We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

NOTA: Ética Declaração: os procedimentos de indivíduos animais foram aprovados pelo comitê de bem-estar dos animais, da Universidade de Hamburgo e da Universidade de Saarland. 1. Preparação e fixação de tecido embrionário <ol><li> Organizar todos os equipamentos necessários para dissecar os embriões e preparar soluções para posterior fixação do tecido antes de sacrificar os animais. NOTA: Sempre preparar uma nova solução de 4% de paraformaldeído (PFA) (PFA a 4% em 0,1 M de solução salina de fosfato tamponada (PBS), pH ajustado a 7,4). </li><li> Eutanásia cronometrado rato fêmea grávida de um procedimento eticamente aprovado. </li><li> Transferir o rato sobre uma plataforma. Molhe o lado ventral do abdômen com etanol 70% e fazer uma incisão vertical usando uma tesoura afiada para expor a cavidade abdominal. </li><li> Identificar a cadeia embrionário e retire-o com cuidado, usando uma pinça sem corte e colocá-lo em PBS gelado. </li><li> Remover os embriões individuaisa cadeia embrionárias usando uma tesoura fina e fórceps. Remover tecido extra em torno dos embriões e lave-os em PBS gelado. </li><li> Pegue uma pequena biópsia de cauda (antes da transferência do embrião para PFA) e incubar-lo em tampão de lise da cauda para a identificação de gênero e alelo tracer genotipagem PCR. </li><li> Iniciar a partir do embrião no lado mais lateral e transferir cada embrião separadamente para um tubo arrefecido com gelo contendo PFA a 4% em gelo num agitador. </li><li> Embeber os embriões com a idade de E13.5 ou menos durante 1,5 horas em gelo com agitação constante. Mergulhe os embriões na E14.5 idade e E15.5 durante 2,5 horas em gelo com agitação constante. </li><li> Para E16.5 embriões idade ou mais, decapitar e remova a pele exterior antes de mergulhar a cabeça em solução PFA. Chefes de embriões E16.5 pode ser embebido durante 4,5 horas em gelo com agitação constante. </li><li> Após a fixação adequada, lavar os embriões três vezes com PBS gelado. Transferir os embriões em sacarose a 30% em solução de PBS a 4 ° C até se afundempara a parte inferior. </li></ol> 2. Congelamento <ol><li> Organizar todos os materiais necessários antes de iniciar o processo de congelamento: crio-mofo, crio-luvas, pinças pluma entomologia, caneta marcador e corte ideal compostos temperatura (OCT) </li><li> Rotular o crio-molde com um marcador permanente resistente ao álcool (mencionar a orientação do tecido, da data e do genótipo). Prepare uma lama de gelo seco moído e 100% de etanol em um balde de gelo. Coloque um copo de vidro no interior contendo isopentano. Aguarde 10 minutos para o isopentano para esfriar. </li><li> Enquanto isso, remover o tecido a partir da solução de sacarose, limpe o excesso de sacarose em torno do tecido usando lenços de laboratório. Transferir o tecido em um pré-rotulados crio-molde com suficiente OCT para cobrir o tecido. Evite as bolhas de ar no PTU; especialmente em torno do tecido. </li><li> Orientar o tecido em outubro com a pinça entomologia pluma para evitar danos aos tecidos. Comece congelamento transferindo o crio-mold para o banho isopentano pré-resfriada. Não salpique isopentano na outubro, pois não irá congelar corretamente. Enrole as amostras em folha de alumínio e armazenar a -80 ° C. </li></ol> 3. cryosectioning <ol><li> Cortar 14 mm cortes seriados finos em série de cinco usando um criostato e recolher em lâminas de vidro SuperFrost® Plus para análise de imunofluorescência (IF). Armazenar as lâminas a -80 ° C até ser utilizado. </li></ol> 4. Usando a visualização Tracer (TSA) Protocolo Tyramide Signal Amplification <ol><li> Prepare os tampões e reagentes necessários para a coloração. Sempre recentemente preparar o tampão Tris-NaCl-Tween (TNT) no dia da utilização. <ol><li> Preparar tampão TNT usando 100 ml de 1 M de Tris-HCl pH 7,5, 30 ml de NaCl 5 M e ddH2O até ao volume final de 1 L. Adicionar 500 ul de Tween 20 utilizando uma pipeta de 1 ml. Adicionar lentamente o Tween 20 e lave a pipeta para cima e para baixo várias vezes para assegurar que todo o Tween 20 é emsolução. </li><li> Prepare Tris-NaCl-tampão de bloqueio (TNB) usando 100 ml de 1 M de Tris-HCl pH 7,5, 30 ml de NaCl 5 M e ddH2O até ao volume final de 1 L. Adicionar 5 g de reagente bloqueador (fornecida com o Kit) lentamente em pequenos