We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

HINWEIS: Ethikerklärung: Verfahren unter Verwendung tierischer Probanden wurden von der Tierschutzkommission der Universität Hamburg und der Universität des Saarlandes genehmigt. 1. Vorbereitung und Fixierung von embryonalem Gewebe <ol><li> Vereinbaren Sie alle mussten sezieren die Embryonen und die Lösungen für die anschließende Fixierung des Gewebes vor dem Töten der Tiere Ausrüstung. HINWEIS: Immer eine frische 4% Paraformaldehyd (PFA) Lösung (4% PFA in 0,1 M phosphatgepufferter Kochsalzlösung (PBS), pH-Wert auf 7,4). </li><li> Euthanize zeitlich schwangere Frau Maus mit einer ethisch genehmigten Verfahren. </li><li> Übertragen Sie die Maus auf eine Plattform. Befeuchten Sie die Bauchseite des Bauches mit 70% Ethanol und einen vertikalen Schnitt mit scharfen Schere, um die Bauchhöhle aus. </li><li> Identifizieren Sie die embryonalen Kette und ziehen Sie sie vorsichtig mit stumpfen Pinzette und legen Sie sie in eiskaltem PBS. </li><li> Holen Sie die einzelnen Embryonen ausdie embryonalen Kette mit einer feinen Schere und Pinzette. Entfernen Sie die zusätzlichen Gewebe um die Embryonen und waschen Sie sie in eiskaltem PBS. </li><li> Nehmen Sie eine kleine Schwanzbiopsie (vor der Übertragung des Embryos in PFA) und Inkubation in Schwanz Lysepuffer für die Geschlechteridentifikation und Tracer-Allel Genotypisierung PCR. </li><li> Starten Sie aus dem Embryo am meisten lateralen Seite und übertragen jedes Embryo getrennt in ein Röhrchen mit eiskaltem 4% PFA auf Eis auf einem Schüttler. </li><li> Weichen Sie die Embryonen im Alter von E13.5 oder jünger 1,5 h auf Eis mit konstantem Schütteln. Weichen Sie die Embryonen im Alter von E14.5 und E15.5 2,5 h auf Eis mit konstantem Schütteln. </li><li> Für Embryonen Alter E16.5 oder älter, enthaupten und entfernen Sie die Außenhaut vor dem Eintauchen des Kopfes in PFA-Lösung. Leiter der E16.5 Embryonen 4,5 h auf Eis mit konstantem Schütteln eingeweicht werden. </li><li> Nach entsprechender Fixierung, waschen Sie die Embryonen dreimal mit eiskaltem PBS. Übertragen Sie die Embryonen in 30% Saccharose in PBS-Lösung bei 4 ° C, bis sie sinkennach unten. </li></ol> 2. Einfrieren <ol><li> Vereinbaren Sie alle vor dem Start des Gefrierprozesses benötigten Materialien: Kryo-Schimmel, Kryo-Handschuhe, Feder Entomologie Zangen, Textmarker und optimale Schnitttemperatur Verbindung (OCT) </li><li> Beschriften Sie die Kryo-Form mit einem permanenten alkoholbeständigen Marker (erwähnen Sie die Ausrichtung des Gewebes, das Datum und Genotyp). Bereiten Sie eine Matsch zerstoßenes Trockeneis und 100% Ethanol in einem Eiskübel. Stellen Sie ein Becherglas innen Isopentan enthält. Nach 10 min für die Isopentan abkühlen. </li><li> In der Zwischenzeit nehmen Sie die Gewebe aus dem Saccharoselösung, wischen Sie überschüssige Saccharose um das Gewebe mit Hilfe von Labortücher. Übertragen Sie das Gewebe in eine vorge beschriftet Kryo-Form mit ausreichend Oktober, um das Gewebe zu bedecken. Vermeiden Sie Luftblasen im Oktober; vor allem rund um das Gewebe. </li><li> Richten Sie das Gewebe in OCT mit Feder Entomologie Pinzette zu Gewebeschäden zu vermeiden. Starten Sie das Einfrieren durch die Übertragung der Kryo-mold in das vorgekühlte Isopentan Badewanne. Isopentan in den Oktober spritzen Sie nicht, da es nicht richtig einfrieren. Wickeln Sie die Proben in Aluminiumfolie und bei -80 ° C. </li></ol> 3. Kryoschneiden <ol><li> Cut 14 um dünne Schnittserien in Serie von fünf mit einem Kryostaten und sammeln auf SuperFrost® Plus-Glasobjektträger für Immunfluoreszenz (IF) Analyse. Bewahren Sie die Objektträger bei -80 ° C bis genutzt. </li></ol> 4. Tracer Visualisierung Mit dem Tyramid Signalverstärkung (TSA) Protokoll <ol><li> Bereiten Sie die Puffer und Reagenzien für die Färbung erforderlich. Immer frisch und die Tris-NaCl-Tween (TNT) Puffer vorzubereiten am Tag der Nutzung. <ol><li> Bereiten TNT Puffer unter Verwendung von 100 ml 1 M Tris-HCl pH 7,5, 30 ml 5 M NaCl und ddH 2 O bis zu einem Endvolumen von 1 l In 500 ul Tween 20 unter Verwendung einer 1 ml Pipette. Fügen Sie die Tween 20 langsam und spülen Sie die Pipette auf und ab mehrmals, um sicherzustellen, dass alle Tween 20 ist inLösung. </li><li> Bereiten Tris-NaCl-Blocking (TNB) Puffer mit 100 ml 1 M Tris-HCl, pH 7,5, 30 ml 5 M NaCl und ddH 2 O bis zu einem Gesamtvolumen von 1 l 5 g Blocking Reagenz (mit der vorgesehenen Kit) langsam in kleinen Schritten an den Puffer unter Rühren. Die Lösung wird langsam auf 55 ° C unter kontinuierlichem Rühren, um das Blockierungsmittel vollständig zu lösen (dies sollte nicht länger als 30-60 Minuten). Um dies zu erreichen homogene Erwärmung mit einem Wasserbad bei 55 ° C. Die Lösung wird milchig erscheinen. Bringen Sie die Lösung auf Raumtemperatur, bevor Sie. Aliquotieren und bei -20 ° C für die langfristige Lagerung. </li><li> Rekonstituieren Biotin Tyramid Reagenz (im Kit enthalten) in Molecular Biology / HPLC-Qualität DMSO. Je nachdem, welcher Kit verwendet die entsprechende Menge DMSO kann variieren. Bewahren Sie die Stammlösung bei 4 ° C. HINWEIS: Teile von Tieren, die heterozygot für die jeweiligen Cre und R26 Allele für die Schaltungsanalyse verwendet werden. Mit sReflexionen von Wurf Durchführung einer Cre oder ein Allel R26 jeweils als negative Kontrollen. Gönnen negativen Kontrollobjektträger genau wie Folien aus doppelt heterozygote Tiere. Darüber hinaus sind in einem Steuerschieber aus einem Doppel heterozygoten Tier, sondern lassen Sie das TSA-Reagenz (nicht verstärkte Kontrolle). </li></ol></li><li> Mit einem scharfen frische Skalpell entfernen überschüssiges Oktober die Gewebeschnitte Umgebung und markieren die Grenze um die Abschnitte mit einem PAP Stift. </li><li> Trocknen Sie die Objektträger für 2-3 Minuten bei Raumtemperatur (RT). Für jede 5 min Waschen Sie die Objektträger bei Raumtemperatur 3x mit TNT. Die Folien bei RT Inkubation 30 min in 0,3% H 2 O 2 -Lösung in eiskaltem Methanol, um endogene Peroxidase-Aktivität zu quenchen. </li><li> Jeweils 3x mit PBS für jeweils 5 min bei RT. Inkubieren für 10 min in 0,5% Triton-X-100 in PBS für Gewebe Permeabilisierung. Für jede 5 min Waschen Sie die Objektträger bei Raumtemperatur 3x mit TNT. </li><li> Block mit TNB (Blockierungslösung, 200 bis 300 &amp; mgr; l pro Folie) 30min bei RT in einer feuchten Kammer. Sicherstellen, dass alle Teile vollständig von TNB bedeckt. Lassen Sie die Objektträger trocknen in den Zwischenbereichen. </li><li> Abfließen überschüssiges Blockierungspuffers und Anwendung des primären Antiserum erkennt den Tracer (1: 1.000 Ziegen-Anti-WGA für BL, 1: 15.000 Kaninchen-Anti-GFP für GTT) in TNB für 2 h bei RT, verdünnt oder über Nacht bei 4 ° C. Achten Sie darauf, genug Volumen, um den Gewebeschnitt (200 bis 300 &amp; mgr; l pro Folie) vollständig bedecken. HINWEIS: Die primären Antiseren Verdünnungen hier empfohlen werden, können angepasst werden. </li><li> Jeweils unter Rühren 5 Minuten waschen Sie die Folien bei RT 3x mit TNT. </li><li> Inkubieren der Schnitte mit biotinylierten sekundären Antiserum erkennt den Host des ersten Antiserum (1: 500 Pferd-Anti-Ziegen-IgG Anti-WGA, 1: 5.000 Ziegen-Anti-Kaninchen-IgG-anti-GFP in TNB für 1 h bei RT). </li><li> Jeweils 3x mit TNT bei RT jeweils unter Rühren 5 min. Inkubation in 1: 100 Streptavidin (SA) konjugierte Meerrettichperoxidase (SA-HRP, sofern with das Kit) in TNB für 30 min bei RT in einer feuchten Kammer. Für jede 5 min Waschen Sie die Objektträger bei Raumtemperatur 3x mit TNT. Unterdessen tauen die TSA. </li><li> Verdünnen TSA 01.50 in TSA Verstärkung Verdünnungsmittel (im Kit enthalten, verwenden Sie das TSA-Kit für die Visualisierung von BL und der TSA + Kit für GTT). Die Gewebeschnitte in verdünnter TSA inkubieren genau 10 min bei RT. Verdünnen TSA kurz vor der Verwendung, im Idealfall während der vorhergehenden Waschschritt, verwenden Sie keine verbleibenden verdünnten TSA Reagenz für zukünftige Experimente; immer frisch zubereiten. </li><li> Jeweils unter Rühren 5 Minuten waschen Sie die Folien bei RT 3x mit TNT. Inkubieren mit 1: 500 Alexa Fluor ® 546-Streptavidin-Konjugat in TNB für 30 min bei RT. Jeweils unter Rühren 5 Minuten waschen Sie die Folien bei RT 3x mit TNT. </li><li> Inkubieren für 10 min in 5% Bisbenzimid-Lösung in PBS bei RT für die Kernfärbung. Jeweils unter Rühren 5 Minuten waschen Sie die Folien bei RT 3x mit TNT. Montieren Sie mit Fluromount G und führen Epifluoreszenz oder konfokalen Mikroskopie. <em&gt; Fehlerbehebung: Wirksamkeit von Tracer Übertragung auf dem Expressionsspiegel des ROSA26 Locus in den produzierenden Zellen (durch die Cre Treiberleitung verwendet wird, bestimmt) abhängen und von der neuronalen Schaltung analysiert (zB Anzahl der Neuronen Herstellung des Tracers Konvergenz etc.). Deshalb sind die primären Antiseren Verdünnungen hier empfohlenen müssen möglicherweise angepasst werden, um Unter- oder Übersignal zu verhindern. Hintergrund sollten immer mit geeigneten Kontrollobjektträger (siehe oben) untersucht werden. </li></ol> 5. τlacZ Färbung für Embryonale Bereiche <ol><li> Bereiten Sie die Puffer und Reagenzien für die Färbung erforderlich. Immer frisch bereiten die LacZ Puffer C vor dem Gebrauch. <ol><li> Bereiten 5-Brom-4-chlor-3-indolyl-β-D-galactopyranosid (X-gal) Stammlösung (40 mg / ml) durch Zugabe von 40 g X-gal zu 1 ml 70% Dimethylformamid (DMF). Mit Alufolie abdecken und bei -20 ° C für die langfristige Lagerung. </li><li> Bereiten Nitroblautetrazolium (NBT) stock-Lösung (50 mg / ml) durch Zugabe von 50 g NBT zu 1 ml 70% DMF. Mit Alufolie abdecken und bei -20 ° C für die langfristige Lagerung. </li><li> Bereiten LacZ Fixativ mit 80 ul 25% Glutaraldehyd, 5 ml einer 4% PFA, 20 ul 1 M MgCl 2, 100 &amp; mgr; l 500 mM EGTA, 1 ml 1 M Phosphatpuffer pH 7,4 und ddH 2 O bis zu einem letzten Volumen von 10 ml. </li><li> Bereiten LacZ Puffer A mit 1 ml von 1 M MgCl 2, 5 ml 500 mM EGTA, 50 ml 1 M Phosphatpuffer pH 7,4 und ddH 2 O bis zu einem Endvolumen von 500 ml. </li><li> Bereiten LacZ Puffer B unter Verwendung von 1 ml von 1 M MgCl 2, 5 ml 500 mM EGTA, 5 ml 1% Natriumdeoxycholat, 100 ml 10% NP-40, 50 ml 1 M Phosphatpuffer pH 7,4 und ddH 2 O bis zu einem Endvolumen von 500 ml. </li><li> Bereiten LacZ Puffer C durch Zugabe von 10 ul NBT-Stammlösung und 12,5 ul der X-gal-Stammlösung zu 1 ml LacZ Puffer B Stellen frisch kurz vor dem Gebrauch und mit Alufolie abdecken. </li></ol&gt; </li><li> Trocknen Sie die Objektträger bei Raumtemperatur mindestens 10-15 min (mittlerweile die Folien mit einem PAP Pen vorzubereiten). </li><li> Fixieren der Abschnitt mit LacZ Fixiermittel für 2 min bei Raumtemperatur in einer befeuchteten Kammer innerhalb einer chemischen Abzugshaube. Waschen 3x mit PBS, ergänzt mit 2 mM MgCl 2. </li><li> Spülen Sie die Folien mit LacZ Puffer A waschen die Dias mit LacZ Puffer A 3 mal für 10 Minuten jeweils bei RT. Für jede 5 min Waschen 2 mal mit LacZ Puffer B. Die Folien in LacZ Puffer C Inkubieren bei 30-37 ° C für 6 Stunden oder über Nacht in einer befeuchteten Kammer. HINWEIS: In ausreichendes Volumen an LacZ-Puffer C; Folien sollten nicht austrocknen während der Inkubation. </li><li> Nach entsprechender Inkubation die Objektträger mit PBS, ergänzt mit 2 mM MgCl 2. Kurz mit ddH 2 O spülen Abschnitte Deckglas mit Mayers Glycin Gelatine. Geeignet für ein Lichtmikroskop mit einem Differentialinterferenzkontrast (DIC) Bild Einrichtung ausgestattet. </li></ol> 6. Gender und Tracer-Genotypisierung <ol><li> Bereiten Schwanz Lysepuffer mit 1 ml 1 M Tris-HCl pH 8,5, 100 ul 500 mM EGTA, 200 ul 10% SDS, 400 &amp; mgr; l 5 M NaCl und ddH 2 O, um ein Endvolumen von 10 ml. </li><li> Fügen Sie 500 ul Lysepuffer Schwanz zu jedem Eppendorf-Röhrchen, die einen Schwanz Biopsie. Hinzufügen Proteinase K bis zu einer Endkonzentration von 100 mg / ml. Inkubieren über Nacht auf einem Schüttler bei 55 ° C. </li><li> Zentrifuge Proben bei 17.000 xg für 10 min bei RT. Den Überstand in ein neues Zentrifugenröhrchen. Gib 500 ul Isopropanol zu dem Überstand. Mischen Sie für mindestens 5 Minuten mit dem Umdrehen der Röhrchen auf und ab. </li><li> Spin in Zentrifuge bei 17.000 xg für 5 Minuten bei Raumtemperatur. Gießen Sie den Überstand. Nach Zugabe von 200 ul 70% Ethanol. Schütteln für mindestens 5 min. </li><li> Zentrifugieren bei 17.000 × g für 5 min. Überstand entfernen mit einem Pipetman (nicht gießen nicht aus). Trocknen des Pellets in einer warmen Kammer (37 ° C) für 15-30 min. </li><li> Pellet in 100 &amp; mgr;niedriger TE pH 8,0 oder Wasser mit weiter Bohrung Filterspitzen. In 55 ° C Setzen Sie für 1 Stunde und bei 37 ° C über Nacht für die richtige Lösung. Lagerung bei 4 ° C. </li><li> Verwenden 1 ul DNA für die PCR-Reaktion (50 &amp; mgr; l Reaktionsgemisch, enthaltend 1 ul Schwanz-DNA, 2,5 &amp; mgr; l DMSO, 10 pM jedes Primers, 25 &amp; mgr; M von jedem dNTP und 1 M Betain). PCR-Primer für die Genotypisierung und Geschlechtsidentität sind in der Tabelle aufgeführten Materialien. </li></ol>

