Name: conditional genetic transsynaptic tracing in the embryonic mouse brain
Uploaded: 2014-12-22T14:00:00.000+00:00
Duration: 11 min 3 s
Description: Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

NOTA: Ética Declaração: os procedimentos de indivíduos animais foram aprovados pelo comitê de bem-estar dos animais, da Universidade de Hamburgo e da Universidade de Saarland. 1. Preparação e fixação de tecido embrionário <ol><li> Organizar todos os equipamentos necessários para dissecar os embriões e preparar soluções para posterior fixação do tecido antes de sacrificar os animais. NOTA: Sempre preparar uma nova solução de 4% de paraformaldeído (PFA) (PFA a 4% em 0,1 M de solução salina de fosfato tamponada (PBS), pH ajustado a 7,4). </li><li> Eutanásia cronometrado rato fêmea grávida de um procedimento eticamente aprovado. </li><li> Transferir o rato sobre uma plataforma. Molhe o lado ventral do abdômen com etanol 70% e fazer uma incisão vertical usando uma tesoura afiada para expor a cavidade abdominal. </li><li> Identificar a cadeia embrionário e retire-o com cuidado, usando uma pinça sem corte e colocá-lo em PBS gelado. </li><li> Remover os embriões individuaisa cadeia embrionárias usando uma tesoura fina e fórceps. Remover tecido extra em torno dos embriões e lave-os em PBS gelado. </li><li> Pegue uma pequena biópsia de cauda (antes da transferência do embrião para PFA) e incubar-lo em tampão de lise da cauda para a identificação de gênero e alelo tracer genotipagem PCR. </li><li> Iniciar a partir do embrião no lado mais lateral e transferir cada embrião separadamente para um tubo arrefecido com gelo contendo PFA a 4% em gelo num agitador. </li><li> Embeber os embriões com a idade de E13.5 ou menos durante 1,5 horas em gelo com agitação constante. Mergulhe os embriões na E14.5 idade e E15.5 durante 2,5 horas em gelo com agitação constante. </li><li> Para E16.5 embriões idade ou mais, decapitar e remova a pele exterior antes de mergulhar a cabeça em solução PFA. Chefes de embriões E16.5 pode ser embebido durante 4,5 horas em gelo com agitação constante. </li><li> Após a fixação adequada, lavar os embriões três vezes com PBS gelado. Transferir os embriões em sacarose a 30% em solução de PBS a 4 ° C até se afundempara a parte inferior. </li></ol> 2. Congelamento <ol><li> Organizar todos os materiais necessários antes de iniciar o processo de congelamento: crio-mofo, crio-luvas, pinças pluma entomologia, caneta marcador e corte ideal compostos temperatura (OCT) </li><li> Rotular o crio-molde com um marcador permanente resistente ao álcool (mencionar a orientação do tecido, da data e do genótipo). Prepare uma lama de gelo seco moído e 100% de etanol em um balde de gelo. Coloque um copo de vidro no interior contendo isopentano. Aguarde 10 minutos para o isopentano para esfriar. </li><li> Enquanto isso, remover o tecido a partir da solução de sacarose, limpe o excesso de sacarose em torno do tecido usando lenços de laboratório. Transferir o tecido em um pré-rotulados crio-molde com suficiente OCT para cobrir o tecido. Evite as bolhas de ar no PTU; especialmente em torno do tecido. </li><li> Orientar o tecido em outubro com a pinça entomologia pluma para evitar danos aos tecidos. Comece congelamento transferindo o crio-mold para o banho isopentano pré-resfriada. Não salpique isopentano na outubro, pois não irá congelar corretamente. Enrole as amostras em folha de alumínio e armazenar a -80 ° C. </li></ol> 3. cryosectioning <ol><li> Cortar 14 mm cortes seriados finos em série de cinco usando um criostato e recolher em lâminas de vidro SuperFrost® Plus para análise de imunofluorescência (IF). Armazenar as lâminas a -80 ° C até ser utilizado. </li></ol> 4. Usando a visualização Tracer (TSA) Protocolo Tyramide Signal Amplification <ol><li> Prepare os tampões e reagentes necessários para a coloração. Sempre recentemente preparar o tampão Tris-NaCl-Tween (TNT) no dia da utilização. <ol><li> Preparar tampão TNT usando 100 ml de 1 M de Tris-HCl pH 7,5, 30 ml de NaCl 5 M e ddH2O até ao volume final de 1 L. Adicionar 500 ul de Tween 20 utilizando uma pipeta de 1 ml. Adicionar lentamente o Tween 20 e lave a pipeta para cima e para baixo várias vezes para assegurar que todo o Tween 20 é emsolução. </li><li> Prepare Tris-NaCl-tampão de bloqueio (TNB) usando 100 ml de 1 M de Tris-HCl pH 7,5, 30 ml de NaCl 5 M e ddH2O até ao volume final de 1 L. Adicionar 5 g de reagente bloqueador (fornecida com o Kit) lentamente em pequenos incrementos para o buffer enquanto se agitava. Aquece-se a solução gradualmente até 55 ° C com agitação contínua, para dissolver completamente o reagente de bloqueio (o que não deveria demorar mais de 30-60 minutos). Para atingir o aquecimento homogéneo utilizar um banho de água a 55 ° C. A solução aparece leitoso. Levar a solução à temperatura ambiente antes de usar. Alíquotas e armazenar a -20 ° C para armazenamento a longo prazo. </li><li> Reconstituir biotina reagente de tiramida (fornecido com o kit) em Biologia Molecular / DMSO de grau HPLC. Consoante o kit é utilizado a quantidade apropriada de DMSO pode variar. Guardar a solução estoque a 4 ° C. NOTA: Os cortes de animais heterozigotos para os respectivos alelos Cre e R26 pode ser usado para análise de circuitos. Use sexões de ninhada que transportam uma Cre ou um alelo R26, respectivamente, como controles negativos. Trate lâminas de controlo negativas exatamente como slides de animais heterozigotos duplas. Além disso, incluem uma lâmina de controlo de um animal heterozigoto duplo, mas deixar de fora o reagente TSA (controlo sem amplificação). </li></ol></li><li> Usando um bisturi afiado fresco remover o excesso de outubro em torno das secções de tecido e marcar o limite em torno das secções com uma caneta PAP. </li><li> Secam-se as lâminas durante 2-3 minutos à temperatura ambiente (TA). Lavar as lâminas em RT 3x com TNT para 5 min cada. Incubar as lâminas à temperatura ambiente durante 30 min em 0,3% de H 2 O 2 em solução de metanol arrefecido em gelo para extinguir a actividade da peroxidase endógena. </li><li> Lavar 3x com PBS durante 5 minutos cada à temperatura ambiente. Incubar durante 10 min em 0,5% de Triton X-100 em PBS durante a permeabilização dos tecidos. Lavar as lâminas em RT 3x com TNT para 5 min cada. </li><li> Bloco com TNB (solução de bloqueio, 200-300 mL por lâmina) para 30min à temperatura ambiente numa câmara humidificada. Certifique-se de todas as seções são completamente cobertas por TNB. Não deixe que as lâminas secar entre as etapas. </li><li> Drenar o excesso de tampão de bloqueio e aplicar o anti-soro primário que reconhece o marcador (1: 1000 de cabra anti-WGA por BL, 1: 15.000 de coelho anti-GFP para GTT) diluído em TNB durante 2 horas à temperatura ambiente ou durante a noite a 4 ° C. Certifique-se de usar um volume suficiente para cobrir totalmente a secção de tecido (200-300 mL por lâmina). NOTA: As diluições anti-soros primários recomendadas aqui pode ter de ser ajustada. </li><li> Lavar as lâminas em RT 3x com TNT para 5 min cada um com agitação. </li><li> Incubar as secções com soro secundário biotinilado reconhecem o anfitrião do primeiro anti-soro (1: 500 cavalo IgG anti-cabra para anti-WGA, 1: 5.000 de cabra anti-IgG de coelho para o anti-GFP em TNB durante 1 hora a RT). </li><li> Lavar 3x com TNT à temperatura ambiente durante 5 min cada, com agitação. Incubar em 1: 100 estreptavidina (SA) conjugado a peroxidase de rábano (SA-HRP, wi fornecidath o kit) em TNB durante 30 min à temperatura ambiente numa câmara humidificada. Lavar as lâminas em RT 3x com TNT para 5 min cada. Enquanto isso descongelar a TSA. </li><li> Diluir 1:50 em TSA TSA diluente amplificação (fornecido com o kit, use o kit TSA para a visualização de BL e o kit de TSA + por GTT). Incubam-se as secções de tecido em TSA diluído para precisamente 10 min à temperatura ambiente. Diluir TSA imediatamente antes da utilização, de preferência durante a etapa de lavagem anterior, não use qualquer restante reagente TSA diluída para experiências futuras; elaborar sempre fresco. </li><li> Lavar as lâminas em RT 3x com TNT para 5 min cada um com agitação. Incubar com 1: 500 de Alexa Fluor ® 546 em TNB estreptavidina conjugada durante 30 min à TA. Lavar as lâminas em RT 3x com TNT para 5 min cada um com agitação. </li><li> Incubar durante 10 min em solução de bisbenzimida 5% em PBS à temperatura ambiente durante a coloração nuclear. Lavar as lâminas em RT 3x com TNT para 5 min cada um com agitação. Montar com Fluromount G e realizar epifluorescência ou microscopia confocal. <em&gt; Solução de problemas: A eficácia da transferência do marcador vai depender do nível do locus ROSA26 nas células produtoras (determinado pelo controlador de linha de Cre utilizado) e