incrementos para o buffer enquanto se agitava. Aquece-se a solução gradualmente até 55 ° C com agitação contínua, para dissolver completamente o reagente de bloqueio (o que não deveria demorar mais de 30-60 minutos). Para atingir o aquecimento homogéneo utilizar um banho de água a 55 ° C. A solução aparece leitoso. Levar a solução à temperatura ambiente antes de usar. Alíquotas e armazenar a -20 ° C para armazenamento a longo prazo. </li><li> Reconstituir biotina reagente de tiramida (fornecido com o kit) em Biologia Molecular / DMSO de grau HPLC. Consoante o kit é utilizado a quantidade apropriada de DMSO pode variar. Guardar a solução estoque a 4 ° C. NOTA: Os cortes de animais heterozigotos para os respectivos alelos Cre e R26 pode ser usado para análise de circuitos. Use sexões de ninhada que transportam uma Cre ou um alelo R26, respectivamente, como controles negativos. Trate lâminas de controlo negativas exatamente como slides de animais heterozigotos duplas. Além disso, incluem uma lâmina de controlo de um animal heterozigoto duplo, mas deixar de fora o reagente TSA (controlo sem amplificação). </li></ol></li><li> Usando um bisturi afiado fresco remover o excesso de outubro em torno das secções de tecido e marcar o limite em torno das secções com uma caneta PAP. </li><li> Secam-se as lâminas durante 2-3 minutos à temperatura ambiente (TA). Lavar as lâminas em RT 3x com TNT para 5 min cada. Incubar as lâminas à temperatura ambiente durante 30 min em 0,3% de H 2 O 2 em solução de metanol arrefecido em gelo para extinguir a actividade da peroxidase endógena. </li><li> Lavar 3x com PBS durante 5 minutos cada à temperatura ambiente. Incubar durante 10 min em 0,5% de Triton X-100 em PBS durante a permeabilização dos tecidos. Lavar as lâminas em RT 3x com TNT para 5 min cada. </li><li> Bloco com TNB (solução de bloqueio, 200-300 mL por lâmina) para 30min à temperatura ambiente numa câmara humidificada. Certifique-se de todas as seções são completamente cobertas por TNB. Não deixe que as lâminas secar entre as etapas. </li><li> Drenar o excesso de tampão de bloqueio e aplicar o anti-soro primário que reconhece o marcador (1: 1000 de cabra anti-WGA por BL, 1: 15.000 de coelho anti-GFP para GTT) diluído em TNB durante 2 horas à temperatura ambiente ou durante a noite a 4 ° C. Certifique-se de usar um volume suficiente para cobrir totalmente a secção de tecido (200-300 mL por lâmina). NOTA: As diluições anti-soros primários recomendadas aqui pode ter de ser ajustada. </li><li> Lavar as lâminas em RT 3x com TNT para 5 min cada um com agitação. </li><li> Incubar as secções com soro secundário biotinilado reconhecem o anfitrião do primeiro anti-soro (1: 500 cavalo IgG anti-cabra para anti-WGA, 1: 5.000 de cabra anti-IgG de coelho para o anti-GFP em TNB durante 1 hora a RT). </li><li> Lavar 3x com TNT à temperatura ambiente durante 5 min cada, com agitação. Incubar em 1: 100 estreptavidina (SA) conjugado a peroxidase de rábano (SA-HRP, wi fornecidath o kit) em TNB durante 30 min à temperatura ambiente numa câmara humidificada. Lavar as lâminas em RT 3x com TNT para 5 min cada. Enquanto isso descongelar a TSA. </li><li> Diluir 1:50 em TSA TSA diluente amplificação (fornecido com o kit, use o kit TSA para a visualização de BL e o kit de TSA + por GTT). Incubam-se as secções de tecido em TSA diluído para precisamente 10 min à temperatura ambiente. Diluir TSA imediatamente antes da utilização, de preferência durante a etapa de lavagem anterior, não use qualquer restante reagente TSA diluída para experiências futuras; elaborar sempre fresco. </li><li> Lavar as lâminas em RT 3x com TNT para 5 min cada um com agitação. Incubar com 1: 500 de Alexa Fluor ® 546 em TNB estreptavidina conjugada durante 30 min à TA. Lavar as lâminas em RT 3x com TNT para 5 min cada um com agitação. </li><li> Incubar durante 10 min em solução de bisbenzimida 5% em PBS à temperatura ambiente durante a coloração nuclear. Lavar as lâminas em RT 3x com TNT para 5 min cada um com agitação. Montar com Fluromount G e realizar epifluorescência ou microscopia confocal. <em&gt; Solução de problemas: A eficácia da transferência do marcador vai depender do nível do locus ROSA26 nas células produtoras (determinado pelo controlador de linha de Cre utilizado) e expressão do circuito neural analisados ​​(por