We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

NOTE: Éthique Déclaration: procédures impliquant des sujets animaux ont été approuvés par le comité de protection des animaux de l&#39;Université de Hambourg et l&#39;Université de la Sarre. 1. Préparation et fixation du tissu embryonnaire <ol><li> Disposer tout l&#39;équipement nécessaire pour disséquer les embryons et préparer des solutions pour la fixation ultérieure du tissu avant de sacrifier les animaux. REMARQUE: Toujours préparer une nouvelle paraformaldéhyde 4% (PFA) solution (PFA 4% dans 0,1 M de tampon phosphate salin (PBS), ajuster le pH à 7,4). </li><li> Euthanasier chronométré souris femelle enceinte avec une procédure éthique approuvé. </li><li> Transférer la souris sur une plate-forme. Mouiller la face ventrale de l&#39;abdomen avec 70% d&#39;éthanol et faire une incision verticale à l&#39;aide des ciseaux bien aiguisés pour exposer la cavité abdominale. </li><li> Identifier la chaîne embryonnaire et tirez-le soigneusement à l&#39;aide de pince émoussée et le placer dans PBS glacé. </li><li> Retirez les embryons individuels dela chaîne embryonnaire avec des ciseaux et des pinces fines. Retirer le tissu supplémentaire autour des embryons et les laver dans PBS glacé. </li><li> Prenez une petite queue biopsie (avant de transférer l&#39;embryon dans PFA) et incuber dans la queue du tampon de lyse pour l&#39;identification de genre et le traceur allèle génotypage PCR. </li><li> À partir de l&#39;embryon au côté le plus latérale et transférer chaque embryon séparément dans un tube contenant glacée PFA 4% sur de la glace sur un agitateur. </li><li> Faire tremper les embryons à l&#39;âge de E13.5 ou moins pendant 1,5 heure sur la glace avec une agitation constante. Faire tremper les embryons à E14,5 d&#39;âge et E15.5 pendant 2,5 heures sur la glace avec une agitation constante. </li><li> Pour E16,5 embryons d&#39;âge ou plus, décapiter et enlever la peau extérieure avant de tremper la tête dans une solution PFA. Chefs d&#39;embryons E16,5 peuvent être trempées pendant 4,5 heures sur la glace avec une agitation constante. </li><li> Après fixation échéant, laver les embryons trois fois avec PBS glacé. Transférer les embryons dans 30% de saccharose dans une solution PBS à 4 ° C jusqu&#39;à ce qu&#39;ils coulentvers le bas. </li></ol> 2. congélation <ol><li> Disposer tous les matériaux nécessaires avant de commencer le processus de congélation: cryo-moules, cryo-gants, pinces plume d&#39;entomologie, stylo marqueur et composés de température de coupe optimale (OCT) </li><li> Etiqueter le cryo-moule avec un marqueur résistant à l&#39;alcool permanent (mentionner l&#39;orientation du tissu, la date et le génotype). Préparer une bouillie de glace sèche pilée et 100% d&#39;éthanol dans un seau à glace. Placez un récipient en verre à l&#39;intérieur contenant isopentane. Attendez 10 min pour le isopentane refroidir. </li><li> Pendant ce temps retirer le tissu de la solution de saccharose, essuyer l&#39;excès de saccharose dans le tissu en utilisant des lingettes de laboratoire. Transférer le tissu dans un cryo-moule pré-étiquetés avec suffisamment octobre pour couvrir le tissu. Éviter les bulles d&#39;air dans les PTOM; en particulier autour du tissu. </li><li> Orientez le tissu dans l&#39;OCT aide d&#39;une pince d&#39;entomologie plume pour éviter des dommages aux tissus. Un début de congélation en transférant la cryo-moled dans le bain isopentane pré-refroidi. Ne pas éclabousser isopentane dans les PTOM comme il ne gèlera pas correctement. Envelopper les échantillons dans du papier d&#39;aluminium et conserver à -80 ° C. </li></ol> 3. Cryosectioning <ol><li> Couper 14 sections um série minces en série »de cinq utilisant un cryostat et de recueillir sur des lames de verre SuperFrost® Plus pour immunofluorescence (IF) analyse. Conserver les diapositives à -80 ° C jusqu&#39;à leur utilisation. </li></ol> 4. Tracer la visualisation Utilisation du (TSA) Protocole tyramide amplification du signal <ol><li> Préparer les tampons et les réactifs nécessaires pour la coloration. Toujours fraîchement préparer le tampon Tris-NaCl-Tween (TNT), le jour de l&#39;utilisation. <ol><li> Préparer du tampon TNT en utilisant 100 ml de 1 M Tris-HCl pH 7,5, 30 ml de NaCl 5 M et ddH 2 O jusqu&#39;à un volume final de 1 L. Ajouter 500 pi de Tween 20 en utilisant une pipette de 1 ml. Ajoutez le Tween 20 lentement et rincer la pipette de haut en bas à plusieurs reprises pour se assurer que tous Tween 20 est ensolution. </li><li> Préparez Tris-NaCl-blocage (TNB) tampon en utilisant 100 ml de 1 M Tris-HCl pH 7,5, 30 ml de NaCl 5 M et ddH 2 O jusqu&#39;à un volume final de 1 L. Ajouter 5 g de réactif de blocage (fourni avec le kit) lentement par petits incréments à la mémoire tampon, tout en agitant. Chauffer la solution progressivement à 55 ° C avec agitation continue pour dissoudre complètement le réactif de blocage (cela ne devrait pas prendre plus de 30 à 60 min). Pour obtenir un chauffage homogène utiliser un bain d&#39;eau à 55 ° C. La solution apparaît laiteux. Porter la solution à la température ambiante avant l&#39;utilisation. Aliquoter et conserver à -20 ° C pour le stockage à long terme. </li><li> Reconstituer la biotine réactif tyramide (fourni avec le kit) dans Molecular Biology / HPLC DMSO. En fonction du kit est utilisé, la quantité appropriée de DMSO peut varier. Conserver la solution d&#39;achat d&#39;actions à 4 ° C. NOTE: Les sections des animaux hétérozygotes pour les allèles CRE et R26 respectifs peuvent être utilisés pour l&#39;analyse des circuits. Utilisation sréflexions à partir de la même portée transportant une Cre ou un allèle R26, respectivement, comme témoins négatifs. Traiter lames de contrôle négatives exactement comme diapositives provenant d&#39;animaux doubles hétérozygotes. En outre, inclure une lame de contrôle d&#39;un animal à double hétérozygote mais laisse de côté le réactif TSA (contrôle non amplifiée). </li></ol></li><li> Avec un scalpel frais forte enlever l&#39;excès octobre entourant les coupes de tissu et marquer la frontière autour de sections avec un stylo de PAP. </li><li> Sécher les diapositives pendant 2-3 min à température ambiante (RT). Laver les lames à la température ambiante 3x avec TNT pendant 5 minutes chacun. Incuber les lames à la température ambiante pendant 30 minutes dans 0,3% de H 2 O 2 solution dans du methanol glacé à étancher activité de peroxydase endogène. </li><li> Laver 3x avec du PBS pendant 5 min chacun à RT. Incuber pendant 10 minutes dans 0,5% de Triton X-100 dans du PBS pendant perméabilisation des tissus. Laver les lames à la température ambiante 3x avec TNT pendant 5 minutes chacun. </li><li> Bloc avec TNB (solution de blocage, 200-300 pi par diapo) pour 30min à température ambiante dans une chambre humidifiée. Assurez-vous que toutes les sections sont complètement couverts par TNB. Ne laissez pas les diapositives sécher entre les étapes. </li><li> Égoutter l&#39;excès de tampon de blocage et d&#39;appliquer l&#39;antisérum primaire reconnaissant le traceur (1: 1000 de chèvre anti-WGA pour BL, 1: 15,000 de lapin anti-GFP pour GTT) dilué dans TNB pendant 2 heures à la température ambiante ou une nuit à 4 ° C. Veillez à utiliser un volume suffisant pour couvrir complètement la section de tissu (200-300 pi par diapositive). NOTE: Les dilutions d&#39;antisérums primaires recommandés ici peuvent être ajustés. </li><li> Laver les lames à la température ambiante 3x avec TNT pendant 5 min chacun avec agitation. </li><li> Incuber les sections avec un antisérum biotinylé secondaire reconnaissant l&#39;hôte du premier antisérum (1: 500 cheval anti-IgG de chèvre anti-WGA, 1: 5000 de chèvre anti-IgG de lapin anti-GFP dans TNB pendant 1 heure à température ambiante). </li><li> Laver 3x avec TNT à température ambiante pendant 5 min chacun avec agitation. Incuber dans 1: 100 streptavidine (SA) conjugué à la peroxydase de raifort (SA-HRP, à condition with le kit) dans TNB pendant 30 min à température ambiante dans une chambre humidifiée. Laver les lames à la température ambiante 3x avec TNT pendant 5 minutes chacun. Pendant ce temps dégeler la TSA. </li><li> Diluer TSA 01h50 dans le CST amplification diluant (fourni avec le kit; utiliser le kit TSA pour la visualisation de BL et le kit TSA + pour GTT). Incuber les coupes de tissus dans dilué TSA précisément pour 10 min à température ambiante. Diluer TSA juste avant l&#39;utilisation, idéalement au cours de l&#39;étape de lavage précédente, ne pas utiliser de réactif dilué TSA restant pour de futures expériences; toujours se préparer frais. </li><li> Laver les lames à la température ambiante 3x avec TNT pendant 5 min chacun avec agitation. Incuber à 1: 500 Alexa Fluor® 546 de la streptavidine conjugué à TNB pendant 30 min à température ambiante. Laver les lames à la température ambiante 3x avec TNT pendant 5 min chacun avec agitation. </li><li> Incuber pendant 10 min dans une solution bisbenzimide 5% dans du PBS à température ambiante pendant une coloration nucléaire. Laver les lames à la température ambiante 3x avec TNT pendant 5 min chacun avec agitation. Montez avec Fluromount G et effectuer épifluorescence ou microscopie confocale. <em&gt; Dépannage: Efficacité de transfert de traceur dépendra du niveau du locus ROSA26 dans les cellules productrices (déterminée par la ligne du pilote Cre utilisé) d&#39;expression et sur ​​le circuit neuronal analysé (par exemple nombre de neurones produisant le traceur, la convergence etc.). Par conséquent, les dilutions de antisérums primaires recommandés ici peuvent être ajustés pour empêcher signal basse ou d&#39;excès. Le fond doit toujours être analysé en utilisant des lames de contrôle appropriées (voir ci-dessus). </li></ol> 5. τlacZ coloration pour les sections embryonnaires <ol><li> Préparer les tampons et les réactifs nécessaires pour la coloration. Toujours fraîchement préparer le tampon LacZ C avant utilisation. <ol><li> Préparation de 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) de solution stock (40 mg / ml) en ajoutant 40 g de X-gal à 1 ml de 70% de diméthylformamide (DMF). Couvrir de papier d&#39;aluminium et conserver à -20 ° C pour le stockage à long terme. </li><li> Préparer nitro bleu de tétrazolium (NBT) stock solution (50 mg / ml) en ajoutant 50 g de NBT à 1 ml de 70% de DMF. Couvrir de papier d&#39;aluminium et conserver à -20 ° C pour le stockage à long terme. </li><li> Préparez LacZ fixateur en utilisant 80 ul de glutaraldéhyde à 25%, 5 ml de PFA 4%, 20 pl de 1 M de MgCl2, 100 ul de 500 mM d&#39;EGTA, 1 ml de 1 M de tampon phosphate pH 7,4 et ddH 2 O jusqu&#39;à une finale volume de 10 ml. </li><li> Préparez LacZ en utilisant le tampon A 1 ml de 1 M de MgCl2, 5 ml de 500 mM d&#39;EGTA, 50 ml de 1 M de tampon phosphate pH 7,4 et ddH 2 O jusqu&#39;à un volume final de 500 ml. </li><li> Préparer LacZ tampon B en utilisant 1 ml de 1 M de MgCl2, 5 ml d&#39;mM d&#39;EGTA 500, 5 ml de 1% de désoxycholate de sodium, 100 ml de 10% de NP-40, 50 ml de 1 M de tampon phosphate pH 7,4 et ddH 2 O jusqu&#39;à un volume final de 500 ml. </li><li> Préparer LacZ tampon C en ajoutant 10 pi de NBT solution stock et 12,5 pi de X-gal solution stock à 1 ml de tampon B. Faire LacZ frais juste avant utilisation et couvrir de papier d&#39;aluminium. </li></ol&gt; </li><li> Sécher les lames à la température ambiante au moins pendant 10-15 min (temps préparer les diapositives avec un stylo PAP). </li><li> Fixer la section avec LacZ fixateur pendant 2 min à température ambiante dans une chambre humidifiée à l&#39;intérieur un produit chimique hotte aspirante. Laver 3 fois avec du PBS supplémenté avec 2 mM de MgCl2. </li><li> Rincer les lames avec LacZ tampon A. laver les lames avec LacZ tampon A 3 fois pendant 10 min chacune à la température ambiante. Laver deux fois avec LacZ tampon B pendant 5 minutes chacun. Incuber les lames dans LacZ tampon C à 30-37 ° C pendant 6 heures ou toute la nuit dans une chambre humidifiée. NOTE: Ajouter un volume suffisant de LacZ tampon C; diapositives ne doivent pas sécher pendant l&#39;incubation. </li><li> Après une incubation appropriée laver les lames avec du PBS additionné MgCl2 2 mM. Rincer les sections brièvement avec ddH 2 O. Lamelle avec la glycine de la gélatine de Mayer. Convient pour un microscope optique équipé d&#39;un contraste d&#39;interférence différentiel (DIC) imagerie set-up. </li></ol> 6. Gender et Tracer génotypage <ol><li> Préparer du tampon de lyse de queue en utilisant 1 ml de 1 M Tris-HCl pH 8,5, 100 ul d&#39;mM d&#39;EGTA 500, 200 ul de SDS à 10%, 400 ul de NaCl 5 M et ddH 2 O pour obtenir un volume final de 10 ml. </li><li> Ajouter 500 pi de tampon de lyse queue à chaque tube Eppendorf contenant une biopsie de la queue. Ajouter la proteinase K à une concentration finale de 100 mg / ml. Incuber une nuit sur un agitateur à 55 ° C. </li><li> Centrifuger les échantillons à 17 000 g pendant 10 min à température ambiante. Transférer le surnageant dans un nouveau tube de centrifugation. Ajouter 500 ul d&#39;isopropanol au surnageant. Mélanger pendant au moins 5 minutes en inversant les tubes de haut en bas. </li><li> Spin dans la centrifugeuse à 17 000 g pendant 5 min à température ambiante. Verser le surnageant. Ajouter 200 ul d&#39;éthanol à 70%. Agiter pendant au moins 5 min. </li><li> Centrifuger à 17 000 g pendant 5 min. Retirer le surnageant avec un Pipetman (ne pas verser off). Sécher la pastille dans une chambre chaude (37 ° C) pendant 15 à 30 min. </li><li> Resuspendre le culot dans 100 pifaible pH 8,0 TE ou de l&#39;eau à l&#39;aide des conseils de gros calibre filtré. Mettre en 55 ° C pendant 1 h et à 37 ° C pendant la nuit pour une bonne dissolution. Conserver à 4 ° C. </li><li> Utiliser une pi d&#39;ADN pour la réaction PCR (mélange réactionnel de 50 pi contenant 1 pi de l&#39;ADN de queue, 2,5 pi de DMSO, 22 heures de chaque amorce, 25 uM de chaque dNTP et 1 M de bétaïne). Amorces de PCR pour le génotypage et l&#39;identification de genre sont énumérés dans le tableau des matériaux. </li></ol>

<ol>
	<li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals.">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li><li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+approaches+to+neural+circuits+in+the+mouse.">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li><li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+half+century+of+experimental+neuroanatomical+tracing.">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li><li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus.">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li><li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero.">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li><li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+approach+to+trace+neural+circuits.">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li><li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice.">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li><li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54.">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li><li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GPR54+gene+as+a+regulator+of+puberty.">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li><li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons.">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li><li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice.">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67 (2005).</li><li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene.">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li><li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-activated+site-specific+recombination+in+mice.">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li></ol>

No conflict of interest declared.

Exprimant traceurs transsynaptique comme transgènes pour tracer les circuits neuronaux de populations neuronales génétiquement définies présente plusieurs avantages par rapport à l&#39;injection stéréotaxique de traceurs ou des virus neurotopic. Tout d&#39;abord, le traceur est produit comme une protéine endogène et donc ne provoque pas de réponse immunitaire et une voie neuronale sélective peut être analysé en différents animaux avec une reproductibilité élevée. Deuxièmement, parce que ce est un proc...

Chemin tracé anatomique est l&#39;un des outils les plus couramment utilisés pour déchiffrer la relation entre le cerveau et le comportement 1. Progrès dans les technologies de circuits neuronaux traçage a accordé neuroscientifiques avec la capacité de retracer les circuits neuronaux de populations de neurones génétiquement identifiés chez la souris deux. En dépit de ces progrès techniques, il reste difficile de démêler la formation des circuits neuronaux en particulier pendant la maturation embryonnaire. Ce est parce que la plupart des méthodes de traçage développées à ce jour sont basées sur l&#39;injection de traceurs transsynaptique stéréotaxique ou des virus neurotropes génétiquement modifiés (Figure 1) 2,3. Bien que ces techniques d&#39;atteindre la résolution spatiale et temporelle de la connectivité, plusieurs limitations inhérentes telles que les injections traçantes techniquement difficiles dans le cerveau en développement, la reproductibilité du point d&#39;injection, inflammation au potentiel du point d&#39;injection et le plus imporcytotoxicité tantly causée par des virus neurotropes limiter leur utilisation 4. Une méthode alternative consiste à exprimer que les traceurs transsynaptique transgènes dans des souris génétiquement modifiées. Nous avons récemment modifié cette technique et développé un système binaire de transsynaptique génétique traçage de cartographier les circuits neuronaux de toute population neuronale génétiquement identifié cinq. Notre stratégie expérimentale est basée sur deux nouvelles souches de souris knock-in, qui expriment soit la bidirectionnel traceur orge lectine (BL) 6 ou le traceur rétrograde toxine tétanique fragment C fusionnée à la GFP (GTT) 7 à partir du locus ROSA 26 après à médiation par Cre recombinaison. Ici, nous avons utilisé ces souches de souris pour exprimer sélectivement et BL GTT dans les neurones qui produisent kisspeptin, un neuropeptide qui est impliquée dans la régulation de la maturation de l&#39;axe de reproduction 8,9. Nous démontrons que cette technique est apte à visualiser le développement et la maturation des bisoucircuits neuronaux peptine pendant le développement embryonnaire du cerveau de la souris femelle 5. Stratégie d&#39;élevage Le R26-BL-IRES-τlacZ (BIZ) et les R26-GFP-TTC (GTT) lignes de traçage sont knock-in 5 souches qui portent allèles ROSA26 recombinantes. La R26-BIZ et les allèles R26-GTT sont transcriptionnellement silencieux en raison de la présence d&#39;un signal d&#39;arrêt de transcription fort, qui est flanquée par deux sites loxP 5. L&#39;expression du transgène et BIZ GTT est activé par l&#39;élimination médiée par Cre du signal d&#39;arrêt de la transcription. Les allèles R26 et R26-BIZ-GTT peuvent être utilisés indépendamment par simple croisement avec une ligne de pilote Cre. Pour les animaux d&#39;analyse hétérozygotes pour les allèles Cre et R26 respectifs peuvent être utilisés. Chiens d&#39;un souche portant un allèle Cre ou une R26, respectivement, devraient être utilisés comme témoins. En variante, il est également possible de générer des triple knock-in animaux porteurs des allèles Cre, R26 et R26-BIZ-GTT, mais cela nécessitera une croix supplémentaire.

<table border="0" cellpadding="0" cellspacing="0" width="721">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:219px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bisbenzimide (Hoechst 33258 dye)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">14530-100MG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">32205-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryo mold (Peel-a-way)</td>
			<td style="width:219px;">Polyscience Inc.</td>
			<td style="width:119px;">18646A-1</td>
			<td>22mm x 22mm x 20mm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DMSO</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D8418-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Dimethyl Formamide (DMF)</td>
			<td style="width:219px;">VWR Chemicals</td>
			<td style="width:119px;">23470,293</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EGTA</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3054.3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fluoromount G</td>
			<td style="width:219px;">Southern Biotech</td>
			<td style="width:119px;">0100-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glutaraldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">G5882-50ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hydrogen peroxide</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">34988-7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Isopentane (Methyl 2-butane)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">M32631-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kaiser&#39;s Glycine gelatin</td>
			<td style="width:219px;">Merck</td>
			<td style="width:119px;">1092420100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Methanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">494437-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">MgCl2</td>
			<td style="width:219px;">Sigma</td>
			<td>M2670-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NaCl</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">HN00.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NBT</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">298-83-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Nonidet P40 substitute</td>
			<td style="width:219px;">Fluka</td>
			<td style="width:119px;">743.85</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">OCT</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">14020108926</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PAP pen</td>
			<td style="width:219px;">Dako</td>
			<td style="width:119px;">S2002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Parafarmaldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">P6148-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium deoxycholate</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D6750-25G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sucrose</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">S7903-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Superfrost slides</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">FT4981GLPLUS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL700</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA plus kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL749A001KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">AE15.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Triton-X 100</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3051.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tween 20</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">9127.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">X-gal</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">2315.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryostat</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">na</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Light microscope equipped with DIC imaging&#160;</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Fluroscence microscope</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Photoshop</td>
			<td style="width:219px;">Adobe</td>
			<td style="width:119px;">PS6</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Goat anti-WGA (recognizes BL)</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">AS-2024</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylayted horse anti-goat IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-9500&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated goat anti-rabbit IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-1000&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Rabbit anti-GFP (recognizes GTT)</td>
			<td style="width:219px;">Invitrogen</td>
			<td style="width:119px;">A11122</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rabbit anti-GnRH</td>
			<td style="width:219px;">Affinity Bio Reagent</td>
			<td style="width:119px;">PA1-121</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dylight488-donkey anti-rabbit IgG</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">SA5-10038</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SA-Alexa Fluor 546</td>
			<td style="width:219px;">Life Technologies</td>
			<td>S-11225</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Primers</td>
			<td style="width:219px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Fwd (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;ATGAAGATGATGAGCACCAG 
			GGC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Rev&#160; (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;AGCCCTCGCCGCAGAACTC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Fwd&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCGATGCAACGAGTGATGAG 
			GTTCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Rev&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCAGGCTAAGTGCCTTCTCTAC 
			ACCTGC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Fwd&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">AGCAAGGGCGAGGAGCTGTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Rev&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCTTGTAGTTGCCGTCGTCCT 
			TGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Fwd (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">TGAAGCTTTTGGCTTTGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Rev&#160; (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCGCTGCCAAATTCTTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ROSA26 Fwd</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">ROSA26 Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">GCAGATGGAGCGGGAGAAAT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">SA Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
	</tbody>
</table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

Cette section montre des résultats représentatifs qui peuvent être obtenus en collaboration avec le R26-BIZ (B L I RES-τlac Z) et la R26-GTT (G FP TT C) allèles. Ici, nous utilisons la R26-BIZ et les allèles R26-GTT pour analyser la maturation des circuits neuronaux qui régissent l&#39;axe de la reproduction. Reproduction chez les vertébrés est centralisé par un petit sous-ensemble de neurones dans l&#39;hypothalamus, qui sécrètent l&#39;hormone...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

Transsynaptique génétique conditionnelle traçage dans le cerveau embryonnaire de souris

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.6K vues.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

Vidéo: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Manual Drainage of the Zebrafish Embryonic Brain Ventricles

Cerebrospinal fluid (CSF) is a protein rich fluid contained within the brain ventricles. It is present during early vertebrate embryonic development and persists throughout life. Adult CSF is thought to cushion the brain, remove waste, and carry secreted molecules1,2. In the adult and older embryo, the majority of CSF is made by the choroid plexus, a series of highly vascularized secretory regions located adjacent to the brain ventricles3-5. In zebrafish, the choroid plexus is fully formed at 144 hours post fertilization (hpf)6. Prior to this, in both zebrafish and other vertebrate embryos including mouse, a significant amount of embryonic CSF (eCSF) is present . These data and studies in chick suggest that the neuroepithelium is secretory early in development and may be the major source of eCSF prior to choroid plexus development7.
eCSF contains about three times more protein than adult CSF, suggesting that it may have an important role during development8,9. Studies in chick and mouse demonstrate that secreted factors in the eCSF, fluid pressure, or a combination of these, are important for neurogenesis, gene expression, cell proliferation, and cell survival in the neuroepithelium10-20. Proteomic analyses of human, rat, mouse, and chick eCSF have identified many proteins that may be necessary for CSF function. These include extracellular matrix components, apolipoproteins, osmotic pressure regulating proteins, and proteins involved in cell death and proliferation21-24. However, the complex functions of the eCSF are largely unknown.
We have developed a method for removing eCSF from zebrafish brain ventricles, thus allowing for identification of eCSF components and for analysis of the eCSF requirement during development. Although more eCSF can be collected from other vertebrate systems with larger embryos, eCSF can be collected from the earliest stages of zebrafish development, and under genetic or environmental conditions that lead to abnormal brain ventricle volume or morphology. Removal and collection of eCSF allows for mass spectrometric analysis, investigation of eCSF function, and reintroduction of select factors into the ventricles to assay their function. Thus the accessibility of the early zebrafish embryo allows for detailed analysis of eCSF function during development.

We present a method to collect cerebrospinal fluid (CSF) and to create a system which lacks CSF within the embryonic zebrafish brain ventricular system. This allows for further examination of CSF composition and its requirement during embryonic brain development.

Drainage Manuel des ventricules cérébraux embryonnaires de poisson-zèbre

Cerebrospinal fluid  (CSF) is a protein rich fluid contained within the brain ventricles. It is  present during early vertebrate embryonic development and ...

Recherche

Neurosciences

Selective Tracing of Auditory Fibers in the Avian Embryonic Vestibulocochlear Nerve

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling of auditory axons within the VIIIth cranial nerve would enhance the study of central auditory circuit development. This approach is challenging because multiple sensory organs of the inner ear contribute to the VIIIth nerve 1. Moreover, markers that reliably distinguish auditory versus vestibular groups of axons within the avian VIIIth nerve have yet to be identified. Auditory and vestibular pathways cannot be distinguished functionally in early embryos, as sensory-evoked responses are not present before the circuits are formed. Centrally projecting VIIIth nerve axons have been traced in some studies, but auditory axon labeling was accompanied by labeling from other VIIIth nerve components 2,3. Here, we describe a method for anterograde tracing from the acoustic ganglion to selectively label auditory axons within the developing VIIIth nerve. First, after partial dissection of the anterior cephalic region of an 8-day chick embryo immersed in oxygenated artificial cerebrospinal fluid, the cochlear duct is identified by anatomical landmarks. Next, a fine pulled glass micropipette is positioned to inject a small amount of rhodamine dextran amine into the duct and adjacent deep region where the acoustic ganglion cells are located. Within thirty minutes following the injection, auditory axons are traced centrally into the hindbrain and can later be visualized following histologic preparation. This method provides a useful tool for developmental studies of peripheral to central auditory circuit formation.

Here we describe a microdissection technique followed by fluorescent dye injection into the acoustic ganglion of early chick embryos for selective tracing of auditory axon fibers in the nerve and hindbrain.

Sélective traçage des fibres auditives dans le nerf vestibulo-cochléaire aviaire embryonnaire

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling ...

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Injection stéréotaxique d&#39;un vecteur viral pour la manipulation génétique conditionnelle dans la moelle épinière de souris

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

Angiogenesis is the complex process of new blood vessel formation defined by the sprouting of new blood vessels from a pre-existing vessel network. Angiogenesis plays a key role not only in normal development of organs and tissues, but also in many diseases in which blood vessel formation is dysregulated, such as cancer, blindness and ischemic diseases. In adult life, blood vessels are generally quiescent so angiogenesis is an important target for novel drug development to try and regulate new vessel formation specifically in disease. In order to better understand angiogenesis and to develop appropriate strategies to regulate it, models are required that accurately reflect the different biological steps that are involved. The mouse neonatal retina provides an excellent model of angiogenesis because arteries, veins and capillaries develop to form a vascular plexus during the first week after birth. This model also has the advantage of having a two-dimensional (2D) structure making analysis straightforward compared with the complex 3D anatomy of other vascular networks. By analyzing the retinal vascular plexus at different times after birth, it is possible to observe the various stages of angiogenesis under the microscope. This article demonstrates a straightforward procedure for analyzing the vasculature of a mouse retina using fluorescent staining with isolectin and vascular specific antibodies.

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

The neonatal murine retina provides a well characterized physiological model of angiogenesis, which permits investigations of the roles of different genes or drugs that modulate angiogenesis in an in vivo context. Immunofluorescent staining to accurately visualize the vascular plexus is pivotal to the success of these types of studies.

Mont entiers immunofluorescence de la rétine de souris néonatal chargé d&#39;enquêter sur l&#39;angiogenèse<em&gt; In vivo</em

Angiogenesis  is the complex process of new blood vessel formation defined by the sprouting  of new blood vessels from a pre-existing vessel network. ...

Transsynaptic Tracing from Peripheral Targets with Pseudorabies Virus Followed by Cholera Toxin and Biotinylated Dextran Amines Double Labeling

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This approach has been most extensively used in the brain by utilizing the swine pathogen pseudorabies virus (PRV)1. PRV does not infect great apes, including humans, so it is most commonly used in studies on small mammals, especially rodents. The pseudorabies strain PRV152 expresses the enhanced green fluorescent protein (eGFP) reporter gene and only crosses functional synapses retrogradely through the hierarchical sequence of synaptic connections away from the infection site2,3. Other PRV strains have distinct microbiological properties and may be transported in both directions (PRV-Becker and PRV-Kaplan)4,5&#160;.&#160;This protocol will deal exclusively with PRV152. By delivering the virus at a peripheral site, such as muscle, it is possible to limit the entry of the virus into the brain through a specific set of neurons. The resulting pattern of eGFP signal throughout the brain then resolves the neurons that are connected to the initially infected cells. As the distributed nature of transsynaptic tracing with pseudorabies virus makes interpreting specific connections within an identified network difficult, we present a sensitive and reliable method employing biotinylated dextran amines (BDA) and cholera toxin subunit b (CTb) for confirming the connections between cells identified using PRV152. Immunochemical detection of BDA and CTb with peroxidase and DAB (3, 3&#39;-diaminobenzidine) was chosen because they are effective at revealing cellular processes including distal dendrites6-11.

Transsynaptic tracing has become a powerful tool for analyzing central efferents regulating peripheral targets through multi-synaptic circuits. Here we present a protocol that exploits the transsynaptic pseudorabies virus to identify and localize a functional brain circuit, followed by classical tract tracing techniques to validate specific connections in the circuit between identified groups of neurons.

Transsynaptique Tracing de cibles périphériques avec virus de la pseudo Suivi par la toxine cholérique et biotinylé Dextran Amines double marquage

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Isolement et culture de cellules endothéliales de la embryonnaire du cerveau antérieur

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow for an in-depth characterization to identify pathways involved in these events. Cerebellar granule neurons (CGNs) that are derived from the developing cerebellum are an ideal model system that allows for morphological analyses. Here, we describe a method of how to genetically manipulate CGNs and how to study axono- and dendritogenesis of individual neurons. With this method the effects of RNA interference, overexpression or small molecules can be compared to control neurons. In addition, the rodent cerebellar cortex is an easily accessible in vivo system owing to its predominant postnatal development. We also present an in vivo electroporation technique to genetically manipulate the developing cerebella and describe subsequent cerebellar analyses to assess neuronal morphology and migration.

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Neuronal morphogenesis and migration are crucial events underlying proper brain development. Here, we describe methods to genetically manipulate cultured cerebellar granule neurons and the developing cerebellum for the assessment of morphology and migratory characteristics of neurons.

Manipulation génétique des neurones du cervelet granules<em&gt; In Vitro</em&gt; Et<em&gt; In Vivo</em&gt; À étudier neuronale Morphologie et migration

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow ...

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this information to the brain. As such, determining how olfactory information is transferred to the brain, modifying both perception and behavior, merits investigation. Interestingly, there is emerging evidence that cellular transduction and transcriptional factors are involved in the diversification of olfactory receptor neuron. Here we provide a robust whole mount immunological labeling method to assay in vivo olfactory receptor neuron organization. Using this method, we identified all olfactory receptor neurons with anti-ELAV antibody, a known pan-neural marker and Or49a-mCD8::GFP, an olfactory receptor neuron specifically expressed in Nba neuron using anti-GFP antibody.

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Herein we describe the process of whole mount immunostaining of Drosophila antennae, which enables us to better understand the molecular mechanisms involved in the diversification of olfactory receptor neurons (ORN)s.

Tout le mont immunomarquage des récepteurs olfactifs neurones dans le<em&gt; Drosophila</em&gt; Antenne

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

Imagerie en direct de la mitose dans les développement Cortex souris embryonnaires

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the ...

Laser-guided Neuronal Tracing In Brain Explants

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake through electroporation in brain explants with targeted laser illumination and matching filter goggles during the procedure. The described technique of in vitro electroporation by itself yields relatively good visual control for targetting certain areas of the brain. By combining it with laser excitation of fluorescent genetic markers and their read-out through band-passing filter goggles, which can pick up the emissions of the genetically labeled cells/nuclei and the fluorescent tracing dye, a researcher can substantially increase the accuracy of injections by finding the area of interest and controlling for the dye-spread/uptake in the injection area much more efficiently. In addition, the laser illumination technique allows to study the functionality of a given neurocircuit by providing information about the type of neurons projecting to a certain area in cases where the GFP expression is linked to the type of transmitter expressed by a subpopulation of neurons.

We describe a technique to label neurons and their processes via anterograde or retrograde tracer injections into brain nuclei using an in vitro preparation. We modified an existing method of in vitro tracer electroporation by taking advantage of fluorescently labeled mouse mutants and basic optical equipment in order to increase labeling accuracy.

Neuronal Tracing dans des explants de cerveau à guidage laser

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake ...