alter von E13.5 oder jünger 1,5 h auf Eis mit konstantem Schütteln. Weichen Sie die Embryonen im Alter von E14.5 und E15.5 2,5 h auf Eis mit konstantem Schütteln. </li><li> Für Embryonen Alter E16.5 oder älter, enthaupten und entfernen Sie die Außenhaut vor dem Eintauchen des Kopfes in PFA-Lösung. Leiter der E16.5 Embryonen 4,5 h auf Eis mit konstantem Schütteln eingeweicht werden. </li><li> Nach entsprechender Fixierung, waschen Sie die Embryonen dreimal mit eiskaltem PBS. Übertragen Sie die Embryonen in 30% Saccharose in PBS-Lösung bei 4 ° C, bis sie sinkennach unten. </li></ol> 2. Einfrieren <ol><li> Vereinbaren Sie alle vor dem Start des Gefrierprozesses benötigten Materialien: Kryo-Schimmel, Kryo-Handschuhe, Feder Entomologie Zangen, Textmarker und optimale Schnitttemperatur Verbindung (OCT) </li><li> Beschriften Sie die Kryo-Form mit einem permanenten alkoholbeständigen Marker (erwähnen Sie die Ausrichtung des Gewebes, das Datum und Genotyp). Bereiten Sie eine Matsch zerstoßenes Trockeneis und 100% Ethanol in einem Eiskübel. Stellen Sie ein Becherglas innen Isopentan enthält. Nach 10 min für die Isopentan abkühlen. </li><li> In der Zwischenzeit nehmen Sie die Gewebe aus dem Saccharoselösung, wischen Sie überschüssige Saccharose um das Gewebe mit Hilfe von Labortücher. Übertragen Sie das Gewebe in eine vorge beschriftet Kryo-Form mit ausreichend Oktober, um das Gewebe zu bedecken. Vermeiden Sie Luftblasen im Oktober; vor allem rund um das Gewebe. </li><li> Richten Sie das Gewebe in OCT mit Feder Entomologie Pinzette zu Gewebeschäden zu vermeiden. Starten Sie das Einfrieren durch die Übertragung der Kryo-mold in das vorgekühlte Isopentan Badewanne. Isopentan in den Oktober spritzen Sie nicht, da es nicht richtig einfrieren. Wickeln Sie die Proben in Aluminiumfolie und bei -80 ° C. </li></ol> 3. Kryoschneiden <ol><li> Cut 14 um dünne Schnittserien in Serie von fünf mit einem Kryostaten und sammeln auf SuperFrost® Plus-Glasobjektträger für Immunfluoreszenz (IF) Analyse. Bewahren Sie die Objektträger bei -80 ° C bis genutzt. </li></ol> 4. Tracer Visualisierung Mit dem Tyramid Signalverstärkung (TSA) Protokoll <ol><li> Bereiten Sie die Puffer und Reagenzien für die Färbung erforderlich. Immer frisch und die Tris-NaCl-Tween (TNT) Puffer vorzubereiten am Tag der Nutzung. <ol><li> Bereiten TNT Puffer unter Verwendung von 100 ml 1 M Tris-HCl pH 7,5, 30 ml 5 M NaCl und ddH 2 O bis zu einem Endvolumen von 1 l In 500 ul Tween 20 unter Verwendung einer 1 ml Pipette. Fügen Sie die Tween 20 langsam und spülen Sie die Pipette auf und ab mehrmals, um sicherzustellen, dass alle Tween 20 ist inLösung. </li><li> Bereiten Tris-NaCl-Blocking (TNB) Puffer mit 100 ml 1 M Tris-HCl, pH 7,5, 30 ml 5 M NaCl und ddH 2 O bis zu einem Gesamtvolumen von 1 l 5 g Blocking Reagenz (mit der vorgesehenen Kit) langsam in kleinen Schritten an den Puffer unter Rühren. Die Lösung wird langsam auf 55 ° C unter kontinuierlichem Rühren, um das Blockierungsmittel vollständig zu lösen (dies sollte nicht länger als 30-60 Minuten). Um dies zu erreichen homogene Erwärmung mit einem Wasserbad bei 55 ° C. Die Lösung wird milchig erscheinen. Bringen Sie die Lösung auf Raumtemperatur, bevor Sie. Aliquotieren und bei -20 ° C für die langfristige Lagerung. </li><li> Rekonstituieren Biotin Tyramid Reagenz (im Kit enthalten) in Molecular Biology / HPLC-Qualität DMSO. Je nachdem, welcher Kit verwendet die entsprechende Menge DMSO kann variieren. Bewahren Sie die Stammlösung bei 4 ° C. HINWEIS: Teile von Tieren, die heterozygot für die jeweiligen Cre und R26 Allele für die Schaltungsanalyse verwendet werden. Mit sReflexionen von Wurf Durchführung einer Cre oder ein Allel R26 jeweils als negative Kontrollen. Gönnen negativen Kontrollobjektträger genau wie Folien aus doppelt