expressão do circuito neural analisados ​​(por exemplo, número de neurónios que produzem o marcador, de convergência, etc.). Por conseguinte, as diluições de anti-soros primários recomendadas aqui podem ter de ser ajustados para impedir sinal baixo ou em excesso. Fundo devem ser sempre analisados ​​utilizando lâminas de controlo adequados (veja acima). </li></ol> 5. τlacZ Coloração para Seções embrionárias <ol><li> Prepare os tampões e reagentes necessários para a coloração. Sempre recém preparar o LacZ tampão C antes do uso. <ol><li> Prepare 5-bromo-4-cloro-3-indolil-β-D-galactopiranósido (X-gal) de solução-mãe (40 mg / ml) por adição de 40 g de X-gal a 1 ml de 70% de dimetilformamida (DMF). Cubra com folha de alumínio e armazenar a -20 ° C para armazenamento a longo prazo. </li><li> Prepare nitro blue tetrazolium (NBT) stock solução (50 mg / ml) por adição de 50 g de NBT a 1 ml de 70% de DMF. Cubra com folha de alumínio e armazenar a -20 ° C para armazenamento a longo prazo. </li><li> Prepare LacZ fixador utilizando 80 ul de 25% de glutaraldeído, 5 ml de 4% de PFA, 20 ul de 1 M de MgCl2, 100 ul de 500 mM de EGTA, 1 ml de 1 M de tampão fosfato pH 7,4 e ddH2O até ao final, volume de 10 ml. </li><li> Prepare LacZ tampão A com 1 ml de 1 M de MgCl2, 5 ml de 500 mM de EGTA, 50 ml de 1 M de tampão de fosfato de pH 7,4 e ddH2O até um volume final de 500 ml. </li><li> Preparar tampão de LacZ B com 1 ml de solução 1 M de MgCl2, 5 ml de 500 mM de EGTA, 5 ml de 1% de desoxicolato de sódio, 100 ml de 10% de NP-40, 50 ml de tampão de fosfato 1 M a pH 7,4 e ddH2O até um volume final de 500 ml. </li><li> Preparar tampão de LacZ C por adição de 10 ul de solução de estoque de NBT e 12,5 ml de solução de estoque de X-gal a 1 ml de tampão B. LacZ fazem fresco imediatamente antes da utilização e cobrir com folha de alumínio. </li></ol&gt; </li><li> Seque as lâminas a RT pelo menos por 10-15 min (entretanto preparar os slides com uma caneta PAP). </li><li> Fixar a secção com LacZ fixador durante 2 min à temperatura ambiente numa câmara humidificada fumos dentro de um capuz-química. Lavar 3 vezes com PBS suplementado com 2 mM de MgCl2. </li><li> Lavar as lâminas com tampão LacZ A. Lavar as lâminas com LacZ tampão A 3 vezes por 10 min cada, a RT. Lavar duas vezes com tampão de LacZ B durante 5 minutos cada. Incubar as lâminas em tampão LacZ C a 30-37 ° C durante 6 horas ou durante a noite numa câmara humidificada. NOTA: Adicionar um volume suficiente de tampão LacZ C; slides não devem secar durante a incubação. </li><li> Após incubação adequada lavar as lâminas com PBS suplementado com 2 mM de MgCl2. Enxágüe seções brevemente com DDH 2 O. Lamela com glicina gelatina de Mayer. Apropriado para um microscópio de luz equipado com um contraste de interferência diferencial (DIC) de imagem set-up. </li></ol> 6. Gender e Tracer Genotipagem <ol><li> Preparar tampão de lise cauda usando 1 ml de 1 M de Tris-HCl pH 8,5, 100 uL de EGTA 500 ​​mM, 200 ul de SDS a 10%, 400 ul de NaCl 5 M e ddH2O para obter um volume final de 10 ml. </li><li> Adicionar 500 ul de tampão de lise cauda para cada tubo Eppendorf contendo uma biopsia da cauda. Adicionar proteinase K para uma concentração final de 100 mg / ml. Incubar durante a noite num agitador a 55 ° C. </li><li> Centrifugar as amostras a 17.000 xg durante 10 min à TA. Transferir o sobrenadante para um novo tubo de centrífuga. Adicionar 500 mL de isopropanol ao sobrenadante. Misturar durante pelo menos 5 min invertendo os tubos para cima e para baixo. </li><li> Girar numa centrífuga a 17.000 xg durante 5 min à temperatura ambiente. Retirar o sobrenadante. Adicionar 200 ul de etanol a 70%. Agita-se durante pelo menos 5 min. </li><li> Centrifuga-se a 17000 xg durante 5 min. Remover o sobrenadante com uma Pipetman (não deitar fora). Seca-se o granulado em uma câmara quente (37 ° C) durante 15-30 min. </li><li> Ressuspender o sedimento em 100 ulde baixo TE pH 8,0 ou água usando dicas wide-bore filtrados. Colocar em 55 ° C durante 1 hora e a 37 ° C durante a noite para dissolução adequada. Armazenar a 4 ° C. </li><li> Use 1 ul de DNA para a reacção de PCR (mistura de reacção de 50 ul contendo 1 uL de ADN da cauda, ​​de 2,5 mL de DMSO, a 10 pM de cada iniciador, 25 uM de cada dNTP, e 1M de betaína). Iniciadores de PCR para genotipagem e identificação de gênero estão listados na tabela de Materiais. </li></ol>