exemplo, número de neurónios que produzem o marcador, de convergência, etc.). Por conseguinte, as diluições de anti-soros primários recomendadas aqui podem ter de ser ajustados para impedir sinal baixo ou em excesso. Fundo devem ser sempre analisados ​​utilizando lâminas de controlo adequados (veja acima). </li></ol> 5. τlacZ Coloração para Seções embrionárias <ol><li> Prepare os tampões e reagentes necessários para a coloração. Sempre recém preparar o LacZ tampão C antes do uso. <ol><li> Prepare 5-bromo-4-cloro-3-indolil-β-D-galactopiranósido (X-gal) de solução-mãe (40 mg / ml) por adição de 40 g de X-gal a 1 ml de 70% de dimetilformamida (DMF). Cubra com folha de alumínio e armazenar a -20 ° C para armazenamento a longo prazo. </li><li> Prepare nitro blue tetrazolium (NBT) stock solução (50 mg / ml) por adição de 50 g de NBT a 1 ml de 70% de DMF. Cubra com folha de alumínio e armazenar a -20 ° C para armazenamento a longo prazo. </li><li> Prepare LacZ fixador utilizando 80 ul de 25% de glutaraldeído, 5 ml de 4% de PFA, 20 ul de 1 M de MgCl2, 100 ul de 500 mM de EGTA, 1 ml de 1 M de tampão fosfato pH 7,4 e ddH2O até ao final, volume de 10 ml. </li><li> Prepare LacZ tampão A com 1 ml de 1 M de MgCl2, 5 ml de 500 mM de EGTA, 50 ml de 1 M de tampão de fosfato de pH 7,4 e ddH2O até um volume final de 500 ml. </li><li> Preparar tampão de LacZ B com 1 ml de solução 1 M de MgCl2, 5 ml de 500 mM de EGTA, 5 ml de 1% de desoxicolato de sódio, 100 ml de 10% de NP-40, 50 ml de tampão de fosfato 1 M a pH 7,4 e ddH2O até um volume final de 500 ml. </li><li> Preparar tampão de LacZ C por adição de 10 ul de solução de estoque de NBT e 12,5 ml de solução de estoque de X-gal a 1 ml de tampão B. LacZ fazem fresco imediatamente antes da utilização e cobrir com folha de alumínio. </li></ol&gt; </li><li> Seque as lâminas a RT pelo menos por 10-15 min (entretanto preparar os slides com uma caneta PAP). </li><li> Fixar a secção com LacZ fixador durante 2 min à temperatura ambiente numa câmara humidificada fumos dentro de um capuz-química. Lavar 3 vezes com PBS suplementado com 2 mM de MgCl2. </li><li> Lavar as lâminas com tampão LacZ A. Lavar as lâminas com LacZ tampão A 3 vezes por 10 min cada, a RT. Lavar duas vezes com tampão de LacZ B durante 5 minutos cada. Incubar as lâminas em tampão LacZ C a 30-37 ° C durante 6 horas ou durante a noite numa câmara humidificada. NOTA: Adicionar um volume suficiente de tampão LacZ C; slides não devem secar durante a incubação. </li><li> Após incubação adequada lavar as lâminas com PBS suplementado com 2 mM de MgCl2. Enxágüe seções brevemente com DDH 2 O. Lamela com glicina gelatina de Mayer. Apropriado para um microscópio de luz equipado com um contraste de interferência diferencial (DIC) de imagem set-up. </li></ol> 6. Gender e Tracer Genotipagem <ol><li> Preparar tampão de lise cauda usando 1 ml de 1 M de Tris-HCl pH 8,5, 100 uL de EGTA 500 ​​mM, 200 ul de SDS a 10%, 400 ul de NaCl 5 M e ddH2O para obter um volume final de 10 ml. </li><li> Adicionar 500 ul de tampão de lise cauda para cada tubo Eppendorf contendo uma biopsia da cauda. Adicionar proteinase K para uma concentração final de 100 mg / ml. Incubar durante a noite num agitador a 55 ° C. </li><li> Centrifugar as amostras a 17.000 xg durante 10 min à TA. Transferir o sobrenadante para um novo tubo de centrífuga. Adicionar 500 mL de isopropanol ao sobrenadante. Misturar durante pelo menos 5 min invertendo os tubos para cima e para baixo. </li><li> Girar numa centrífuga a 17.000 xg durante 5 min à temperatura ambiente. Retirar o sobrenadante. Adicionar 200 ul de etanol a 70%. Agita-se durante pelo menos 5 min. </li><li> Centrifuga-se a 17000 xg durante 5 min. Remover o sobrenadante com uma Pipetman (não deitar fora). Seca-se o granulado em uma câmara quente (37 ° C) durante 15-30 min. </li><li> Ressuspender o sedimento em 100 ulde baixo TE pH 8,0 ou água usando dicas wide-bore filtrados. Colocar em 55 ° C durante 1 hora e a 37 ° C durante a noite para dissolução adequada. Armazenar a 4 ° C. </li><li> Use 1 ul de DNA para a reacção de PCR (mistura de reacção de 50 ul contendo 1 uL de ADN da cauda, ​​de 2,5 mL de DMSO, a 10 pM de cada iniciador, 25 uM de cada dNTP, e 1M de betaína). Iniciadores de PCR para genotipagem e identificação de gênero estão listados na tabela de Materiais. </li></ol>