heterozygote Tiere. Darüber hinaus sind in einem Steuerschieber aus einem Doppel heterozygoten Tier, sondern lassen Sie das TSA-Reagenz (nicht verstärkte Kontrolle). </li></ol></li><li> Mit einem scharfen frische Skalpell entfernen überschüssiges Oktober die Gewebeschnitte Umgebung und markieren die Grenze um die Abschnitte mit einem PAP Stift. </li><li> Trocknen Sie die Objektträger für 2-3 Minuten bei Raumtemperatur (RT). Für jede 5 min Waschen Sie die Objektträger bei Raumtemperatur 3x mit TNT. Die Folien bei RT Inkubation 30 min in 0,3% H 2 O 2 -Lösung in eiskaltem Methanol, um endogene Peroxidase-Aktivität zu quenchen. </li><li> Jeweils 3x mit PBS für jeweils 5 min bei RT. Inkubieren für 10 min in 0,5% Triton-X-100 in PBS für Gewebe Permeabilisierung. Für jede 5 min Waschen Sie die Objektträger bei Raumtemperatur 3x mit TNT. </li><li> Block mit TNB (Blockierungslösung, 200 bis 300 &amp; mgr; l pro Folie) 30min bei RT in einer feuchten Kammer. Sicherstellen, dass alle Teile vollständig von TNB bedeckt. Lassen Sie die Objektträger trocknen in den Zwischenbereichen. </li><li> Abfließen überschüssiges Blockierungspuffers und Anwendung des primären Antiserum erkennt den Tracer (1: 1.000 Ziegen-Anti-WGA für BL, 1: 15.000 Kaninchen-Anti-GFP für GTT) in TNB für 2 h bei RT, verdünnt oder über Nacht bei 4 ° C. Achten Sie darauf, genug Volumen, um den Gewebeschnitt (200 bis 300 &amp; mgr; l pro Folie) vollständig bedecken. HINWEIS: Die primären Antiseren Verdünnungen hier empfohlen werden, können angepasst werden. </li><li> Jeweils unter Rühren 5 Minuten waschen Sie die Folien bei RT 3x mit TNT. </li><li> Inkubieren der Schnitte mit biotinylierten sekundären Antiserum erkennt den Host des ersten Antiserum (1: 500 Pferd-Anti-Ziegen-IgG Anti-WGA, 1: 5.000 Ziegen-Anti-Kaninchen-IgG-anti-GFP in TNB für 1 h bei RT). </li><li> Jeweils 3x mit TNT bei RT jeweils unter Rühren 5 min. Inkubation in 1: 100 Streptavidin (SA) konjugierte Meerrettichperoxidase (SA-HRP, sofern with das Kit) in TNB für 30 min bei RT in einer feuchten Kammer. Für jede 5 min Waschen Sie die Objektträger bei Raumtemperatur 3x mit TNT. Unterdessen tauen die TSA. </li><li> Verdünnen TSA 01.50 in TSA Verstärkung Verdünnungsmittel (im Kit enthalten, verwenden Sie das TSA-Kit für die Visualisierung von BL und der TSA + Kit für GTT). Die Gewebeschnitte in verdünnter TSA inkubieren genau 10 min bei RT. Verdünnen TSA kurz vor der Verwendung, im Idealfall während der vorhergehenden Waschschritt, verwenden Sie keine verbleibenden verdünnten TSA Reagenz für zukünftige Experimente; immer frisch zubereiten. </li><li> Jeweils unter Rühren 5 Minuten waschen Sie die Folien bei RT 3x mit TNT. Inkubieren mit 1: 500 Alexa Fluor ® 546-Streptavidin-Konjugat in TNB für 30 min bei RT. Jeweils unter Rühren 5 Minuten waschen Sie die Folien bei RT 3x mit TNT. </li><li> Inkubieren für 10 min in 5% Bisbenzimid-Lösung in PBS bei RT für die Kernfärbung. Jeweils unter Rühren 5 Minuten waschen Sie die Folien bei RT 3x mit TNT. Montieren Sie mit Fluromount G und führen Epifluoreszenz oder konfokalen Mikroskopie. <em&gt; Fehlerbehebung: Wirksamkeit von Tracer Übertragung auf dem Expressionsspiegel des ROSA26 Locus in den produzierenden Zellen (durch die Cre Treiberleitung verwendet wird, bestimmt) abhängen und von der neuronalen Schaltung analysiert (zB Anzahl der Neuronen Herstellung des Tracers Konvergenz etc.). Deshalb sind die primären Antiseren Verdünnungen hier empfohlenen müssen möglicherweise angepasst werden, um Unter- oder Übersignal zu verhindern. Hintergrund sollten immer mit geeigneten Kontrollobjektträger (siehe oben) untersucht werden. </li></ol> 5. τlacZ Färbung für Embryonale Bereiche <ol><li> Bereiten Sie die Puffer und Reagenzien für die Färbung erforderlich. Immer frisch bereiten die LacZ Puffer C vor dem Gebrauch. <ol><li> Bereiten 5-Brom-4-chlor-3-indolyl-β-D-galactopyranosid (X-gal) Stammlösung (40 mg / ml) durch Zugabe von 40 g X-gal zu 1 ml 70% Dimethylformamid (DMF). Mit Alufolie abdecken und bei -20 ° C für die langfristige Lagerung. </li><li> Bereiten Nitroblautetrazolium (NBT) stock-Lösung (50 mg / ml) durch Zugabe von 50 g NBT zu 1 ml 70% DMF. Mit Alufolie abdecken und bei -20 ° C für die langfristige Lagerung. </li><li> Bereiten LacZ Fixativ mit 80 ul 25% Glutaraldehyd, 5 ml einer 4% PFA, 20 ul 1 M MgCl 2, 100 &amp; mgr; l 500 mM EGTA, 1 ml 1 M Phosphatpuffer pH 7,4 und ddH 2 O bis zu einem letzten Volumen von 10 ml. </li><li> Bereiten LacZ Puffer A mit 1 ml von 1 M MgCl 2, 5 ml 500 mM EGTA, 50 ml 1 M Phosphatpuffer pH 7,4 und ddH 2 O bis zu einem Endvolumen von 500 ml. </li><li> Bereiten LacZ Puffer B unter Verwendung von 1 ml von 1 M MgCl 2, 5 ml 500 mM EGTA, 5 ml 1% Natriumdeoxycholat, 100 ml 10% NP-40, 50 ml 1 M Phosphatpuffer pH 7,4 und ddH 2 O bis zu einem Endvolumen von 500 ml. </li><li> Bereiten LacZ Puffer C durch Zugabe von 10 ul NBT-Stammlösung und 12,5 ul der X-gal-Stammlösung zu 1 ml LacZ Puffer B Stellen frisch kurz vor dem Gebrauch und mit Alufolie abdecken. </li></ol&gt; </li><li> Trocknen Sie die Objektträger bei Raumtemperatur mindestens 10-15 min (mittlerweile die Folien mit einem PAP Pen vorzubereiten). </li><li> Fixieren der Abschnitt mit LacZ Fixiermittel für 2 min bei Raumtemperatur in einer befeuchteten Kammer innerhalb einer chemischen Abzugshaube. Waschen 3x mit PBS, ergänzt mit 2 mM MgCl 2. </li><li> Spülen Sie die Folien mit LacZ Puffer A waschen die Dias mit LacZ Puffer A 3 mal für 10 Minuten jeweils bei RT. Für jede 5 min Waschen 2 mal mit LacZ Puffer B. Die Folien in LacZ Puffer C Inkubieren bei 30-37 ° C für 6 Stunden oder über Nacht in einer befeuchteten Kammer. HINWEIS: In ausreichendes Volumen an LacZ-Puffer C; Folien sollten nicht austrocknen während der Inkubation. </li><li> Nach entsprechender Inkubation die Objektträger mit PBS, ergänzt mit 2 mM MgCl 2. Kurz mit ddH 2 O spülen Abschnitte Deckglas mit Mayers Glycin Gelatine. Geeignet für ein Lichtmikroskop mit einem Differentialinterferenzkontrast (DIC) Bild Einrichtung ausgestattet. </li></ol> 6. Gender und Tracer-Genotypisierung <ol><li> Bereiten Schwanz Lysepuffer mit 1 ml 1 M Tris-HCl pH 8,5, 100 ul 500 mM EGTA, 200 ul 10% SDS, 400 &amp; mgr; l 5 M NaCl und ddH 2 O, um ein Endvolumen von 10 ml. </li><li> Fügen Sie 500 ul Lysepuffer Schwanz zu jedem Eppendorf-Röhrchen, die einen Schwanz Biopsie. Hinzufügen Proteinase K bis zu einer Endkonzentration von 100 mg / ml. Inkubieren über Nacht auf einem Schüttler bei 55 ° C. </li><li> Zentrifuge Proben bei 17.000 xg für 10 min bei RT. Den Überstand in ein neues Zentrifugenröhrchen. Gib 500 ul Isopropanol zu dem Überstand. Mischen Sie für mindestens 5 Minuten mit dem Umdrehen der Röhrchen auf und ab. </li><li> Spin in Zentrifuge bei 17.000 xg für 5 Minuten bei Raumtemperatur. Gießen Sie den Überstand. Nach Zugabe von 200 ul 70% Ethanol. Schütteln für mindestens 5 min. </li><li> Zentrifugieren bei 17.000 × g für 5 min. Überstand entfernen mit einem Pipetman (nicht gießen nicht aus). Trocknen des Pellets in einer warmen Kammer (37 ° C) für 15-30 min. </li><li> Pellet in 100 &amp; mgr;niedriger TE pH 8,0 oder Wasser mit weiter Bohrung Filterspitzen. In 55 ° C Setzen Sie für 1 Stunde und bei 37 ° C über Nacht für die richtige Lösung. Lagerung bei 4 ° C. </li><li> Verwenden 1 ul DNA für die PCR-Reaktion (50 &amp; mgr; l Reaktionsgemisch, enthaltend 1 ul Schwanz-DNA, 2,5 &amp; mgr; l DMSO, 10 pM jedes Primers, 25 &amp; mgr; M von jedem dNTP und 1 M Betain). PCR-Primer für die Genotypisierung und Geschlechtsidentität sind in der Tabelle aufgeführten Materialien. </li></ol>

<ol>
	<li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals.">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li><li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+approaches+to+neural+circuits+in+the+mouse.">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li><li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+half+century+of+experimental+neuroanatomical+tracing.">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li><li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus.">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li><li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero.">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li><li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+approach+to+trace+neural+circuits.">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li><li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice.">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li><li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54.">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li><li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GPR54+gene+as+a+regulator+of+puberty.">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li><li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons.">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li><li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice.">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67 (2005).</li><li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene.">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li><li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-activated+site-specific+recombination+in+mice.">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li></ol>

No conflict of interest declared.

Ausdruck transsynaptische Tracer als Transgene, die neuronale Schaltkreise genetisch definierten neuronalen Populationen verfolgen hat mehrere Vorteile gegenüber dem stereotaktische Injektion von Tracern oder neurotopic Viren. Zuerst wird der Tracer als endogenes Protein erzeugt und daher keine Immunantwort hervorzurufen und eine selektive neuralen Weg kann in verschiedenen Tieren, die mit hoher Reproduzierbarkeit zu analysieren. Zweitens, weil dies eine nicht-invasive Methode kann verwendet werden, um die Schaltungen ...

Anatomische Pfadverfolgung ist eine der am häufigsten verwendeten Werkzeuge, um die Beziehung zwischen Gehirn und Verhalten 1 entziffern. Fortschritt in neuronalen Schaltkreis Tracing Technologien hat Neurowissenschaftler mit der Fähigkeit, neuronale Schaltkreise genetisch identifiziert Neuronenpopulationen in Mäusen 2 Spuren verliehen. Trotz dieser technischen Fortschritt bleibt es schwierig, die Bildung von neuronalen Schaltkreisen vor allem während der embryonalen Reifung zu entwirren. Das ist, weil die meisten der bisher entwickelten Tracing-Verfahren basieren auf stereotaktische Injektion von transsynaptische Tracer oder gentechnisch veränderten neurotropen Viren (Abbildung 1) 2,3 basierend. Während diese Techniken zu erreichen räumliche und zeitliche Auflösung der Konnektivität, mehrere inhärente Beschränkungen wie technisch anspruchs Tracer Injektionen in das sich entwickelnde Gehirn, die Reproduzierbarkeit der Injektionsstelle, potenzielle Entzündung an der Injektionsstelle und wich-tantly Zytotoxizität von neurotropen Viren verursacht begrenzen ihre Verwendung 4. Eine alternative Methode ist es, die transsynaptische Tracer als Transgene in genetisch veränderten Mäusen exprimieren. Vor kurzem haben wir diese Technik modifiziert und eine binäre genetische transsynaptische Tracing-System, um die neuronalen Schaltkreise eines genetisch identifiziert neuronalen Population 5 Karte entwickelt. Unsere experimentellen Strategie basiert auf zwei neuen Knock-in Mausstämme, die entweder die bidirektionale Tracer Gerstenlektin (BL) 6 oder die retrograde Tracer-Tetanustoxin-Fragment C bis GFP (GTT) 7 von der ROSA 26 Ort verschmolzen Ausdruck basiert nach Cre-vermittelte Rekombination. Hier verwendeten wir diese Mäusestämme, selektiv auszudrücken BL und GTT in Neuronen, kisspeptin erzeugen, ein Neuropeptid, das bei der Regulierung der Reifung des reproduktiven Achse 8,9 gebracht wird. Wir zeigen, dass diese Technik geeignet ist, die Entwicklung und Reifung der Kuss visualisierenPeptin neuronalen Schaltkreise während der embryonalen Entwicklung des weiblichen Maushirn 5. Zuchtstrategie Die R26-BL-IRES-τlacZ (BIZ) und die R26-GFP-TTC (GTT) Begleitheizungsleitungen sind Knock-in-Stämme, die rekombinante 5 ROSA26 Allele tragen. Die R26-BIZ und die R26-GTT Allele transkriptional stumm aufgrund der Gegenwart einer starken Transkriptionsstoppsignal, das von zwei loxP-Stellen flankiert ist 5. Expression des BIZ und GTT Transgen durch Cre-vermittelte Entfernung des transkriptionellen Stop-Signal aktiviert. Die R26-BIZ und R26 GTT-Allele können unabhängig voneinander einfach durch Kreuzung mit einem Cre Fahrer verwendet werden. Zur Analyse Tiere, die heterozygot für die jeweiligen Cre und R26 Allele verwendet werden. Wurf Durchführung einer Cre oder ein Allel R26 jeweils als Kontrollen verwendet werden. Alternativ ist es auch möglich, zu erzeugen triple Knock-in Tiere, die die Cre, R26 und R26-BIZ-GTT-Allele jedoch wird dies eine zusätzliche Quer erfordern.