<ol>
	<li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals.">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li><li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+approaches+to+neural+circuits+in+the+mouse.">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li><li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+half+century+of+experimental+neuroanatomical+tracing.">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li><li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus.">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li><li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero.">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li><li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+approach+to+trace+neural+circuits.">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li><li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice.">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li><li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54.">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li><li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GPR54+gene+as+a+regulator+of+puberty.">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li><li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons.">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li><li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice.">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67 (2005).</li><li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene.">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li><li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-activated+site-specific+recombination+in+mice.">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li></ol>

No conflict of interest declared.

Expressando traçadores transsináptica como transgenes para rastrear os circuitos neurais das populações neuronais geneticamente definidos tem várias vantagens em comparação com a injeção estereotáxica de marcadores ou vírus neurotopic. Em primeiro lugar, o marcador é produzido como uma proteína endógena e, por conseguinte, não provocam qualquer resposta imune e uma via neural selectiva pode ser analisada em diferentes animais com elevada reprodutibilidade. Em segundo lugar, porque este é um método não-...

Rastreamento de trajeto anatômico é uma das ferramentas mais utilizadas para decifrar a relação entre cérebro e comportamento 1. Avanço nas tecnologias de rastreamento de circuitos neurais concedeu neurocientistas com a capacidade de rastrear circuitos neurais a partir de populações de neurônios geneticamente identificadas em camundongos 2. Apesar desses avanços técnicos que continua sendo um desafio para desvendar a formação de circuitos neurais especialmente durante a maturação embrionária. Isto é porque a maioria dos métodos de rastreio desenvolvidos até à data baseiam-se a injecção estereotáxica de marcadores transsináptica ou vírus neurotrópico geneticamente modificados (Figura 1) 2,3. Embora essas técnicas obter uma resolução espacial e temporal da conectividade, várias limitações inerentes, tais como injecções traçadores tecnicamente difíceis para o desenvolvimento do cérebro, a reprodutibilidade do local da injecção, inflamação potencial no local da injecção e mais importantly citotoxicidade causada por vírus neurotrópicas limitar a sua utilização 4. Um método alternativo é a de expressar os transgenes marcadores transsináptica como em murganhos geneticamente modificados. Temos recentemente modificado esta técnica e desenvolveu um sistema binário transsináptica genética rastreamento para mapear os circuitos neurais de qualquer população neuronal geneticamente identificado 5. A nossa estratégia experimental baseia-se em duas novas estirpes knock-no rato, que expressam a lectina ou bidirecional cevada traçador (BL) 6 ou o traçador retrógrado fragmento C da toxina do tétano fundido a GFP (GTT) a partir da 7 ROSA 26 lócus após mediada por Cre recombinação. Aqui usamos estas linhagens de camundongos para expressar seletivamente BL e GTT em neurônios que produzem kisspeptin, um neuropeptídeo que está implicado na regulação da maturação do eixo reprodutivo 8,9. Nós demonstramos que esta técnica é adequado para a visualização do desenvolvimento e maturação de ósculocircuitos neurais peptina durante o desenvolvimento embrionário do cérebro do rato fêmea 5. Estratégia para a criação O os R26-GFP-TTC (GTT) linhas traçadores R26-BL-IRES-τlacZ (BIZ) e são knock-in cepas 5 que carregam alelos ROSA26 recombinantes. O R26-BIZ e os alelos R26-GTT são transcricionalmente silencioso devido à presença de um sinal de paragem da transcrição forte, que é flanqueado por dois sítios loxP 5. A expressão do transgene e BIZ GTT é activado por remoção mediada por Cre do sinal de paragem da transcrição. Os alelos-R26 e R26-BIZ GTT pode ser usado de forma independente através da simples cruzamento com uma linha de condutor Cre. Para os animais de análise heterozigótica para os respectivos alelos Cre e R26 pode ser usado. Da mesma ninhada que transportam uma Cre ou um alelo R26, respectivamente, devem ser utilizadas como controlos. Em alternativa, também é possível gerar triple knock-nos animais com os alelos Cre, R26 e R26-BIZ-GTT, porém isso vai exigir uma cruz adicional.

<table><tbody><tr><td>Bisbenzimide (Hoechst 33258 dye)</td><td>Sigma</td><td>14530-100MG</td><td></td></tr><tr><td>Ethanol</td><td>Sigma</td><td>32205-1L</td><td></td></tr><tr><td>Cryo mold (Peel-a-way)</td><td>Polyscience Inc.</td><td>18646A-1</td><td>22 x 22 x 20mm</td></tr><tr><td>DMSO</td><td>Sigma</td><td>D8418-100ML</td><td></td></tr><tr><td>Dimethyl Formamide (DMF)</td><td>VWR Chemicals</td><td>23470,293</td><td></td></tr><tr><td>EGTA</td><td>ROTH</td><td>3054.3</td><td></td></tr><tr><td>Fluoromount G</td><td>Southern Biotech</td><td>0100-01</td><td></td></tr><tr><td>Glutaraldehyde</td><td>Sigma</td><td>G5882-50ML</td><td></td></tr><tr><td>Hydrogen peroxide</td><td>Sigma</td><td>34988-7</td><td></td></tr><tr><td>Isopentane (Methyl 2-butane)</td><td>Sigma</td><td>M32631-2.5L</td><td></td></tr><tr><td>Kaiser&#039;s glycine gelatin</td><td>Merck</td><td>1092420100</td><td></td></tr><tr><td>Methanol</td><td>Sigma</td><td>494437-1L</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>M2670-100G</td><td></td></tr><tr><td>NaCl</td><td>ROTH</td><td>HN00.2</td><td></td></tr><tr><td>NBT</td><td>Sigma</td><td>298-83-9</td><td></td></tr><tr><td>Nonidet P40 substitute</td><td>Fluka</td><td>743.85</td><td></td></tr><tr><td>OCT</td><td>Leica</td><td>14020108926</td><td></td></tr><tr><td>PAP pen</td><td>Dako</td><td>S2002</td><td></td></tr><tr><td>Parafarmaldehyde</td><td>Sigma</td><td>P6148-1KG</td><td></td></tr><tr><td>Sodium deoxycholate</td><td>Sigma</td><td>D6750-25G</td><td></td></tr><tr><td>Sucrose</td><td>Sigma</td><td>S7903-1KG</td><td></td></tr><tr><td>Superfrost slides</td><td>Thermo Scientific</td><td>FT4981GLPLUS</td><td></td></tr><tr><td>TSA kit</td><td>PerkinElmer</td><td>NEL700</td><td></td></tr><tr><td>TSA plus kit</td><td>PerkinElmer</td><td>NEL749A001KT</td><td></td></tr><tr><td>Tris</td><td>ROTH</td><td>AE15.2</td><td></td></tr><tr><td>Triton-X 100</td><td>ROTH</td><td>3051.2</td><td></td></tr><tr><td>Tween 20</td><td>ROTH</td><td>9127.1</td><td></td></tr><tr><td>X-gal</td><td>ROTH</td><td>2315.1</td><td></td></tr><tr><td>Cryostat</td><td>Leica</td><td>na</td><td></td></tr><tr><td>Light microscope equipped with DIC imaging</td><td>Zeiss</td><td>Axioskop2 equipped with Axio Vision software</td><td></td></tr><tr><td>Fluroscence microscope</td><td>Zeiss</td><td>Axioskop2 equipped with Axio Vision software</td><td></td></tr><tr><td>Photoshop</td><td>Adobe</td><td>PS6</td><td></td></tr><tr><td>Goat anti-WGA (recognizes BL)</td><td>Vector Laboatories</td><td>AS-2024</td><td></td></tr><tr><td>Biotinylayted horse anti-goat IgG</td><td>Vector Laboatories</td><td>BA-9500</td><td></td></tr><tr><td>Biotinylated goat anti-rabbit IgG</td><td>Vector Laboatories</td><td>BA-1000</td><td></td></tr><tr><td>Rabbit anti-GFP (recognizes GTT)</td><td>Invitrogen</td><td>A11122</td><td></td></tr><tr><td>Rabbit anti-GnRH</td><td>Affinity Bio Reagent</td><td>PA1-121</td><td></td></tr><tr><td>Dylight488-donkey anti-rabbit IgG</td><td>Thermo Scientific</td><td>SA5-10038</td><td></td></tr><tr><td>SA-Alexa Fluor 546</td><td>Life Technologies</td><td>S-11225</td><td></td></tr><tr><td colspan="4">Primers</td></tr><tr><td>BL Fwd (for BIZ genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>ATGAAGATGATGAGCACCAGGGC</td></tr><tr><td>BL Rev (for BIZ genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>AGCCCTCGCCGCAGAACTC</td></tr><tr><td>Cre Fwd (for Cre genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>GTCGATGCAACGAGTGATGAGGTTCG</td></tr><tr><td>Cre Rev (for Cre genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>CCAGGCTAAGTGCCTTCTCTACACCTGC</td></tr><tr><td>TTC Fwd (for GTT genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>AGCAAGGGCGAGGAGCTGTT</td></tr><tr><td>TTC Rev (for GTT genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>GTCTTGTAGTTGCCGTCGTCCTTGAA</td></tr><tr><td>XY Fwd (for gender genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>TGAAGCTTTTGGCTTTGA</td></tr><tr><td>XY Rev (for gender genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>CCGCTGCCAAATTCTTTG</td></tr><tr><td>ROSA26 Fwd</td><td>Eurofins MWG Operon</td><td></td><td>CGAAGTCGCTCTGAGTTGTTATC</td></tr><tr><td>ROSA26 Rev</td><td>Eurofins MWG Operon</td><td></td><td>GCAGATGGAGCGGGAGAAAT</td></tr><tr><td>SA Rev</td><td>Eurofins MWG Operon</td><td></td><td>CGAAGTCGCTCTGAGTTGTTATC</td></tr></tbody></table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

Esta seção apresenta os resultados representativos que podem ser obtidos a trabalhar com o R26-BIZ (B L- I RES-τlac Z) e o R26-GTT (G FP- TT C) alelos. Aqui usamos o R26-BIZ e os alelos R26-GTT para analisar a maturação dos circuitos neurais que regulam o eixo reprodutivo. Reprodução em vertebrados está centralmente controlada por um pequeno subconjunto de neurônios no hipotálamo, que secretam hormônio liberador de gonadotrofinas (GnRH). Kisspept...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

Condicional Genetic transsináptica Tracing no Embryonic do cérebro do rato

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.6K visualizações.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

Vídeo: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Mosaic Analysis of Gene Function in Postnatal Mouse Brain Development by Using Virus-based Cre Recombination

Normal brain function relies not only on embryonic development when major neuronal pathways are established, but also on postnatal 
development when neural circuits are matured and refined. Misregulation at this stage may lead to neurological and psychiatric disorders such as autism 
and schizophrenia1,2. Many genes have been studied in the prenatal brain and found crucial to many developmental processes3-5. However, their 
function in the postnatal brain is largely unknown, partly because their deletion in mice often leads to lethality during neonatal development, and partly because their requirement in early development hampers the postnatal analysis. To overcome these obstacles, floxed alleles of these genes are currently being generated in mice 6. When combined with transgenic alleles that express Cre recombinase in specific cell types, conditional deletion can be achieved to study gene function in the postnatal brain. However, this method requires additional alleles and extra time (3-6 months) to generate the mice with appropriate genotypes, thereby limiting the expansion of the genetic analysis to a large scale in the mouse brain.
Here we demonstrate a complementary approach that uses virally-expressed Cre to study these floxed alleles rapidly and 
systematically in postnatal brain development. By injecting recombinant adeno-associated viruses (rAAVs)7,8 encoding Cre into the neonatal brain, 
we are able to delete the gene of interest in different regions of the brain. By controlling the viral titer and coexpressing a fluorescent 
protein marker, we can simultaneously achieve mosaic gene inactivation and sparse neuronal labeling. This method bypasses the requirement of 
many genes in early development, and allows us to study their cell autonomous function in many critical processes in postnatal brain development,
 including axonal and dendritic growth, branching, and tiling, as well as synapse formation and refinement. This method has been used successfully 
in our own lab (unpublished results) and others8,9, and can be extended to other viruses, such as lentivirus 9, as well as to the expression of 
shRNA or dominant active proteins 10. Furthermore, by combining this technique with electrophysiology as well as recently-developed optical 
imaging tools 11, this method provides a new strategy to study how genetic pathways influence neural circuit development and function in mice 
and rats.