<ol>
	<li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals.">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li><li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+approaches+to+neural+circuits+in+the+mouse.">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li><li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+half+century+of+experimental+neuroanatomical+tracing.">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li><li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus.">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li><li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero.">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li><li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+approach+to+trace+neural+circuits.">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li><li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice.">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li><li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54.">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li><li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GPR54+gene+as+a+regulator+of+puberty.">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li><li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons.">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li><li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice.">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67 (2005).</li><li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene.">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li><li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-activated+site-specific+recombination+in+mice.">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li></ol>

No conflict of interest declared.

Expressando traçadores transsináptica como transgenes para rastrear os circuitos neurais das populações neuronais geneticamente definidos tem várias vantagens em comparação com a injeção estereotáxica de marcadores ou vírus neurotopic. Em primeiro lugar, o marcador é produzido como uma proteína endógena e, por conseguinte, não provocam qualquer resposta imune e uma via neural selectiva pode ser analisada em diferentes animais com elevada reprodutibilidade. Em segundo lugar, porque este é um método não-...

Rastreamento de trajeto anatômico é uma das ferramentas mais utilizadas para decifrar a relação entre cérebro e comportamento 1. Avanço nas tecnologias de rastreamento de circuitos neurais concedeu neurocientistas com a capacidade de rastrear circuitos neurais a partir de populações de neurônios geneticamente identificadas em camundongos 2. Apesar desses avanços técnicos que continua sendo um desafio para desvendar a formação de circuitos neurais especialmente durante a maturação embrionária. Isto é porque a maioria dos métodos de rastreio desenvolvidos até à data baseiam-se a injecção estereotáxica de marcadores transsináptica ou vírus neurotrópico geneticamente modificados (Figura 1) 2,3. Embora essas técnicas obter uma resolução espacial e temporal da conectividade, várias limitações inerentes, tais como injecções traçadores tecnicamente difíceis para o desenvolvimento do cérebro, a reprodutibilidade do local da injecção, inflamação potencial no local da injecção e mais importantly citotoxicidade causada por vírus neurotrópicas limitar a sua utilização 4. Um método alternativo é a de expressar os transgenes marcadores transsináptica como em murganhos geneticamente modificados. Temos recentemente modificado esta técnica e desenvolveu um sistema binário transsináptica genética rastreamento para mapear os circuitos neurais de qualquer população neuronal geneticamente identificado 5. A nossa estratégia experimental baseia-se em duas novas estirpes knock-no rato, que expressam a lectina ou bidirecional cevada traçador (BL) 6 ou o traçador retrógrado fragmento C da toxina do tétano fundido a GFP (GTT) a partir da 7 ROSA 26 lócus após mediada por Cre recombinação. Aqui usamos estas linhagens de camundongos para expressar seletivamente BL e GTT em neurônios que produzem kisspeptin, um neuropeptídeo que está implicado na regulação da maturação do eixo reprodutivo 8,9. Nós demonstramos que esta técnica é adequado para a visualização do desenvolvimento e maturação de ósculocircuitos neurais peptina durante o desenvolvimento embrionário do cérebro do rato fêmea 5. Estratégia para a criação O os R26-GFP-TTC (GTT) linhas traçadores R26-BL-IRES-τlacZ (BIZ) e são knock-in cepas 5 que carregam alelos ROSA26 recombinantes. O R26-BIZ e os alelos R26-GTT são transcricionalmente silencioso devido à presença de um sinal de paragem da transcrição forte, que é flanqueado por dois sítios loxP 5. A expressão do transgene e BIZ GTT é activado por remoção mediada por Cre do sinal de paragem da transcrição. Os alelos-R26 e R26-BIZ GTT pode ser usado de forma independente através da simples cruzamento com uma linha de condutor Cre. Para os animais de análise heterozigótica para os respectivos alelos Cre e R26 pode ser usado. Da mesma ninhada que transportam uma Cre ou um alelo R26, respectivamente, devem ser utilizadas como controlos. Em alternativa, também é possível gerar triple knock-nos animais com os alelos Cre, R26 e R26-BIZ-GTT, porém isso vai exigir uma cruz adicional.

<table border="0" cellpadding="0" cellspacing="0" width="721">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:219px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bisbenzimide (Hoechst 33258 dye)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">14530-100MG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">32205-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryo mold (Peel-a-way)</td>
			<td style="width:219px;">Polyscience Inc.</td>
			<td style="width:119px;">18646A-1</td>
			<td>22mm x 22mm x 20mm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DMSO</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D8418-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Dimethyl Formamide (DMF)</td>
			<td style="width:219px;">VWR Chemicals</td>
			<td style="width:119px;">23470,293</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EGTA</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3054.3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fluoromount G</td>
			<td style="width:219px;">Southern Biotech</td>
			<td style="width:119px;">0100-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glutaraldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">G5882-50ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hydrogen peroxide</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">34988-7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Isopentane (Methyl 2-butane)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">M32631-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kaiser&#39;s Glycine gelatin</td>
			<td style="width:219px;">Merck</td>
			<td style="width:119px;">1092420100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Methanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">494437-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">MgCl2</td>
			<td style="width:219px;">Sigma</td>
			<td>M2670-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NaCl</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">HN00.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NBT</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">298-83-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Nonidet P40 substitute</td>
			<td style="width:219px;">Fluka</td>
			<td style="width:119px;">743.85</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">OCT</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">14020108926</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PAP pen</td>
			<td style="width:219px;">Dako</td>
			<td style="width:119px;">S2002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Parafarmaldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">P6148-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium deoxycholate</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D6750-25G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sucrose</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">S7903-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Superfrost slides</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">FT4981GLPLUS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL700</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA plus kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL749A001KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">AE15.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Triton-X 100</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3051.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tween 20</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">9127.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">X-gal</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">2315.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryostat</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">na</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Light microscope equipped with DIC imaging&#160;</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Fluroscence microscope</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Photoshop</td>
			<td style="width:219px;">Adobe</td>
			<td style="width:119px;">PS6</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Goat anti-WGA (recognizes BL)</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">AS-2024</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylayted horse anti-goat IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-9500&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated goat anti-rabbit IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-1000&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Rabbit anti-GFP (recognizes GTT)</td>
			<td style="width:219px;">Invitrogen</td>
			<td style="width:119px;">A11122</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rabbit anti-GnRH</td>
			<td style="width:219px;">Affinity Bio Reagent</td>
			<td style="width:119px;">PA1-121</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dylight488-donkey anti-rabbit IgG</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">SA5-10038</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SA-Alexa Fluor 546</td>
			<td style="width:219px;">Life Technologies</td>
			<td>S-11225</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Primers</td>
			<td style="width:219px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Fwd (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;ATGAAGATGATGAGCACCAG 
			GGC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Rev&#160; (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;AGCCCTCGCCGCAGAACTC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Fwd&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCGATGCAACGAGTGATGAG 
			GTTCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Rev&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCAGGCTAAGTGCCTTCTCTAC 
			ACCTGC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Fwd&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">AGCAAGGGCGAGGAGCTGTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Rev&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCTTGTAGTTGCCGTCGTCCT 
			TGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Fwd (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">TGAAGCTTTTGGCTTTGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Rev&#160; (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCGCTGCCAAATTCTTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ROSA26 Fwd</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">ROSA26 Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">GCAGATGGAGCGGGAGAAAT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">SA Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
	</tbody>
</table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

Esta seção apresenta os resultados representativos que podem ser obtidos a trabalhar com o R26-BIZ (B L- I RES-τlac Z) e o R26-GTT (G FP- TT C) alelos. Aqui usamos o R26-BIZ e os alelos R26-GTT para analisar a maturação dos circuitos neurais que regulam o eixo reprodutivo. Reprodução em vertebrados está centralmente controlada por um pequeno subconjunto de neurônios no hipotálamo, que secretam hormônio liberador de gonadotrofinas (GnRH). Kisspept...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

Condicional Genetic transsináptica Tracing no Embryonic do cérebro do rato

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.6K visualizações.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

Vídeo: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Manual Drainage of the Zebrafish Embryonic Brain Ventricles

Cerebrospinal fluid (CSF) is a protein rich fluid contained within the brain ventricles. It is present during early vertebrate embryonic development and persists throughout life. Adult CSF is thought to cushion the brain, remove waste, and carry secreted molecules1,2. In the adult and older embryo, the majority of CSF is made by the choroid plexus, a series of highly vascularized secretory regions located adjacent to the brain ventricles3-5. In zebrafish, the choroid plexus is fully formed at 144 hours post fertilization (hpf)6. Prior to this, in both zebrafish and other vertebrate embryos including mouse, a significant amount of embryonic CSF (eCSF) is present . These data and studies in chick suggest that the neuroepithelium is secretory early in development and may be the major source of eCSF prior to choroid plexus development7.
eCSF contains about three times more protein than adult CSF, suggesting that it may have an important role during development8,9. Studies in chick and mouse demonstrate that secreted factors in the eCSF, fluid pressure, or a combination of these, are important for neurogenesis, gene expression, cell proliferation, and cell survival in the neuroepithelium10-20. Proteomic analyses of human, rat, mouse, and chick eCSF have identified many proteins that may be necessary for CSF function. These include extracellular matrix components, apolipoproteins, osmotic pressure regulating proteins, and proteins involved in cell death and proliferation21-24. However, the complex functions of the eCSF are largely unknown.
We have developed a method for removing eCSF from zebrafish brain ventricles, thus allowing for identification of eCSF components and for analysis of the eCSF requirement during development. Although more eCSF can be collected from other vertebrate systems with larger embryos, eCSF can be collected from the earliest stages of zebrafish development, and under genetic or environmental conditions that lead to abnormal brain ventricle volume or morphology. Removal and collection of eCSF allows for mass spectrometric analysis, investigation of eCSF function, and reintroduction of select factors into the ventricles to assay their function. Thus the accessibility of the early zebrafish embryo allows for detailed analysis of eCSF function during development.

We present a method to collect cerebrospinal fluid (CSF) and to create a system which lacks CSF within the embryonic zebrafish brain ventricular system. This allows for further examination of CSF composition and its requirement during embryonic brain development.

Drenagem Manual dos Zebrafish ventrículos cerebrais embrionárias

Cerebrospinal fluid  (CSF) is a protein rich fluid contained within the brain ventricles. It is  present during early vertebrate embryonic development and ...

Neurociência

Selective Tracing of Auditory Fibers in the Avian Embryonic Vestibulocochlear Nerve

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling of auditory axons within the VIIIth cranial nerve would enhance the study of central auditory circuit development. This approach is challenging because multiple sensory organs of the inner ear contribute to the VIIIth nerve 1. Moreover, markers that reliably distinguish auditory versus vestibular groups of axons within the avian VIIIth nerve have yet to be identified. Auditory and vestibular pathways cannot be distinguished functionally in early embryos, as sensory-evoked responses are not present before the circuits are formed. Centrally projecting VIIIth nerve axons have been traced in some studies, but auditory axon labeling was accompanied by labeling from other VIIIth nerve components 2,3. Here, we describe a method for anterograde tracing from the acoustic ganglion to selectively label auditory axons within the developing VIIIth nerve. First, after partial dissection of the anterior cephalic region of an 8-day chick embryo immersed in oxygenated artificial cerebrospinal fluid, the cochlear duct is identified by anatomical landmarks. Next, a fine pulled glass micropipette is positioned to inject a small amount of rhodamine dextran amine into the duct and adjacent deep region where the acoustic ganglion cells are located. Within thirty minutes following the injection, auditory axons are traced centrally into the hindbrain and can later be visualized following histologic preparation. This method provides a useful tool for developmental studies of peripheral to central auditory circuit formation.

Here we describe a microdissection technique followed by fluorescent dye injection into the acoustic ganglion of early chick embryos for selective tracing of auditory axon fibers in the nerve and hindbrain.

Rastreamento seletiva de fibras no nervo auditivo embrionário aviária Vestibulococlear

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling ...

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Injeção estereotáxica de um vetor viral para manipulação genética condicional no Cabo de Rato Spinal

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Genetic modification of specific regions of the developing mammalian brain is a very powerful experimental approach. However, generating novel mouse mutants is often frustratingly slow. It has been shown that access to the mouse brain developing in utero with reasonable post-operatory survival is possible. Still, results with this procedure have been reported almost exclusively for the most superficial and easily accessible part of the developing brain, i.e. the cortex. The thalamus, a narrower and more medial region, has proven more difficult to target. Transfection into deeper nuclei, especially those of the hypothalamus, is perhaps the most challenging and therefore very few results have been reported. Here we demonstrate a procedure to target the entire hypothalamic neuroepithelium or part of it (hypothalamic regions) for transfection through electroporation. The keys to our approach are longer narcosis times, injection in the third ventricle, and appropriate kind and positioning of the electrodes. Additionally, we show results of targeting and subsequent histological analysis of the most recessed hypothalamic nucleus, the mammillary body.

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Despite the functional and medical importance of the hypothalamus, in utero genetic manipulation of its development has rarely been attempted. We show a detailed procedure for in utero electroporation into the mouse hypothalamus and show representative results of total and partial (regional) hypothalamic transfection.

Manipulação genética do rato em desenvolvimento Hipotálamo através<em&gt; In utero</em&gt; Eletroporação

Genetic  modification of specific regions of the developing mammalian brain is a very  powerful experimental approach. However, generating novel mouse ...

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

Angiogenesis is the complex process of new blood vessel formation defined by the sprouting of new blood vessels from a pre-existing vessel network. Angiogenesis plays a key role not only in normal development of organs and tissues, but also in many diseases in which blood vessel formation is dysregulated, such as cancer, blindness and ischemic diseases. In adult life, blood vessels are generally quiescent so angiogenesis is an important target for novel drug development to try and regulate new vessel formation specifically in disease. In order to better understand angiogenesis and to develop appropriate strategies to regulate it, models are required that accurately reflect the different biological steps that are involved. The mouse neonatal retina provides an excellent model of angiogenesis because arteries, veins and capillaries develop to form a vascular plexus during the first week after birth. This model also has the advantage of having a two-dimensional (2D) structure making analysis straightforward compared with the complex 3D anatomy of other vascular networks. By analyzing the retinal vascular plexus at different times after birth, it is possible to observe the various stages of angiogenesis under the microscope. This article demonstrates a straightforward procedure for analyzing the vasculature of a mouse retina using fluorescent staining with isolectin and vascular specific antibodies.

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

The neonatal murine retina provides a well characterized physiological model of angiogenesis, which permits investigations of the roles of different genes or drugs that modulate angiogenesis in an in vivo context. Immunofluorescent staining to accurately visualize the vascular plexus is pivotal to the success of these types of studies.

Whole Mount coloração de imunofluorescência do Rato Retina Neonatal para investigar angiogênese<em&gt; In vivo</em

Angiogenesis  is the complex process of new blood vessel formation defined by the sprouting  of new blood vessels from a pre-existing vessel network. ...

Transsynaptic Tracing from Peripheral Targets with Pseudorabies Virus Followed by Cholera Toxin and Biotinylated Dextran Amines Double Labeling

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This approach has been most extensively used in the brain by utilizing the swine pathogen pseudorabies virus (PRV)1. PRV does not infect great apes, including humans, so it is most commonly used in studies on small mammals, especially rodents. The pseudorabies strain PRV152 expresses the enhanced green fluorescent protein (eGFP) reporter gene and only crosses functional synapses retrogradely through the hierarchical sequence of synaptic connections away from the infection site2,3. Other PRV strains have distinct microbiological properties and may be transported in both directions (PRV-Becker and PRV-Kaplan)4,5&#160;.&#160;This protocol will deal exclusively with PRV152. By delivering the virus at a peripheral site, such as muscle, it is possible to limit the entry of the virus into the brain through a specific set of neurons. The resulting pattern of eGFP signal throughout the brain then resolves the neurons that are connected to the initially infected cells. As the distributed nature of transsynaptic tracing with pseudorabies virus makes interpreting specific connections within an identified network difficult, we present a sensitive and reliable method employing biotinylated dextran amines (BDA) and cholera toxin subunit b (CTb) for confirming the connections between cells identified using PRV152. Immunochemical detection of BDA and CTb with peroxidase and DAB (3, 3&#39;-diaminobenzidine) was chosen because they are effective at revealing cellular processes including distal dendrites6-11.

Transsynaptic tracing has become a powerful tool for analyzing central efferents regulating peripheral targets through multi-synaptic circuits. Here we present a protocol that exploits the transsynaptic pseudorabies virus to identify and localize a functional brain circuit, followed by classical tract tracing techniques to validate specific connections in the circuit between identified groups of neurons.

Transsináptica Rastreamento de Alvos periféricos com vírus da pseudo-Seguido por cólera toxina e Biotinilado Dextran aminas Duplo Labeling

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Isolamento e cultura de células endoteliais da Embryonic posencéfalo

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow for an in-depth characterization to identify pathways involved in these events. Cerebellar granule neurons (CGNs) that are derived from the developing cerebellum are an ideal model system that allows for morphological analyses. Here, we describe a method of how to genetically manipulate CGNs and how to study axono- and dendritogenesis of individual neurons. With this method the effects of RNA interference, overexpression or small molecules can be compared to control neurons. In addition, the rodent cerebellar cortex is an easily accessible in vivo system owing to its predominant postnatal development. We also present an in vivo electroporation technique to genetically manipulate the developing cerebella and describe subsequent cerebellar analyses to assess neuronal morphology and migration.

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Neuronal morphogenesis and migration are crucial events underlying proper brain development. Here, we describe methods to genetically manipulate cultured cerebellar granule neurons and the developing cerebellum for the assessment of morphology and migratory characteristics of neurons.

Manipulação genética de Cerebelar Granule Neurônios<em&gt; In Vitro</em&gt; E<em&gt; In Vivo</em&gt; Estudar Neuronal Morfologia e Migração

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow ...

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this information to the brain. As such, determining how olfactory information is transferred to the brain, modifying both perception and behavior, merits investigation. Interestingly, there is emerging evidence that cellular transduction and transcriptional factors are involved in the diversification of olfactory receptor neuron. Here we provide a robust whole mount immunological labeling method to assay in vivo olfactory receptor neuron organization. Using this method, we identified all olfactory receptor neurons with anti-ELAV antibody, a known pan-neural marker and Or49a-mCD8::GFP, an olfactory receptor neuron specifically expressed in Nba neuron using anti-GFP antibody.

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Herein we describe the process of whole mount immunostaining of Drosophila antennae, which enables us to better understand the molecular mechanisms involved in the diversification of olfactory receptor neurons (ORN)s.

Monte todo imunomarcação de Neurônios Receptores Olfatórios no<em&gt; Drosophila</em&gt; Antena

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

Condicional Genetic transsináptica Tracing no Embryonic do cérebro do rato

Resumo

Explore mais vídeos

Capítulos neste vídeo

Drenagem Manual dos Zebrafish ventrículos cerebrais embrionárias

Rastreamento seletiva de fibras no nervo auditivo embrionário aviária Vestibulococlear

Injeção estereotáxica de um vetor viral para manipulação genética condicional no Cabo de Rato Spinal

Manipulação genética do rato em desenvolvimento Hipotálamo através

Whole Mount coloração de imunofluorescência do Rato Retina Neonatal para investigar angiogênese

Transsináptica Rastreamento de Alvos periféricos com vírus da pseudo-Seguido por cólera toxina e Biotinilado Dextran aminas Duplo Labeling

Isolamento e cultura de células endoteliais da Embryonic posencéfalo

Manipulação genética de Cerebelar Granule Neurônios

Monte todo imunomarcação de Neurônios Receptores Olfatórios no

Imagens ao vivo da mitose no desenvolvimento Cortex embrionárias de camundongos