<table><tbody><tr><td>Bisbenzimide (Hoechst 33258 dye)</td><td>Sigma</td><td>14530-100MG</td><td></td></tr><tr><td>Ethanol</td><td>Sigma</td><td>32205-1L</td><td></td></tr><tr><td>Cryo mold (Peel-a-way)</td><td>Polyscience Inc.</td><td>18646A-1</td><td>22 x 22 x 20mm</td></tr><tr><td>DMSO</td><td>Sigma</td><td>D8418-100ML</td><td></td></tr><tr><td>Dimethyl Formamide (DMF)</td><td>VWR Chemicals</td><td>23470,293</td><td></td></tr><tr><td>EGTA</td><td>ROTH</td><td>3054.3</td><td></td></tr><tr><td>Fluoromount G</td><td>Southern Biotech</td><td>0100-01</td><td></td></tr><tr><td>Glutaraldehyde</td><td>Sigma</td><td>G5882-50ML</td><td></td></tr><tr><td>Hydrogen peroxide</td><td>Sigma</td><td>34988-7</td><td></td></tr><tr><td>Isopentane (Methyl 2-butane)</td><td>Sigma</td><td>M32631-2.5L</td><td></td></tr><tr><td>Kaiser&#039;s glycine gelatin</td><td>Merck</td><td>1092420100</td><td></td></tr><tr><td>Methanol</td><td>Sigma</td><td>494437-1L</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>M2670-100G</td><td></td></tr><tr><td>NaCl</td><td>ROTH</td><td>HN00.2</td><td></td></tr><tr><td>NBT</td><td>Sigma</td><td>298-83-9</td><td></td></tr><tr><td>Nonidet P40 substitute</td><td>Fluka</td><td>743.85</td><td></td></tr><tr><td>OCT</td><td>Leica</td><td>14020108926</td><td></td></tr><tr><td>PAP pen</td><td>Dako</td><td>S2002</td><td></td></tr><tr><td>Parafarmaldehyde</td><td>Sigma</td><td>P6148-1KG</td><td></td></tr><tr><td>Sodium deoxycholate</td><td>Sigma</td><td>D6750-25G</td><td></td></tr><tr><td>Sucrose</td><td>Sigma</td><td>S7903-1KG</td><td></td></tr><tr><td>Superfrost slides</td><td>Thermo Scientific</td><td>FT4981GLPLUS</td><td></td></tr><tr><td>TSA kit</td><td>PerkinElmer</td><td>NEL700</td><td></td></tr><tr><td>TSA plus kit</td><td>PerkinElmer</td><td>NEL749A001KT</td><td></td></tr><tr><td>Tris</td><td>ROTH</td><td>AE15.2</td><td></td></tr><tr><td>Triton-X 100</td><td>ROTH</td><td>3051.2</td><td></td></tr><tr><td>Tween 20</td><td>ROTH</td><td>9127.1</td><td></td></tr><tr><td>X-gal</td><td>ROTH</td><td>2315.1</td><td></td></tr><tr><td>Cryostat</td><td>Leica</td><td>na</td><td></td></tr><tr><td>Light microscope equipped with DIC imaging</td><td>Zeiss</td><td>Axioskop2 equipped with Axio Vision software</td><td></td></tr><tr><td>Fluroscence microscope</td><td>Zeiss</td><td>Axioskop2 equipped with Axio Vision software</td><td></td></tr><tr><td>Photoshop</td><td>Adobe</td><td>PS6</td><td></td></tr><tr><td>Goat anti-WGA (recognizes BL)</td><td>Vector Laboatories</td><td>AS-2024</td><td></td></tr><tr><td>Biotinylayted horse anti-goat IgG</td><td>Vector Laboatories</td><td>BA-9500</td><td></td></tr><tr><td>Biotinylated goat anti-rabbit IgG</td><td>Vector Laboatories</td><td>BA-1000</td><td></td></tr><tr><td>Rabbit anti-GFP (recognizes GTT)</td><td>Invitrogen</td><td>A11122</td><td></td></tr><tr><td>Rabbit anti-GnRH</td><td>Affinity Bio Reagent</td><td>PA1-121</td><td></td></tr><tr><td>Dylight488-donkey anti-rabbit IgG</td><td>Thermo Scientific</td><td>SA5-10038</td><td></td></tr><tr><td>SA-Alexa Fluor 546</td><td>Life Technologies</td><td>S-11225</td><td></td></tr><tr><td colspan="4">Primers</td></tr><tr><td>BL Fwd (for BIZ genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>ATGAAGATGATGAGCACCAGGGC</td></tr><tr><td>BL Rev (for BIZ genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>AGCCCTCGCCGCAGAACTC</td></tr><tr><td>Cre Fwd (for Cre genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>GTCGATGCAACGAGTGATGAGGTTCG</td></tr><tr><td>Cre Rev (for Cre genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>CCAGGCTAAGTGCCTTCTCTACACCTGC</td></tr><tr><td>TTC Fwd (for GTT genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>AGCAAGGGCGAGGAGCTGTT</td></tr><tr><td>TTC Rev (for GTT genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>GTCTTGTAGTTGCCGTCGTCCTTGAA</td></tr><tr><td>XY Fwd (for gender genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>TGAAGCTTTTGGCTTTGA</td></tr><tr><td>XY Rev (for gender genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>CCGCTGCCAAATTCTTTG</td></tr><tr><td>ROSA26 Fwd</td><td>Eurofins MWG Operon</td><td></td><td>CGAAGTCGCTCTGAGTTGTTATC</td></tr><tr><td>ROSA26 Rev</td><td>Eurofins MWG Operon</td><td></td><td>GCAGATGGAGCGGGAGAAAT</td></tr><tr><td>SA Rev</td><td>Eurofins MWG Operon</td><td></td><td>CGAAGTCGCTCTGAGTTGTTATC</td></tr></tbody></table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

Dieser Abschnitt zeigt repräsentative Ergebnisse, die erhalten wird, kann die Arbeit mit dem R26-BIZ (B L I RES-τlac Z) und der R26-GTT (G FP TT C) Allele werden. Hier verwenden wir die R26-BIZ und der R26-GTT-Allele, die Reifung der neuronalen Schaltkreise Regulierung der reproduktiven Achse analysieren. Die Vervielfältigung in Wirbeltieren wird zentral von einer kleinen Untergruppe von Neuronen im Hypothalamus, die Gonadotropin-Releasing-Hormon (GnRH) ...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

Bedingte Genetische transsynaptische Tracing in der embryonalen Maus-Gehirn

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.6K Aufrufe.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

Serie: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Mosaic Analysis of Gene Function in Postnatal Mouse Brain Development by Using Virus-based Cre Recombination

Normal brain function relies not only on embryonic development when major neuronal pathways are established, but also on postnatal 
development when neural circuits are matured and refined. Misregulation at this stage may lead to neurological and psychiatric disorders such as autism 
and schizophrenia1,2. Many genes have been studied in the prenatal brain and found crucial to many developmental processes3-5. However, their 
function in the postnatal brain is largely unknown, partly because their deletion in mice often leads to lethality during neonatal development, and partly because their requirement in early development hampers the postnatal analysis. To overcome these obstacles, floxed alleles of these genes are currently being generated in mice 6. When combined with transgenic alleles that express Cre recombinase in specific cell types, conditional deletion can be achieved to study gene function in the postnatal brain. However, this method requires additional alleles and extra time (3-6 months) to generate the mice with appropriate genotypes, thereby limiting the expansion of the genetic analysis to a large scale in the mouse brain.
Here we demonstrate a complementary approach that uses virally-expressed Cre to study these floxed alleles rapidly and 
systematically in postnatal brain development. By injecting recombinant adeno-associated viruses (rAAVs)7,8 encoding Cre into the neonatal brain, 
we are able to delete the gene of interest in different regions of the brain. By controlling the viral titer and coexpressing a fluorescent 
protein marker, we can simultaneously achieve mosaic gene inactivation and sparse neuronal labeling. This method bypasses the requirement of 
many genes in early development, and allows us to study their cell autonomous function in many critical processes in postnatal brain development,
 including axonal and dendritic growth, branching, and tiling, as well as synapse formation and refinement. This method has been used successfully 
in our own lab (unpublished results) and others8,9, and can be extended to other viruses, such as lentivirus 9, as well as to the expression of 
shRNA or dominant active proteins 10. Furthermore, by combining this technique with electrophysiology as well as recently-developed optical 
imaging tools 11, this method provides a new strategy to study how genetic pathways influence neural circuit development and function in mice 
and rats.

An in vivo method to test gene function in postnatal brain is described. Recombinant AAVs expressing Cre and/or a fluorescent protein are injected into neonatal mouse brain. Mosaic gene inactivation and sparse neuronal labeling are achieved, allowing rapid analysis of gene function in processes critical to neural circuit development.

Mosaic Analyse der Genfunktion in Postnatale Mäusehirnen mithilfe von Virus-basierten Cre Rekombination

Normal brain function relies not only on embryonic development when major neuronal pathways are established, but also on postnatal 
development when ...

Forschung

Neurowissenschaften

Mouse in Utero Electroporation: Controlled Spatiotemporal Gene Transfection

In order to understand the function of genes expressed in specific region of the developing brain, including signaling molecules and axon guidance molecules, local gene transfer or knock- out is required. Gene targeting knock-in or knock-out into local regions is possible to perform with combination with a specific CRE line, which is laborious, costly, and time consuming. Therefore, a simple transfection method, an in utero electroporation technique, which can be performed with short time, will be handy to test the possible function of candidate genes prior to the generation of transgenic animals 1,2. In addition to this, in utero electroporation targets areas of the brain where no specific CRE line exists, and will limit embryonic lethality 3,4. Here, we present a method of in utero electroporation combining two different types of electrodes for simple and convenient gene transfer into target areas of the developing brain. First, a unique holding method of embryos using an optic fiber optic light cable will make small embryos (from E9.5) visible for targeted DNA solution injection into ventricles and needle type electrodes insertion to the targeted brain area 5,6. The patterning of the brain such as cortical area occur at early embryonic stage, therefore, these early electroporation from E9.5 make a big contribution to understand entire area patterning event. Second, the precise shape of a capillary prevents uterine damage by making holes by insertion of the capillary. Furthermore, the precise shape of the needle electrodes are created with tungsten and platinum wire and sharpened using sand paper and insulated with nail polish 7, a method which is described in great detail in this protocol. This unique technique allows transfection of plasmid DNA into restricted areas of the brain and will enable small embryos to be electroporated. This will help to, open a new window for many scientists who are working on cell differentiation, cell migration, axon guidance in very early embryonic stage. Moreover, this technique will allow scientists to transfect plasmid DNA into deep parts of the developing brain such as thalamus and hypothalamus, where not many region-specific CRE lines exist for gain of function (GOF) or loss of function (LOF) analyses.

Mouse in Utero Electroporation: Controlled Spatiotemporal Gene Transfection

A gene transfer method into the developing mouse brain is described by using a unique surgical method and special shape of electrodes. This unique technique allows transfection of plasmid DNA temporally and spatially, which will aid many neuroscientists in studying brain development.

Maus in Utero Elektroporation: Kontrollierte Spatiotemporal Gene Transefection

In order to understand the function of genes expressed in specific region of the developing brain, including signaling molecules and axon guidance ...

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date this tool has been widely used to study the regulation of cellular proliferation, differentiation and neuronal migration especially in the developing cerebral cortex 6-8. Here we detail our protocol to electroporate in utero the cerebral cortex and the hippocampus and provide evidence that this approach can be used to study dendrites and spines in these two cerebral regions.
Visualization and manipulation of neurons in primary cultures have contributed to a better understanding of the processes involved in dendrite, spine and synapse development. However neurons growing in vitro are not exposed to all the physiological cues that can affect dendrite and/or spine formation and maintenance during normal development. Our knowledge of dendrite and spine structures in vivo in wild-type or mutant mice comes mostly from observations using the Golgi-Cox method 9. However, Golgi staining is considered to be unpredictable. Indeed, groups of nerve cells and fiber tracts are labeled randomly, with particular areas often appearing completely stained while adjacent areas are devoid of staining. Recent studies have shown that IUE of fluorescent constructs represents an attractive alternative method to study dendrites, spines as well as synapses in mutant / wild-type mice 10-11 (Figure 1A). Moreover in comparison to the generation of mouse knockouts, IUE represents a rapid approach to perform gain and loss of function studies in specific population of cells during a specific time window. In addition, IUE has been successfully used with inducible gene expression or inducible RNAi approaches to refine the temporal control over the expression of a gene or shRNA 12. These advantages of IUE have thus opened new dimensions to study the effect of gene expression/suppression on dendrites and spines not only in specific cerebral structures (Figure 1B) but also at a specific time point of development (Figure 1C).
Finally, IUE provides a useful tool to identify functional interactions between genes involved in dendrite, spine and/or synapse development. Indeed, in contrast to other gene transfer methods such as virus, it is straightforward to combine multiple RNAi or transgenes in the same population of cells. 
In summary, IUE is a powerful method that has already contributed to the characterization of molecular mechanisms underlying brain function and disease and it should also be useful in the study of dendrites and spines.

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

This article describes in detail a protocol to electroporate in utero the cerebral cortex and the hippocampus at E14.5 in mice. We also show that this is a valuable method to study dendrites and spines in these two cerebral regions.

Visualisierung und genetische Manipulation von Dendriten und Dornen in der Maus Hirnrinde und im Hippocampus mit<em&gt; In utero</em&gt; Die Elektroporation

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date ...

Viral Tracing of Genetically Defined Neural Circuitry

Classical methods for studying neuronal circuits are fairly low throughput. Transsynaptic viruses, particularly the pseudorabies (PRV) and rabies virus (RABV), and more recently vesicular stomatitis virus (VSV), for studying circuitry, is becoming increasingly popular. These higher throughput methods use viruses that transmit between neurons in either the anterograde or retrograde direction.
Recently, a modified RABV for monosynaptic retrograde tracing was developed. (Figure 1A). In this method, the glycoprotein (G) gene is deleted from the viral genome, and resupplied only in targeted neurons. Infection specificity is achieved by substituting a chimeric G, composed of the extracellular domain of the ASLV-A glycoprotein and the cytoplasmic domain of the RABV-G (A/RG), for the normal RABV-G1. This chimeric G specifically infects cells expressing the TVA receptor1. The gene encoding TVA can been delivered by various methods2-8. Following RABV-G infection of a TVA-expressing neuron, the RABV can transmit to other, synaptically connected neurons in a retrograde direction by nature of its own G which was co-delivered with the TVA receptor. This technique labels a relatively large number of inputs (5-10%)2 onto a defined cell type, providing a sampling of all of the inputs onto a defined starter cell type.
We recently modified this technique to use VSV as a transsynaptic tracer9. VSV has several advantages, including the rapidity of gene expression. Here we detail a new viral tracing system using VSV useful for probing microcircuitry with increased resolution. While the original published strategies by Wickersham et al.4 and Beier et al.9 permit labeling of any neurons that project onto initially-infected TVA-expressing-cells, here VSV was engineered to transmit only to TVA-expressing cells (Figure 1B). The virus is first pseudotyped with RABV-G to permit infection of neurons downstream of TVA-expressing neurons. After infecting this first population of cells, the virus released can only infect TVA-expressing cells. Because the transsynaptic viral spread is limited to TVA-expressing cells, presence of absence of connectivity from defined cell types can be explored with high resolution. An experimental flow chart of these experiments is shown in Figure 2. Here we show a model circuit, that of direction-selectivity in the mouse retina. We examine the connectivity of starburst amacrine cells (SACs) to retinal ganglion cells (RGCs).

A method of tracing synaptically connected neurons is described. We use TVA specificity of an upstream cell to probe whether a cell population of interest receives synaptic input from genetically defined cell types.

Viral Tracing von genetisch definierten Neural Circuitry

Classical methods for studying neuronal circuits are fairly low throughput. Transsynaptic viruses, particularly the pseudorabies (PRV) and rabies virus ...

Electroporation of the Hindbrain to Trace Axonal Trajectories and Synaptic Targets in the Chick Embryo

Electroporation of the chick embryonic neural tube has many advantages such as being quick and efficient for the expression of foreign genes into neuronal cells. In this manuscript we provide a method that demonstrates uniquely how to electroporate DNA into the avian hindbrain at E2.75 in order to specifically label a subset of neuronal progenitors, and how to follow their axonal projections and synaptic targets at much advanced stages of development, up to E14.5. We have utilized novel genetic tools including specific enhancer elements, Cre/Lox - based plasmids and the PiggyBac-mediated DNA transposition system to drive GFP expression in a subtype of hindbrain cells (the dorsal most subgroup of interneurons, dA1). Axonal trajectories and targets of dA1 axons are followed at early and late embryonic stages at various brainstem regions. This strategy contributes advanced techniques for targeting cells of interest in the embryonic hindbrain and for tracing circuit formation at multiple stages of development.

How neuronal networks are established in the embryonic brain is a fundamental question in developmental neurobiology. Here we combined an electroporation technique with novel genetic tools, such as Cre/Lox&#x2013;plasmids and PiggyBac-mediated DNA transposition system in the avian hindbrain to label dorsal interneurons and track their axonal projections and synaptic targets at various developmental stages.

Elektroporation des Hinterhirn zu Axonal Trajectories und Synaptic Treffer in der Embryo-Küken Trace

Electroporation of  the chick embryonic neural tube has many advantages such as being quick and efficient  for the expression of foreign genes into ...

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Genetic modification of specific regions of the developing mammalian brain is a very powerful experimental approach. However, generating novel mouse mutants is often frustratingly slow. It has been shown that access to the mouse brain developing in utero with reasonable post-operatory survival is possible. Still, results with this procedure have been reported almost exclusively for the most superficial and easily accessible part of the developing brain, i.e. the cortex. The thalamus, a narrower and more medial region, has proven more difficult to target. Transfection into deeper nuclei, especially those of the hypothalamus, is perhaps the most challenging and therefore very few results have been reported. Here we demonstrate a procedure to target the entire hypothalamic neuroepithelium or part of it (hypothalamic regions) for transfection through electroporation. The keys to our approach are longer narcosis times, injection in the third ventricle, and appropriate kind and positioning of the electrodes. Additionally, we show results of targeting and subsequent histological analysis of the most recessed hypothalamic nucleus, the mammillary body.

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Despite the functional and medical importance of the hypothalamus, in utero genetic manipulation of its development has rarely been attempted. We show a detailed procedure for in utero electroporation into the mouse hypothalamus and show representative results of total and partial (regional) hypothalamic transfection.

Genetische Manipulation der Maus entwickeln Hypothalamus durch<em&gt; In utero</em&gt; Elektroporation

Genetic  modification of specific regions of the developing mammalian brain is a very  powerful experimental approach. However, generating novel mouse ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

Live-Imaging der Mitose in der Entwicklung von embryonalen Maus-Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the ...

Two-Photon in vivo Imaging of Dendritic Spines in the Mouse Cortex Using a Thinned-skull Preparation

In the mammalian cortex, neurons form extremely complicated networks and exchange information at synapses. Changes in synaptic strength, as well as addition/removal of synapses, occur in an experience-dependent manner, providing the structural foundation of neuronal plasticity. As postsynaptic components of the most excitatory synapses in the cortex, dendritic spines are considered to be a good proxy of synapses. Taking advantages of mouse genetics and fluorescent labeling techniques, individual neurons and their synaptic structures can be labeled in the intact brain. Here we introduce a transcranial imaging protocol using two-photon laser scanning microscopy to follow fluorescently labeled postsynaptic dendritic spines over time in vivo. This protocol utilizes a thinned-skull preparation, which keeps the skull intact and avoids inflammatory effects caused by exposure of the meninges and the cortex. Therefore, images can be acquired immediately after surgery is performed. The experimental procedure can be performed repetitively over various time intervals ranging from hours to years. The application of this preparation can also be expanded to investigate different cortical regions and layers, as well as other cell types, under physiological and pathological conditions.

Two-Photon in vivo Imaging of Dendritic Spines in the Mouse Cortex Using a Thinned-skull Preparation

Time-lapse imaging in the living animal provides valuable information on structural reorganization in the intact brain. Here, we introduce a thinned-skull preparation that allows transcranial imaging of fluorescently labeled synaptic structures in the living mouse cortex by two-photon microscopy.

Zwei-Photonen-<em&gt; In vivo</em&gt; Imaging von dendritischen Dornen in der Maus Cortex Mit einem ausgedünnten Schädel Vorbereitung

In the mammalian cortex, neurons form extremely complicated networks and exchange information at synapses. Changes in synaptic strength, as well as ...

Laser-guided Neuronal Tracing In Brain Explants

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake through electroporation in brain explants with targeted laser illumination and matching filter goggles during the procedure. The described technique of in vitro electroporation by itself yields relatively good visual control for targetting certain areas of the brain. By combining it with laser excitation of fluorescent genetic markers and their read-out through band-passing filter goggles, which can pick up the emissions of the genetically labeled cells/nuclei and the fluorescent tracing dye, a researcher can substantially increase the accuracy of injections by finding the area of interest and controlling for the dye-spread/uptake in the injection area much more efficiently. In addition, the laser illumination technique allows to study the functionality of a given neurocircuit by providing information about the type of neurons projecting to a certain area in cases where the GFP expression is linked to the type of transmitter expressed by a subpopulation of neurons.

We describe a technique to label neurons and their processes via anterograde or retrograde tracer injections into brain nuclei using an in vitro preparation. We modified an existing method of in vitro tracer electroporation by taking advantage of fluorescently labeled mouse mutants and basic optical equipment in order to increase labeling accuracy.

Lasergelenkte neuronale Tracing in Brain Explantate

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake ...

Time-lapse Confocal Imaging of Migrating Neurons in Organotypic Slice Culture of Embryonic Mouse Brain Using In Utero Electroporation

In utero electroporation is a rapid and powerful approach to study the process of radial migration in the cerebral cortex of developing mouse embryos. It has helped to describe the different steps of radial migration and characterize the molecular mechanisms controlling this process. To directly and dynamically analyze migrating neurons they have to be traced over time. This protocol describes a workflow that combines in utero electroporation with organotypic slice culture and time-lapse confocal imaging, which allows for a direct examination and dynamic analysis of radially migrating cortical neurons. Furthermore, detailed characterization of migrating neurons, such as migration speed, speed profiles, as well as radial orientation changes, is possible. The method can easily be adapted to perform functional analyses of genes of interest in radially migrating cortical neurons by loss and gain of function as well as rescue experiments. Time-lapse imaging of migrating neurons is a state-of-the-art technique that once established is a potent tool to study the development of the cerebral cortex in mouse models of neuronal migration disorders.

Time-lapse Confocal Imaging of Migrating Neurons in Organotypic Slice Culture of Embryonic Mouse Brain Using In Utero Electroporation

This protocol provides instructions for direct observation of radially migrating cortical neurons. In utero electroporation, organotypic slice culture, and time-lapse confocal imaging are combined to directly and dynamically study the effects of overexpression or downregulation of genes of interest in migrating neurons and to analyze their differentiation during development.

Zeitraffer-konfokale Bildgebung der Migration von Neuronen in der organotypischen Scheibe Kultur der embryonalen Maus Gehirn mit<em&gt; In Utero</em&gt; Elektroporation

In utero electroporation is a rapid and powerful approach to study the process of radial migration in the cerebral cortex of developing mouse embryos. It ...

Bedingte Genetische transsynaptische Tracing in der embryonalen Maus-Gehirn

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Mosaic Analyse der Genfunktion in Postnatale Mäusehirnen mithilfe von Virus-basierten Cre Rekombination

Maus in Utero Elektroporation: Kontrollierte Spatiotemporal Gene Transefection

Visualisierung und genetische Manipulation von Dendriten und Dornen in der Maus Hirnrinde und im Hippocampus mit

Viral Tracing von genetisch definierten Neural Circuitry

Elektroporation des Hinterhirn zu Axonal Trajectories und Synaptic Treffer in der Embryo-Küken Trace

Genetische Manipulation der Maus entwickeln Hypothalamus durch

Live-Imaging der Mitose in der Entwicklung von embryonalen Maus-Cortex

Zwei-Photonen-

Lasergelenkte neuronale Tracing in Brain Explantate

Zeitraffer-konfokale Bildgebung der Migration von Neuronen in der organotypischen Scheibe Kultur der embryonalen Maus Gehirn mit