An in vivo method to test gene function in postnatal brain is described. Recombinant AAVs expressing Cre and/or a fluorescent protein are injected into neonatal mouse brain. Mosaic gene inactivation and sparse neuronal labeling are achieved, allowing rapid analysis of gene function in processes critical to neural circuit development.

Análise mosaico de função do gene em desenvolvimento pós-natal do rato do cérebro usando Virus baseado Recombinação Cre

Normal brain function relies not only on embryonic development when major neuronal pathways are established, but also on postnatal 
development when ...

Neurociência

Mouse in Utero Electroporation: Controlled Spatiotemporal Gene Transfection

In order to understand the function of genes expressed in specific region of the developing brain, including signaling molecules and axon guidance molecules, local gene transfer or knock- out is required. Gene targeting knock-in or knock-out into local regions is possible to perform with combination with a specific CRE line, which is laborious, costly, and time consuming. Therefore, a simple transfection method, an in utero electroporation technique, which can be performed with short time, will be handy to test the possible function of candidate genes prior to the generation of transgenic animals 1,2. In addition to this, in utero electroporation targets areas of the brain where no specific CRE line exists, and will limit embryonic lethality 3,4. Here, we present a method of in utero electroporation combining two different types of electrodes for simple and convenient gene transfer into target areas of the developing brain. First, a unique holding method of embryos using an optic fiber optic light cable will make small embryos (from E9.5) visible for targeted DNA solution injection into ventricles and needle type electrodes insertion to the targeted brain area 5,6. The patterning of the brain such as cortical area occur at early embryonic stage, therefore, these early electroporation from E9.5 make a big contribution to understand entire area patterning event. Second, the precise shape of a capillary prevents uterine damage by making holes by insertion of the capillary. Furthermore, the precise shape of the needle electrodes are created with tungsten and platinum wire and sharpened using sand paper and insulated with nail polish 7, a method which is described in great detail in this protocol. This unique technique allows transfection of plasmid DNA into restricted areas of the brain and will enable small embryos to be electroporated. This will help to, open a new window for many scientists who are working on cell differentiation, cell migration, axon guidance in very early embryonic stage. Moreover, this technique will allow scientists to transfect plasmid DNA into deep parts of the developing brain such as thalamus and hypothalamus, where not many region-specific CRE lines exist for gain of function (GOF) or loss of function (LOF) analyses.

Mouse in Utero Electroporation: Controlled Spatiotemporal Gene Transfection

A gene transfer method into the developing mouse brain is described by using a unique surgical method and special shape of electrodes. This unique technique allows transfection of plasmid DNA temporally and spatially, which will aid many neuroscientists in studying brain development.

Mouse No Utero Eletroporação: Transfecção Gênica Controlled Spatiotemporal

In order to understand the function of genes expressed in specific region of the developing brain, including signaling molecules and axon guidance ...

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date this tool has been widely used to study the regulation of cellular proliferation, differentiation and neuronal migration especially in the developing cerebral cortex 6-8. Here we detail our protocol to electroporate in utero the cerebral cortex and the hippocampus and provide evidence that this approach can be used to study dendrites and spines in these two cerebral regions.
Visualization and manipulation of neurons in primary cultures have contributed to a better understanding of the processes involved in dendrite, spine and synapse development. However neurons growing in vitro are not exposed to all the physiological cues that can affect dendrite and/or spine formation and maintenance during normal development. Our knowledge of dendrite and spine structures in vivo in wild-type or mutant mice comes mostly from observations using the Golgi-Cox method 9. However, Golgi staining is considered to be unpredictable. Indeed, groups of nerve cells and fiber tracts are labeled randomly, with particular areas often appearing completely stained while adjacent areas are devoid of staining. Recent studies have shown that IUE of fluorescent constructs represents an attractive alternative method to study dendrites, spines as well as synapses in mutant / wild-type mice 10-11 (Figure 1A). Moreover in comparison to the generation of mouse knockouts, IUE represents a rapid approach to perform gain and loss of function studies in specific population of cells during a specific time window. In addition, IUE has been successfully used with inducible gene expression or inducible RNAi approaches to refine the temporal control over the expression of a gene or shRNA 12. These advantages of IUE have thus opened new dimensions to study the effect of gene expression/suppression on dendrites and spines not only in specific cerebral structures (Figure 1B) but also at a specific time point of development (Figure 1C).
Finally, IUE provides a useful tool to identify functional interactions between genes involved in dendrite, spine and/or synapse development. Indeed, in contrast to other gene transfer methods such as virus, it is straightforward to combine multiple RNAi or transgenes in the same population of cells. 
In summary, IUE is a powerful method that has already contributed to the characterization of molecular mechanisms underlying brain function and disease and it should also be useful in the study of dendrites and spines.

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

This article describes in detail a protocol to electroporate in utero the cerebral cortex and the hippocampus at E14.5 in mice. We also show that this is a valuable method to study dendrites and spines in these two cerebral regions.

Visualização e manipulação genética de dendritos e espinhas no córtex cerebral e hipocampo do rato usando<em&gt; In utero</em&gt; Eletroporação

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date ...

Viral Tracing of Genetically Defined Neural Circuitry

Classical methods for studying neuronal circuits are fairly low throughput. Transsynaptic viruses, particularly the pseudorabies (PRV) and rabies virus (RABV), and more recently vesicular stomatitis virus (VSV), for studying circuitry, is becoming increasingly popular. These higher throughput methods use viruses that transmit between neurons in either the anterograde or retrograde direction.
Recently, a modified RABV for monosynaptic retrograde tracing was developed. (Figure 1A). In this method, the glycoprotein (G) gene is deleted from the viral genome, and resupplied only in targeted neurons. Infection specificity is achieved by substituting a chimeric G, composed of the extracellular domain of the ASLV-A glycoprotein and the cytoplasmic domain of the RABV-G (A/RG), for the normal RABV-G1. This chimeric G specifically infects cells expressing the TVA receptor1. The gene encoding TVA can been delivered by various methods2-8. Following RABV-G infection of a TVA-expressing neuron, the RABV can transmit to other, synaptically connected neurons in a retrograde direction by nature of its own G which was co-delivered with the TVA receptor. This technique labels a relatively large number of inputs (5-10%)2 onto a defined cell type, providing a sampling of all of the inputs onto a defined starter cell type.
We recently modified this technique to use VSV as a transsynaptic tracer9. VSV has several advantages, including the rapidity of gene expression. Here we detail a new viral tracing system using VSV useful for probing microcircuitry with increased resolution. While the original published strategies by Wickersham et al.4 and Beier et al.9 permit labeling of any neurons that project onto initially-infected TVA-expressing-cells, here VSV was engineered to transmit only to TVA-expressing cells (Figure 1B). The virus is first pseudotyped with RABV-G to permit infection of neurons downstream of TVA-expressing neurons. After infecting this first population of cells, the virus released can only infect TVA-expressing cells. Because the transsynaptic viral spread is limited to TVA-expressing cells, presence of absence of connectivity from defined cell types can be explored with high resolution. An experimental flow chart of these experiments is shown in Figure 2. Here we show a model circuit, that of direction-selectivity in the mouse retina. We examine the connectivity of starburst amacrine cells (SACs) to retinal ganglion cells (RGCs).

A method of tracing synaptically connected neurons is described. We use TVA specificity of an upstream cell to probe whether a cell population of interest receives synaptic input from genetically defined cell types.

Rastreamento de viral geneticamente definido Neural dos circuitos

Classical methods for studying neuronal circuits are fairly low throughput. Transsynaptic viruses, particularly the pseudorabies (PRV) and rabies virus ...

Electroporation of the Hindbrain to Trace Axonal Trajectories and Synaptic Targets in the Chick Embryo

Electroporation of the chick embryonic neural tube has many advantages such as being quick and efficient for the expression of foreign genes into neuronal cells. In this manuscript we provide a method that demonstrates uniquely how to electroporate DNA into the avian hindbrain at E2.75 in order to specifically label a subset of neuronal progenitors, and how to follow their axonal projections and synaptic targets at much advanced stages of development, up to E14.5. We have utilized novel genetic tools including specific enhancer elements, Cre/Lox - based plasmids and the PiggyBac-mediated DNA transposition system to drive GFP expression in a subtype of hindbrain cells (the dorsal most subgroup of interneurons, dA1). Axonal trajectories and targets of dA1 axons are followed at early and late embryonic stages at various brainstem regions. This strategy contributes advanced techniques for targeting cells of interest in the embryonic hindbrain and for tracing circuit formation at multiple stages of development.

How neuronal networks are established in the embryonic brain is a fundamental question in developmental neurobiology. Here we combined an electroporation technique with novel genetic tools, such as Cre/Lox&#x2013;plasmids and PiggyBac-mediated DNA transposition system in the avian hindbrain to label dorsal interneurons and track their axonal projections and synaptic targets at various developmental stages.

Eletroporação do rombencéfalo rastrear Trajetórias axonal e Metas Synaptic no embrião de galinha

Electroporation of  the chick embryonic neural tube has many advantages such as being quick and efficient  for the expression of foreign genes into ...

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Genetic modification of specific regions of the developing mammalian brain is a very powerful experimental approach. However, generating novel mouse mutants is often frustratingly slow. It has been shown that access to the mouse brain developing in utero with reasonable post-operatory survival is possible. Still, results with this procedure have been reported almost exclusively for the most superficial and easily accessible part of the developing brain, i.e. the cortex. The thalamus, a narrower and more medial region, has proven more difficult to target. Transfection into deeper nuclei, especially those of the hypothalamus, is perhaps the most challenging and therefore very few results have been reported. Here we demonstrate a procedure to target the entire hypothalamic neuroepithelium or part of it (hypothalamic regions) for transfection through electroporation. The keys to our approach are longer narcosis times, injection in the third ventricle, and appropriate kind and positioning of the electrodes. Additionally, we show results of targeting and subsequent histological analysis of the most recessed hypothalamic nucleus, the mammillary body.

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Despite the functional and medical importance of the hypothalamus, in utero genetic manipulation of its development has rarely been attempted. We show a detailed procedure for in utero electroporation into the mouse hypothalamus and show representative results of total and partial (regional) hypothalamic transfection.

Manipulação genética do rato em desenvolvimento Hipotálamo através<em&gt; In utero</em&gt; Eletroporação

Genetic  modification of specific regions of the developing mammalian brain is a very  powerful experimental approach. However, generating novel mouse ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

Imagens ao vivo da mitose no desenvolvimento Cortex embrionárias de camundongos

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the ...

Two-Photon in vivo Imaging of Dendritic Spines in the Mouse Cortex Using a Thinned-skull Preparation

In the mammalian cortex, neurons form extremely complicated networks and exchange information at synapses. Changes in synaptic strength, as well as addition/removal of synapses, occur in an experience-dependent manner, providing the structural foundation of neuronal plasticity. As postsynaptic components of the most excitatory synapses in the cortex, dendritic spines are considered to be a good proxy of synapses. Taking advantages of mouse genetics and fluorescent labeling techniques, individual neurons and their synaptic structures can be labeled in the intact brain. Here we introduce a transcranial imaging protocol using two-photon laser scanning microscopy to follow fluorescently labeled postsynaptic dendritic spines over time in vivo. This protocol utilizes a thinned-skull preparation, which keeps the skull intact and avoids inflammatory effects caused by exposure of the meninges and the cortex. Therefore, images can be acquired immediately after surgery is performed. The experimental procedure can be performed repetitively over various time intervals ranging from hours to years. The application of this preparation can also be expanded to investigate different cortical regions and layers, as well as other cell types, under physiological and pathological conditions.

Two-Photon in vivo Imaging of Dendritic Spines in the Mouse Cortex Using a Thinned-skull Preparation

Time-lapse imaging in the living animal provides valuable information on structural reorganization in the intact brain. Here, we introduce a thinned-skull preparation that allows transcranial imaging of fluorescently labeled synaptic structures in the living mouse cortex by two-photon microscopy.

Two-Photon<em&gt; In vivo</em&gt; Imagem de espinhas dendríticas no Rato Cortex Usando um desbaste-crânio Preparação

In the mammalian cortex, neurons form extremely complicated networks and exchange information at synapses. Changes in synaptic strength, as well as ...

Laser-guided Neuronal Tracing In Brain Explants

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake through electroporation in brain explants with targeted laser illumination and matching filter goggles during the procedure. The described technique of in vitro electroporation by itself yields relatively good visual control for targetting certain areas of the brain. By combining it with laser excitation of fluorescent genetic markers and their read-out through band-passing filter goggles, which can pick up the emissions of the genetically labeled cells/nuclei and the fluorescent tracing dye, a researcher can substantially increase the accuracy of injections by finding the area of interest and controlling for the dye-spread/uptake in the injection area much more efficiently. In addition, the laser illumination technique allows to study the functionality of a given neurocircuit by providing information about the type of neurons projecting to a certain area in cases where the GFP expression is linked to the type of transmitter expressed by a subpopulation of neurons.

We describe a technique to label neurons and their processes via anterograde or retrograde tracer injections into brain nuclei using an in vitro preparation. We modified an existing method of in vitro tracer electroporation by taking advantage of fluorescently labeled mouse mutants and basic optical equipment in order to increase labeling accuracy.

Neuronal Tracing em explantes cérebro guiadas a laser

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake ...

Time-lapse Confocal Imaging of Migrating Neurons in Organotypic Slice Culture of Embryonic Mouse Brain Using In Utero Electroporation

In utero electroporation is a rapid and powerful approach to study the process of radial migration in the cerebral cortex of developing mouse embryos. It has helped to describe the different steps of radial migration and characterize the molecular mechanisms controlling this process. To directly and dynamically analyze migrating neurons they have to be traced over time. This protocol describes a workflow that combines in utero electroporation with organotypic slice culture and time-lapse confocal imaging, which allows for a direct examination and dynamic analysis of radially migrating cortical neurons. Furthermore, detailed characterization of migrating neurons, such as migration speed, speed profiles, as well as radial orientation changes, is possible. The method can easily be adapted to perform functional analyses of genes of interest in radially migrating cortical neurons by loss and gain of function as well as rescue experiments. Time-lapse imaging of migrating neurons is a state-of-the-art technique that once established is a potent tool to study the development of the cerebral cortex in mouse models of neuronal migration disorders.

Time-lapse Confocal Imaging of Migrating Neurons in Organotypic Slice Culture of Embryonic Mouse Brain Using In Utero Electroporation

This protocol provides instructions for direct observation of radially migrating cortical neurons. In utero electroporation, organotypic slice culture, and time-lapse confocal imaging are combined to directly and dynamically study the effects of overexpression or downregulation of genes of interest in migrating neurons and to analyze their differentiation during development.

Imaginação confocal de lapso de tempo de neurônios migratórios na cultura de fatias organotípicas do cérebro de mouse embrionário Usando<em&gt; Em Utero</em&gt; Electroporação

In utero electroporation is a rapid and powerful approach to study the process of radial migration in the cerebral cortex of developing mouse embryos. It ...

Condicional Genetic transsináptica Tracing no Embryonic do cérebro do rato

Resumo

Explore mais vídeos

Capítulos neste vídeo

Análise mosaico de função do gene em desenvolvimento pós-natal do rato do cérebro usando Virus baseado Recombinação Cre

Mouse No Utero Eletroporação: Transfecção Gênica Controlled Spatiotemporal

Visualização e manipulação genética de dendritos e espinhas no córtex cerebral e hipocampo do rato usando

Rastreamento de viral geneticamente definido Neural dos circuitos

Eletroporação do rombencéfalo rastrear Trajetórias axonal e Metas Synaptic no embrião de galinha

Manipulação genética do rato em desenvolvimento Hipotálamo através

Imagens ao vivo da mitose no desenvolvimento Cortex embrionárias de camundongos

Two-Photon

Neuronal Tracing em explantes cérebro guiadas a laser

Imaginação confocal de lapso de tempo de neurônios migratórios na cultura de fatias organotípicas do cérebro de mouse embrionário Usando