<ol>
	<li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals.">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li><li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+approaches+to+neural+circuits+in+the+mouse.">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li><li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+half+century+of+experimental+neuroanatomical+tracing.">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li><li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus.">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li><li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero.">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li><li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+approach+to+trace+neural+circuits.">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li><li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice.">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li><li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54.">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li><li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GPR54+gene+as+a+regulator+of+puberty.">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li><li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons.">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li><li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice.">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67 (2005).</li><li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene.">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li><li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-activated+site-specific+recombination+in+mice.">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li></ol>

No conflict of interest declared.

Ausdruck transsynaptische Tracer als Transgene, die neuronale Schaltkreise genetisch definierten neuronalen Populationen verfolgen hat mehrere Vorteile gegenüber dem stereotaktische Injektion von Tracern oder neurotopic Viren. Zuerst wird der Tracer als endogenes Protein erzeugt und daher keine Immunantwort hervorzurufen und eine selektive neuralen Weg kann in verschiedenen Tieren, die mit hoher Reproduzierbarkeit zu analysieren. Zweitens, weil dies eine nicht-invasive Methode kann verwendet werden, um die Schaltungen ...

Anatomische Pfadverfolgung ist eine der am häufigsten verwendeten Werkzeuge, um die Beziehung zwischen Gehirn und Verhalten 1 entziffern. Fortschritt in neuronalen Schaltkreis Tracing Technologien hat Neurowissenschaftler mit der Fähigkeit, neuronale Schaltkreise genetisch identifiziert Neuronenpopulationen in Mäusen 2 Spuren verliehen. Trotz dieser technischen Fortschritt bleibt es schwierig, die Bildung von neuronalen Schaltkreisen vor allem während der embryonalen Reifung zu entwirren. Das ist, weil die meisten der bisher entwickelten Tracing-Verfahren basieren auf stereotaktische Injektion von transsynaptische Tracer oder gentechnisch veränderten neurotropen Viren (Abbildung 1) 2,3 basierend. Während diese Techniken zu erreichen räumliche und zeitliche Auflösung der Konnektivität, mehrere inhärente Beschränkungen wie technisch anspruchs Tracer Injektionen in das sich entwickelnde Gehirn, die Reproduzierbarkeit der Injektionsstelle, potenzielle Entzündung an der Injektionsstelle und wich-tantly Zytotoxizität von neurotropen Viren verursacht begrenzen ihre Verwendung 4. Eine alternative Methode ist es, die transsynaptische Tracer als Transgene in genetisch veränderten Mäusen exprimieren. Vor kurzem haben wir diese Technik modifiziert und eine binäre genetische transsynaptische Tracing-System, um die neuronalen Schaltkreise eines genetisch identifiziert neuronalen Population 5 Karte entwickelt. Unsere experimentellen Strategie basiert auf zwei neuen Knock-in Mausstämme, die entweder die bidirektionale Tracer Gerstenlektin (BL) 6 oder die retrograde Tracer-Tetanustoxin-Fragment C bis GFP (GTT) 7 von der ROSA 26 Ort verschmolzen Ausdruck basiert nach Cre-vermittelte Rekombination. Hier verwendeten wir diese Mäusestämme, selektiv auszudrücken BL und GTT in Neuronen, kisspeptin erzeugen, ein Neuropeptid, das bei der Regulierung der Reifung des reproduktiven Achse 8,9 gebracht wird. Wir zeigen, dass diese Technik geeignet ist, die Entwicklung und Reifung der Kuss visualisierenPeptin neuronalen Schaltkreise während der embryonalen Entwicklung des weiblichen Maushirn 5. Zuchtstrategie Die R26-BL-IRES-τlacZ (BIZ) und die R26-GFP-TTC (GTT) Begleitheizungsleitungen sind Knock-in-Stämme, die rekombinante 5 ROSA26 Allele tragen. Die R26-BIZ und die R26-GTT Allele transkriptional stumm aufgrund der Gegenwart einer starken Transkriptionsstoppsignal, das von zwei loxP-Stellen flankiert ist 5. Expression des BIZ und GTT Transgen durch Cre-vermittelte Entfernung des transkriptionellen Stop-Signal aktiviert. Die R26-BIZ und R26 GTT-Allele können unabhängig voneinander einfach durch Kreuzung mit einem Cre Fahrer verwendet werden. Zur Analyse Tiere, die heterozygot für die jeweiligen Cre und R26 Allele verwendet werden. Wurf Durchführung einer Cre oder ein Allel R26 jeweils als Kontrollen verwendet werden. Alternativ ist es auch möglich, zu erzeugen triple Knock-in Tiere, die die Cre, R26 und R26-BIZ-GTT-Allele jedoch wird dies eine zusätzliche Quer erfordern.

<table border="0" cellpadding="0" cellspacing="0" width="721">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:219px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bisbenzimide (Hoechst 33258 dye)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">14530-100MG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">32205-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryo mold (Peel-a-way)</td>
			<td style="width:219px;">Polyscience Inc.</td>
			<td style="width:119px;">18646A-1</td>
			<td>22mm x 22mm x 20mm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DMSO</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D8418-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Dimethyl Formamide (DMF)</td>
			<td style="width:219px;">VWR Chemicals</td>
			<td style="width:119px;">23470,293</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EGTA</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3054.3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fluoromount G</td>
			<td style="width:219px;">Southern Biotech</td>
			<td style="width:119px;">0100-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glutaraldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">G5882-50ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hydrogen peroxide</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">34988-7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Isopentane (Methyl 2-butane)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">M32631-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kaiser&#39;s Glycine gelatin</td>
			<td style="width:219px;">Merck</td>
			<td style="width:119px;">1092420100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Methanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">494437-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">MgCl2</td>
			<td style="width:219px;">Sigma</td>
			<td>M2670-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NaCl</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">HN00.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NBT</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">298-83-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Nonidet P40 substitute</td>
			<td style="width:219px;">Fluka</td>
			<td style="width:119px;">743.85</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">OCT</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">14020108926</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PAP pen</td>
			<td style="width:219px;">Dako</td>
			<td style="width:119px;">S2002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Parafarmaldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">P6148-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium deoxycholate</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D6750-25G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sucrose</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">S7903-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Superfrost slides</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">FT4981GLPLUS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL700</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA plus kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL749A001KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">AE15.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Triton-X 100</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3051.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tween 20</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">9127.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">X-gal</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">2315.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryostat</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">na</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Light microscope equipped with DIC imaging&#160;</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Fluroscence microscope</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Photoshop</td>
			<td style="width:219px;">Adobe</td>
			<td style="width:119px;">PS6</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Goat anti-WGA (recognizes BL)</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">AS-2024</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylayted horse anti-goat IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-9500&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated goat anti-rabbit IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-1000&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Rabbit anti-GFP (recognizes GTT)</td>
			<td style="width:219px;">Invitrogen</td>
			<td style="width:119px;">A11122</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rabbit anti-GnRH</td>
			<td style="width:219px;">Affinity Bio Reagent</td>
			<td style="width:119px;">PA1-121</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dylight488-donkey anti-rabbit IgG</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">SA5-10038</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SA-Alexa Fluor 546</td>
			<td style="width:219px;">Life Technologies</td>
			<td>S-11225</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Primers</td>
			<td style="width:219px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Fwd (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;ATGAAGATGATGAGCACCAG 
			GGC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Rev&#160; (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;AGCCCTCGCCGCAGAACTC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Fwd&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCGATGCAACGAGTGATGAG 
			GTTCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Rev&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCAGGCTAAGTGCCTTCTCTAC 
			ACCTGC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Fwd&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">AGCAAGGGCGAGGAGCTGTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Rev&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCTTGTAGTTGCCGTCGTCCT 
			TGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Fwd (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">TGAAGCTTTTGGCTTTGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Rev&#160; (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCGCTGCCAAATTCTTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ROSA26 Fwd</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">ROSA26 Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">GCAGATGGAGCGGGAGAAAT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">SA Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
	</tbody>
</table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

Dieser Abschnitt zeigt repräsentative Ergebnisse, die erhalten wird, kann die Arbeit mit dem R26-BIZ (B L I RES-τlac Z) und der R26-GTT (G FP TT C) Allele werden. Hier verwenden wir die R26-BIZ und der R26-GTT-Allele, die Reifung der neuronalen Schaltkreise Regulierung der reproduktiven Achse analysieren. Die Vervielfältigung in Wirbeltieren wird zentral von einer kleinen Untergruppe von Neuronen im Hypothalamus, die Gonadotropin-Releasing-Hormon (GnRH) ...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

Bedingte Genetische transsynaptische Tracing in der embryonalen Maus-Gehirn

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.6K Aufrufe.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

Serie: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Manual Drainage of the Zebrafish Embryonic Brain Ventricles

Cerebrospinal fluid (CSF) is a protein rich fluid contained within the brain ventricles. It is present during early vertebrate embryonic development and persists throughout life. Adult CSF is thought to cushion the brain, remove waste, and carry secreted molecules1,2. In the adult and older embryo, the majority of CSF is made by the choroid plexus, a series of highly vascularized secretory regions located adjacent to the brain ventricles3-5. In zebrafish, the choroid plexus is fully formed at 144 hours post fertilization (hpf)6. Prior to this, in both zebrafish and other vertebrate embryos including mouse, a significant amount of embryonic CSF (eCSF) is present . These data and studies in chick suggest that the neuroepithelium is secretory early in development and may be the major source of eCSF prior to choroid plexus development7.
eCSF contains about three times more protein than adult CSF, suggesting that it may have an important role during development8,9. Studies in chick and mouse demonstrate that secreted factors in the eCSF, fluid pressure, or a combination of these, are important for neurogenesis, gene expression, cell proliferation, and cell survival in the neuroepithelium10-20. Proteomic analyses of human, rat, mouse, and chick eCSF have identified many proteins that may be necessary for CSF function. These include extracellular matrix components, apolipoproteins, osmotic pressure regulating proteins, and proteins involved in cell death and proliferation21-24. However, the complex functions of the eCSF are largely unknown.
We have developed a method for removing eCSF from zebrafish brain ventricles, thus allowing for identification of eCSF components and for analysis of the eCSF requirement during development. Although more eCSF can be collected from other vertebrate systems with larger embryos, eCSF can be collected from the earliest stages of zebrafish development, and under genetic or environmental conditions that lead to abnormal brain ventricle volume or morphology. Removal and collection of eCSF allows for mass spectrometric analysis, investigation of eCSF function, and reintroduction of select factors into the ventricles to assay their function. Thus the accessibility of the early zebrafish embryo allows for detailed analysis of eCSF function during development.

We present a method to collect cerebrospinal fluid (CSF) and to create a system which lacks CSF within the embryonic zebrafish brain ventricular system. This allows for further examination of CSF composition and its requirement during embryonic brain development.

Manuelle Drainage der Zebrafisch Embryonale Hirnkammern

Cerebrospinal fluid  (CSF) is a protein rich fluid contained within the brain ventricles. It is  present during early vertebrate embryonic development and ...

Forschung

Neurowissenschaften

Selective Tracing of Auditory Fibers in the Avian Embryonic Vestibulocochlear Nerve

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling of auditory axons within the VIIIth cranial nerve would enhance the study of central auditory circuit development. This approach is challenging because multiple sensory organs of the inner ear contribute to the VIIIth nerve 1. Moreover, markers that reliably distinguish auditory versus vestibular groups of axons within the avian VIIIth nerve have yet to be identified. Auditory and vestibular pathways cannot be distinguished functionally in early embryos, as sensory-evoked responses are not present before the circuits are formed. Centrally projecting VIIIth nerve axons have been traced in some studies, but auditory axon labeling was accompanied by labeling from other VIIIth nerve components 2,3. Here, we describe a method for anterograde tracing from the acoustic ganglion to selectively label auditory axons within the developing VIIIth nerve. First, after partial dissection of the anterior cephalic region of an 8-day chick embryo immersed in oxygenated artificial cerebrospinal fluid, the cochlear duct is identified by anatomical landmarks. Next, a fine pulled glass micropipette is positioned to inject a small amount of rhodamine dextran amine into the duct and adjacent deep region where the acoustic ganglion cells are located. Within thirty minutes following the injection, auditory axons are traced centrally into the hindbrain and can later be visualized following histologic preparation. This method provides a useful tool for developmental studies of peripheral to central auditory circuit formation.

Here we describe a microdissection technique followed by fluorescent dye injection into the acoustic ganglion of early chick embryos for selective tracing of auditory axon fibers in the nerve and hindbrain.

Selektive Tracing von Auditory Fibers im Avian Embryonale vestibulocochlearis

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling ...

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Stereotaktische Injektion eines viralen Vektors für Conditional Gene Manipulation im Maus-Rückenmark

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

Angiogenesis is the complex process of new blood vessel formation defined by the sprouting of new blood vessels from a pre-existing vessel network. Angiogenesis plays a key role not only in normal development of organs and tissues, but also in many diseases in which blood vessel formation is dysregulated, such as cancer, blindness and ischemic diseases. In adult life, blood vessels are generally quiescent so angiogenesis is an important target for novel drug development to try and regulate new vessel formation specifically in disease. In order to better understand angiogenesis and to develop appropriate strategies to regulate it, models are required that accurately reflect the different biological steps that are involved. The mouse neonatal retina provides an excellent model of angiogenesis because arteries, veins and capillaries develop to form a vascular plexus during the first week after birth. This model also has the advantage of having a two-dimensional (2D) structure making analysis straightforward compared with the complex 3D anatomy of other vascular networks. By analyzing the retinal vascular plexus at different times after birth, it is possible to observe the various stages of angiogenesis under the microscope. This article demonstrates a straightforward procedure for analyzing the vasculature of a mouse retina using fluorescent staining with isolectin and vascular specific antibodies.

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

The neonatal murine retina provides a well characterized physiological model of angiogenesis, which permits investigations of the roles of different genes or drugs that modulate angiogenesis in an in vivo context. Immunofluorescent staining to accurately visualize the vascular plexus is pivotal to the success of these types of studies.

Ganze Berge Immunfluoreszenzfärbung der Neonatal Maus Retina zu untersuchen Angiogenese<em&gt; In vivo</em

Angiogenesis  is the complex process of new blood vessel formation defined by the sprouting  of new blood vessels from a pre-existing vessel network. ...

Transsynaptic Tracing from Peripheral Targets with Pseudorabies Virus Followed by Cholera Toxin and Biotinylated Dextran Amines Double Labeling

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This approach has been most extensively used in the brain by utilizing the swine pathogen pseudorabies virus (PRV)1. PRV does not infect great apes, including humans, so it is most commonly used in studies on small mammals, especially rodents. The pseudorabies strain PRV152 expresses the enhanced green fluorescent protein (eGFP) reporter gene and only crosses functional synapses retrogradely through the hierarchical sequence of synaptic connections away from the infection site2,3. Other PRV strains have distinct microbiological properties and may be transported in both directions (PRV-Becker and PRV-Kaplan)4,5&#160;.&#160;This protocol will deal exclusively with PRV152. By delivering the virus at a peripheral site, such as muscle, it is possible to limit the entry of the virus into the brain through a specific set of neurons. The resulting pattern of eGFP signal throughout the brain then resolves the neurons that are connected to the initially infected cells. As the distributed nature of transsynaptic tracing with pseudorabies virus makes interpreting specific connections within an identified network difficult, we present a sensitive and reliable method employing biotinylated dextran amines (BDA) and cholera toxin subunit b (CTb) for confirming the connections between cells identified using PRV152. Immunochemical detection of BDA and CTb with peroxidase and DAB (3, 3&#39;-diaminobenzidine) was chosen because they are effective at revealing cellular processes including distal dendrites6-11.

Transsynaptic tracing has become a powerful tool for analyzing central efferents regulating peripheral targets through multi-synaptic circuits. Here we present a protocol that exploits the transsynaptic pseudorabies virus to identify and localize a functional brain circuit, followed by classical tract tracing techniques to validate specific connections in the circuit between identified groups of neurons.

Transsynaptische Tracing von Peripherie Targets mit Pseudorabies-Virus durch Cholera Toxin und biotinyliertes Dextran Amine Doppelmarkierung Gefolgt

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Isolierung und Kultivierung von Endothelzellen aus dem embryonalen Vorderhirn

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow for an in-depth characterization to identify pathways involved in these events. Cerebellar granule neurons (CGNs) that are derived from the developing cerebellum are an ideal model system that allows for morphological analyses. Here, we describe a method of how to genetically manipulate CGNs and how to study axono- and dendritogenesis of individual neurons. With this method the effects of RNA interference, overexpression or small molecules can be compared to control neurons. In addition, the rodent cerebellar cortex is an easily accessible in vivo system owing to its predominant postnatal development. We also present an in vivo electroporation technique to genetically manipulate the developing cerebella and describe subsequent cerebellar analyses to assess neuronal morphology and migration.

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Neuronal morphogenesis and migration are crucial events underlying proper brain development. Here, we describe methods to genetically manipulate cultured cerebellar granule neurons and the developing cerebellum for the assessment of morphology and migratory characteristics of neurons.

Genetische Manipulation von Kleinhirnkörnerzellen<em&gt; In-vitro-</em&gt; Und<em&gt; In Vivo</em&gt;, Um neuronale Morphologie und Migration Studieren

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow ...

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this information to the brain. As such, determining how olfactory information is transferred to the brain, modifying both perception and behavior, merits investigation. Interestingly, there is emerging evidence that cellular transduction and transcriptional factors are involved in the diversification of olfactory receptor neuron. Here we provide a robust whole mount immunological labeling method to assay in vivo olfactory receptor neuron organization. Using this method, we identified all olfactory receptor neurons with anti-ELAV antibody, a known pan-neural marker and Or49a-mCD8::GFP, an olfactory receptor neuron specifically expressed in Nba neuron using anti-GFP antibody.

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Herein we describe the process of whole mount immunostaining of Drosophila antennae, which enables us to better understand the molecular mechanisms involved in the diversification of olfactory receptor neurons (ORN)s.

Ganze Berge Immunmarkierung der olfaktorischen Rezeptorneuronen in der<em&gt; Drosophila</em&gt; Antennen

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

Live-Imaging der Mitose in der Entwicklung von embryonalen Maus-Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the ...

Laser-guided Neuronal Tracing In Brain Explants

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake through electroporation in brain explants with targeted laser illumination and matching filter goggles during the procedure. The described technique of in vitro electroporation by itself yields relatively good visual control for targetting certain areas of the brain. By combining it with laser excitation of fluorescent genetic markers and their read-out through band-passing filter goggles, which can pick up the emissions of the genetically labeled cells/nuclei and the fluorescent tracing dye, a researcher can substantially increase the accuracy of injections by finding the area of interest and controlling for the dye-spread/uptake in the injection area much more efficiently. In addition, the laser illumination technique allows to study the functionality of a given neurocircuit by providing information about the type of neurons projecting to a certain area in cases where the GFP expression is linked to the type of transmitter expressed by a subpopulation of neurons.

We describe a technique to label neurons and their processes via anterograde or retrograde tracer injections into brain nuclei using an in vitro preparation. We modified an existing method of in vitro tracer electroporation by taking advantage of fluorescently labeled mouse mutants and basic optical equipment in order to increase labeling accuracy.

Lasergelenkte neuronale Tracing in Brain Explantate

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake ...