We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

הערה: אתיקה הצהרה: נהלים כרוכים בנושאי בעלי חיים אושרו על ידי ועדת רווחת בעלי החיים של אוניברסיטת המבורג ובאוניברסיטת Saarland. 1. הכנה וקיבוע של רקמה העוברית <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מסדרים את כל הציוד הדרוש ללנתח את העוברים ולהכין פתרונות לקיבעון הבא של הרקמה לפני להקריב בעלי החיים. הערה: תמיד להכין פתרון paraformaldehyde 4% טריים (PFA) (4% PFA ב 0.1 M מלוח פוספט (PBS), להתאים את ה- pH 7.4). </li><li style=";text-align:right;direction:rtl"> להרדים נקבת עכבר בהריון בעיתוי בנוהל שאושר מבחינה אתית. </li><li style=";text-align:right;direction:rtl"> העבר את העכבר על גבי פלטפורמה. להרטיב את הצד הגחוני של הבטן עם 70% אתנול ו לעשות חתך אנכי באמצעות מספריים חדים לחשוף את חלל הבטן. </li><li style=";text-align:right;direction:rtl"> זהה את השרשרת העוברית ולמשוך אותו החוצה מלקחיים בוטים באמצעות זהירות ולמקם אותו לתוך PBS קר כקרח. </li><li style=";text-align:right;direction:rtl"> הסר את העוברים הבודדים מהשרשרת העוברית באמצעות מספריים ומלקחיים בסדר. הסרה של רקמה נוספת סביב העוברים ולשטוף אותם בPBS קר כקרח. </li><li style=";text-align:right;direction:rtl"> לקחת ביופסיה זנב קטנה (לפני העברת העובר לPFA) ודגירה אותו במאגר תמוגה זנב לזיהוי המין וgenotyping אלל נותב PCR. </li><li style=";text-align:right;direction:rtl"> תתחיל מהעובר בצד לרוחב ביותר ולהעביר כל עובר בנפרד לתוך צינור המכיל 4% PFA קר כקרח על קרח על שייקר. </li><li style=";text-align:right;direction:rtl"> משרים את העוברים בגיל צעיר יותר E13.5 או עבור 1.5 שעות על קרח עם רעד קבוע. משרים את העוברים בE14.5 הגיל וE15.5 תמורת 2.5 שעות על קרח עם רעד קבוע. </li><li style=";text-align:right;direction:rtl"> לE16.5 גיל עוברים או יותר, לערוף ולהסיר את העור החיצוני לפני השריית הראש בפתרון PFA. ראשי עוברי E16.5 יכולים להיות טבולים תמורת 4.5 שעות על קרח עם רעד קבוע. </li><li style=";text-align:right;direction:rtl"> לאחר הקיבוע מתאים, לשטוף את העוברים שלוש פעמים עם PBS קר כקרח. מעביר את העוברים לתוך סוכרוז 30% בפתרון PBS על 4 מעלות צלזיוס עד שהם שוקעיםלתחתית. </li></ol> 2. הקפאה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לסדר את כל החומרים הדרושים לפני שמתחיל את תהליך ההקפאה: cryo-עובש, cryo-כפפות, מלקחיים אנטומולוגיה במשקל הנוצה, בטוש ומתחם טמפרטורה אופטימלי חיתוך (אוקטובר) </li><li style=";text-align:right;direction:rtl"> תווית cryo-העובש עם סמן אלכוהול עמיד קבוע (להזכיר את הכיוון של רקמות, תאריך וגנוטיפ). הכן רפש של קרח יבש כתוש ו 100% אתנול בדלי קרח. מניחים כוס זכוכית בתוך המכיל איזופנטאן. חכה 10 דקות לאיזופנטאן להתקרר. </li><li style=";text-align:right;direction:rtl"> בינתיים להסיר את הרקמה מפתרון סוכרוז, נגב את סוכרוז העודף סביב הרקמות באמצעות מגבוני מעבדה. העברת הרקמה לתוך cryo-עובש שכותרתו מראש עם אוקטובר מספיק כדי לכסות את הרקמה. הימנע מכל בועות אוויר ב- OCT; במיוחד סביב הרקמה. </li><li style=";text-align:right;direction:rtl"> כוון את הרקמה ב אוקטובר באמצעות מלקחיים אנטומולוגיה במשקל נוצה, כדי למנוע נזק לרקמות. התחל הקפאה על ידי העברת cryo-molד לאמבטיה איזופנטאן מקורר מראש. לא להתיז איזופנטאן ל- OCT כפי שהוא לא להקפיא כראוי. עטוף את הדגימות ברדיד אלומיניום ולאחסן ב -80 ° C. </li></ol> 3. Cryosectioning <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לחתוך 14 מיקרומטר חלקים סידוריים דקים בסדרה &quot;חמש באמצעות cryostat ולאסוף בשקופיות זכוכית SuperFrost® פלוס עבור immunofluorescence ניתוח (IF). אחסן את השקופיות ב -80 ° C עד מנוצל. </li></ol> 4. הדמיה Tracer שימוש בפרוטוקול Tyramide איתותים ההגברה (TSA) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן את המאגרים וחומרים כימיים הנדרשים לצביעה. תמיד טרי להכין את חיץ טריס-NaCl-Tween (TNT) ביום השימוש. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן חיץ TNT באמצעות 100 מיליליטר של 1 M טריס- HCl pH 7.5, 30 מיליליטר של 5 M NaCl וDDH 2 O עד נפח סופי של 1 ל הוסף 500 μl של Tween 20 בעזרת פיפטה 1 מיליליטר. הוסף את Tween 20 לאט ולשטוף את פיפטה מעלה ומטה מספר פעמים כדי לוודא שכל Tween 20 הוא בפתרון. </li><li style=";text-align:right;direction:rtl"> הכן טריס-NaCl-חסימת חיץ (TNB) באמצעות של 1 M טריס-HCl 100 מיליליטר 7.5 pH, 30 מיליליטר של 5 M NaCl וDDH 2 O עד נפח סופי של 1 ל הוסף 5 גרם חסימה מגיב (מסופק עם ערכה) לאט במרווחים קטנים למאגר תוך ערבוב. מחממים את הפתרון בהדרגה ל -55 מעלות צלזיוס עם ערבוב רציף לפזר מגיב חסימה לחלוטין (זה לא צריך לקחת יותר מ30-60 דקות). כדי להשיג חימום אחיד להשתמש אמבט מים ב 55 ° C. הפתרון יופיע חלבי. להביא את הפתרון לטמפרטורת חדר לפני השימוש. Aliquot ולאחסן ב -20 ° C לאחסון לטווח ארוך. </li><li style=";text-align:right;direction:rtl"> מחדש מגיב ביוטין tyramide (מצורף לערכה) בכיתה HPLC-ביולוגיה מולקולרית / DMSO. תלוי איזה ערכה משמשת את הכמות המתאימה של DMSO עשויה להשתנות. אחסן את פתרון המניות ב 4 מעלות צלזיוס. הערה: סעיפים מבעלי חיים הטרוזיגוטיים לאללים Cre וR26 המתאימים יכולים לשמש לניתוח מעגל. שימוש שלections מהמלטת ביצוע Cre אחד או אחת אלל R26, בהתאמה, כפקדים שליליים. פנק את שקופיות בקרה שליליות בדיוק כמו שקופיות מבעלי חיים כפולים הטרוזיגוטיים. בנוסף, כולל שקופיות שליטה אחד מבעלי חיים כפולים הטרוזיגוטיים אבל להשאיר את מגיב TSA (שליטת unamplified). </li></ol></li><li style=";text-align:right;direction:rtl"> באמצעות אזמל טרי חד להסיר אוקטובר העודף המקיף את חלקי רקמות ולסמן את הגבול סביב החלקים עם עט PAP. </li><li style=";text-align:right;direction:rtl"> ייבש את השקופיות במשך 2-3 דקות בטמפרטורת חדר (RT). שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד. דגירה השקופיות ב RT למשך 30 דקות בשיעור של 0.3% פתרון H 2 O 2 במתנול קר כקרח כדי להרוות את פעילות peroxidase אנדוגני. </li><li style=";text-align:right;direction:rtl"> 3x לשטוף עם PBS במשך 5 דקות כל אחד ב RT. דגירה של 10 דקות ב 0.5% Triton-X 100 בPBS לpermeabilization רקמות. שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד. </li><li style=";text-align:right;direction:rtl"> בלוק עם TNB (חסימת פתרון, 200-300 μl לכל שקופית) במשך 30דקות ב RT בתא humidified. ודא שכל החלקים מכוסים לחלוטין על ידי TNB. אל תתנו לשקופיות להתייבש בין הצעדים. </li><li style=";text-align:right;direction:rtl"> מסננים את חיץ חסימת עודף ולהחיל antiserum העיקרי הכרה נותב (1: 1,000 העז נגד WGA לBL, 1: 15,000 ארנב נגד GFP לGTT) מדולל בTNB לשעה 2 ב RT או הלילה ב 4 מעלות צלזיוס. הקפד להשתמש נפח מספיק כדי לכסות את קטע הרקמה (200-300 μl לכל שקופית) לחלוטין. הערה: דילולים antisera העיקריים המומלצים כאן עשויים להיות מותאמים. </li><li style=";text-align:right;direction:rtl"> שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד עם תסיסה. </li><li style=";text-align:right;direction:rtl"> דגירה הקטעים עם antiserum המשני biotinylated הכרה בשורה של antiserum הראשון (1: IgG 500 הסוס האנטי-העז לאנטי-WGA, 1: IgG נגד ארנב העז 5,000 לאנטי-GFP בTNB עבור שעה 1 ב RT). </li><li style=";text-align:right;direction:rtl"> 3x לשטוף עם TNT ב RT במשך 5 דקות כל אחד עם תסיסה. דגירה ב 1: 100 streptavidin (SA) peroxidase חזרת -conjugated (SA-HRP wi, ובלבדth הערכה) בTNB למשך 30 דקות ב RT בתא humidified. שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד. בינתיים להפשיר TSA. </li><li style=";text-align:right;direction:rtl"> לדלל TSA 01:50 בdiluent ההגברה TSA (מצורפת לערכה; להשתמש בערכת TSA להדמיה של BL וערכת TSA + לGTT). דגירה סעיפי הרקמות בTSA המדולל לבדיוק 10 דקות ב RT. לדלל TSA רק לפני השימוש, באופן אידיאלי בשלב הכביסה הקודם, לא להשתמש בכל מגיב TSA מדולל שנותר לניסויים עתידיים; תמיד להכין טרי. </li><li style=";text-align:right;direction:rtl"> שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד עם תסיסה. דגירה עם 1: 500 המצומד Alexa Fluor® 546 streptavidin בTNB למשך 30 דקות ב RT. שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד עם תסיסה. </li><li style=";text-align:right;direction:rtl"> דגירה של 10 דקות ב 5% פתרון bisbenzimide PBS ב RT עבור מכתים גרעיני. שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד עם תסיסה. הר עם Fluromount G ולבצע epifluorescence או confocal. <em&gt; פתרון בעיות: יעילות של העברה נותב תהיה תלויה ברמת הביטוי של מוקד ROSA26 בתאים המייצרים (שנקבע על ידי קו נהג Cre בשימוש) ועל המעגלים העצביים ניתחה (למשל מספר הנוירונים הפקה נותב, וכו &#39;התכנסות). לכן דילולים antisera העיקריים המומלצים כאן עשויים להיות מותאמים כדי למנוע אות נמוכה או עודפת. רקע תמיד צריך לנתח באמצעות שקופיות בקרה מתאימות (ראה לעיל). </li></ol> 5. τlacZ מכתים לסעיפים עובריים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן את המאגרים וחומרים כימיים הנדרשים לצביעה. תמיד טרי להכין את חיץ C LacZ לפני השימוש. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן 5-bromo-4-כלורו-3-indolyl-β-D-galactopyranoside (X-gal) פתרון מניות (40 מ&quot;ג / מיליליטר) על ידי הוספת 40 גרם של X-gal עד 1 dimethylformamide מיליליטר 70% (DMF). מכסה ברדיד האלומיניום ולאחסן ב -20 ° C לאחסון לטווח ארוך. </li><li style=";text-align:right;direction:rtl"> הכן tetrazolium הכחול ניטרו (NBT) stפתרון Ock (50 מ&quot;ג / מיליליטר) על ידי הוספת 50 גרם של NBT לDMF 1 מיליליטר 70%. מכסה ברדיד האלומיניום ולאחסן ב -20 ° C לאחסון לטווח ארוך. </li><li style=";text-align:right;direction:rtl"> הכן LacZ קוֹבֵעַ באמצעות 80 μl של glutaraldehyde 25%, 5 מיליליטר של 4% PFA, 20 μl של 1 M MgCl 2, של 500 מ&quot;מ EGTA 100 μl, 1 מיליליטר של חיץ pH M פוספט 1 7.4 וDDH 2 O עד גמר נפח של 10 מיליליטר. </li><li style=";text-align:right;direction:rtl"> הכן LacZ חיץ 1 מיליליטר באמצעות של 1 M MgCl 2, 5 מיליליטר של 500 מ&quot;מ EGTA, 50 מיליליטר של 1 M pH חיץ פוספט 7.4 וDDH 2 O עד נפח סופי של 500 מיליליטר. </li><li style=";text-align:right;direction:rtl"> הכן B חיץ LacZ באמצעות 1 מיליליטר של 1 M MgCl 2, 5 מיליליטר של 500 מ&quot;מ EGTA, 5 deoxycholate מיליליטר של 1% נתרן, 10% NP-40 100 מיליליטר, 50 מיליליטר של חיץ פוספט pH 1 M 7.4 וDDH 2 O עד נפח סופי של 500 מיליליטר. </li><li style=";text-align:right;direction:rtl"> הכן חיץ C LacZ על ידי הוספת 10 μl של פתרון מניות NBT ו12.5 μl של מניות פתרון X-gal עד 1 מיליליטר של חיץ B. LacZ הפוך טרי רק לפני השימוש ומכסים ברדיד אלומיניום. </li></ol&gt; </li><li style=";text-align:right;direction:rtl"> ייבש את השקופיות ב RT לפחות במשך 10-15 דקות (בינתיים להכין שקופיות עם עט PAP). </li><li style=";text-align:right;direction:rtl"> לתקן את הסעיף עם LacZ קוֹבֵעַ למשך 2 דקות בטמפרטורת חדר בתא humidified בתוך קטר-מנדף כימי. לשטוף 3 פעמים עם PBS בתוספת 2 מ&quot;מ MgCl 2. </li><li style=";text-align:right;direction:rtl"> יש לשטוף את השקופיות עם א &#39;חיץ LacZ שטוף את השקופיות עם LacZ חיץ 3 פעמים במשך 10 דקות כל אחד ב RT. לשטוף 2 פעמים עם החיץ B LacZ במשך 5 דקות כל אחד. דגירה השקופיות בC חיץ LacZ ב30-37 מעלות צלזיוס במשך שעה 6 או לילה בתא humidified. הערה: הוספת נפח מספיק של חיץ C LacZ; שקופיות לא צריכים להתייבש במהלך דגירה. </li><li style=";text-align:right;direction:rtl"> לאחר הדגירה מתאימה לשטוף את השקופיות עם PBS בתוספת 2 מ&quot;מ MgCl 2. יש לשטוף את החלקים בקצרה עם DDH 2 O. Coverslip עם ג&#39;לטין גליצין של מאיר. מתאים למיקרוסקופ אור מצויד בסט-אפ הדמיה התערבות ההפרש לעומת זאת (DIC). </li></ol> 6. Gendאה וGenotyping Tracer <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן מאגר תמוגה זנב באמצעות 1 מיליליטר של 1 M טריס- HCl pH 8.5, של 500 מ&quot;מ EGTA 100 μl, 200 μl של 10% SDS, 400 μl של 5 M NaCl וDDH 2 O כדי לפצות נפח סופי של 10 מיליליטר. </li><li style=";text-align:right;direction:rtl"> הוסף 500 μl של חיץ תמוגה זנב לכל צינור Eppendorf המכיל ביופסית זנב. להוסיף K proteinase לריכוז סופי של 100 מ&quot;ג / מיליליטר. דגירה הלילה על שייקר ב 55 ° C. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה דגימות 17,000 XG במשך 10 דקות ב RT. מעביר את supernatant לצינור צנטריפוגות חדש. הוסף 500 μl של isopropanol לsupernatant. מערבבים במשך לפחות 5 דקות על ידי היפוך הצינורות למעלה ולמטה. </li><li style=";text-align:right;direction:rtl"> ספין בצנטריפוגות ב 17,000 XG במשך 5 דקות בRT. יוצקים את supernatant. הוסף 200 μl של 70% אתנול. לנער במשך 5 דקות לפחות. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה ב17,000 XG במשך 5 דקות. הסר supernatant עם Pipetman (לא לשפוך את). ייבש את הכדור בתא חם (37 מעלות צלזיוס) במשך 15-30 דקות. </li><li style=";text-align:right;direction:rtl"> גלולה גלולה ב100 μlpH הנמוך TE 8.0 או מים באמצעות טיפים רחבים נשא מסוננים. שים ב -55 מעלות צלזיוס במשך שעה 1 ועל 37 מעלות צלזיוס למשך הלילה להמסה נכונה. חנות ב 4 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> השתמש μl 1 של ה- DNA לתגובת PCR (תערובת תגובת 50 μl המכילה 1 μl של DNA זנב, 2.5 μl DMSO, 10:00 של כל צבע יסוד, 25 מיקרומטר של כל dNTP, וbetaine 1M). פריימרים PCR לgenotyping וזיהוי מין רשומים בטבלת חומרים. </li></ol>

<ol>
	<li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals.">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li><li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+approaches+to+neural+circuits+in+the+mouse.">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li><li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+half+century+of+experimental+neuroanatomical+tracing.">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li><li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus.">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li><li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero.">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li><li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+approach+to+trace+neural+circuits.">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li><li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice.">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li><li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54.">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li><li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GPR54+gene+as+a+regulator+of+puberty.">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li><li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons.">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li><li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice.">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67 (2005).</li><li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene.">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li><li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-activated+site-specific+recombination+in+mice.">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li></ol>

No conflict of interest declared.

יש להביע קליעים נותבים transsynaptic כtransgenes להתחקות המעגלים העצביים של אוכלוסיות נוירונים מוגדרות גנטי יש מספר יתרונות בהשוואה להזרקת stereotaxic של קליעים נותבים או וירוסי neurotopic. ראשית, נותב מופק כחלבון אנדוגני ולכן אינו מפיק כל תגובה חיסונית ומסלול עצבי סלקטיבית ניתן לנתח ב?...

מעקב נתיב האנטומי הוא אחד הכלים הנפוצים ביותר בשימוש לפענח את הקשר בין המוח והתנהגות 1. קידום בטכנולוגיות מעגל התחקות עצביות העניק מדעני מוח עם היכולת לעקוב אחר מעגלים עצביים מאוכלוסיות נוירון זיהו גנטי בעכברים 2. למרות התקדמות הטכנולוגית אלה נותרים מאתגרים לפענח את היווצרותם של מעגלים עצביים במיוחד בתקופת התבגרות עוברית. סיבה לכך הוא שרוב שיטות המעקב שפותחו עד היום מבוססים על הזרקת stereotaxic של קליעים נותבים transsynaptic או וירוסי neurotropic מהונדסים גנטי (איור 1) 2,3. בעוד טכניקות אלה להשיג רזולוציה מרחב ובזמן של קישוריות, כמה מגבלות מובנות כגון זריקות נותב מאתגרות מבחינה טכנית למוח המתפתח, שחזור של אתר הזרקה, דלקת פוטנציאלית במקום ההזרקה וimpor ביותרcytotoxicity tantly נגרמת על ידי וירוסי neurotropic להגביל את השימוש בם 4. שיטה חלופית היא להביע קליעים נותבים transsynaptic כtransgenes בעכברים שעברו מוטציה גנטית. יש לנו לאחרונה שונו בטכניקה זו ופיתחתי מערכת בינארית transsynaptic גנטי התחקות למפות את המעגלים העצביים של כל אוכלוסייה עצבית מזוהה גנטי 5. האסטרטגיה הניסיונית שלנו מבוססת על שני זנים חדשים לדפוק בעכבר, המבטאים גם לקטינים שעורה נותב דו-כיווני (BL) 6 או בר רעלנים נותב מדרדר C התמזג GFP (GTT) 7 מלוקוס ROSA 26 לאחר Cre תיווך רקומבינציה. כאן אנו משמשים זני עכבר אלו כדי להביע את BL וGTT בתאי עצב המייצרים kisspeptin, neuropeptide שמעורב בויסות ההתבגרות של ציר הרבייה 8,9 באופן סלקטיבי. אנו מראים כי טכניקה זו היא מתאימה כדי לחזות את ההתפתחות והתבגרות של נשיקהמעגלים עצביים peptin במהלך התפתחות עוברית של מוח העכבר נקבת 5. אסטרטגית רבייה R26-BL-IRES-τlacZ (BIZ) והקווים נותב R26-GFP-TTC (GTT) הם לדפוק בזנים 5 שנושאים אללים ROSA26 רקומביננטי. R26-BIZ ואללים R26-GTT הם תעתיק שקטים בשל נוכחותם של איתות חזקה תעתיק תחנה, שמעוטרת בשני אתרי loxP 5. ביטוי של transgene BIZ וGTT מופעל על ידי ההסרה בתיווך Cre של אות תחנת תעתיק. ניתן להשתמש אללים R26-BIZ וR26-GTT באופן עצמאי על ידי פשוט חצייה עם קו נהג Cre. להטרוזיגוטיים בעלי חיים ניתוח לאללים Cre וR26 המתאימים ניתן להשתמש. המלטת ביצוע Cre אחד או אחת אלל R26, בהתאמה, צריכה לשמש כקבוצת ביקורת. לחלופין, אפשר גם ליצור triple לדפוק בבעלי חיים שנשאו את אללים Cre, R26-BIZ וR26-GTT, אולם זה יחייב צלב אחד נוסף.

<table border="0" cellpadding="0" cellspacing="0" width="721">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:219px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bisbenzimide (Hoechst 33258 dye)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">14530-100MG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">32205-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryo mold (Peel-a-way)</td>
			<td style="width:219px;">Polyscience Inc.</td>
			<td style="width:119px;">18646A-1</td>
			<td>22mm x 22mm x 20mm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DMSO</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D8418-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Dimethyl Formamide (DMF)</td>
			<td style="width:219px;">VWR Chemicals</td>
			<td style="width:119px;">23470,293</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EGTA</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3054.3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fluoromount G</td>
			<td style="width:219px;">Southern Biotech</td>
			<td style="width:119px;">0100-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glutaraldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">G5882-50ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hydrogen peroxide</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">34988-7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Isopentane (Methyl 2-butane)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">M32631-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kaiser&#39;s Glycine gelatin</td>
			<td style="width:219px;">Merck</td>
			<td style="width:119px;">1092420100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Methanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">494437-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">MgCl2</td>
			<td style="width:219px;">Sigma</td>
			<td>M2670-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NaCl</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">HN00.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NBT</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">298-83-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Nonidet P40 substitute</td>
			<td style="width:219px;">Fluka</td>
			<td style="width:119px;">743.85</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">OCT</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">14020108926</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PAP pen</td>
			<td style="width:219px;">Dako</td>
			<td style="width:119px;">S2002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Parafarmaldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">P6148-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium deoxycholate</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D6750-25G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sucrose</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">S7903-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Superfrost slides</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">FT4981GLPLUS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL700</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA plus kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL749A001KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">AE15.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Triton-X 100</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3051.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tween 20</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">9127.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">X-gal</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">2315.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryostat</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">na</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Light microscope equipped with DIC imaging&#160;</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Fluroscence microscope</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Photoshop</td>
			<td style="width:219px;">Adobe</td>
			<td style="width:119px;">PS6</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Goat anti-WGA (recognizes BL)</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">AS-2024</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylayted horse anti-goat IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-9500&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated goat anti-rabbit IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-1000&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Rabbit anti-GFP (recognizes GTT)</td>
			<td style="width:219px;">Invitrogen</td>
			<td style="width:119px;">A11122</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rabbit anti-GnRH</td>
			<td style="width:219px;">Affinity Bio Reagent</td>
			<td style="width:119px;">PA1-121</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dylight488-donkey anti-rabbit IgG</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">SA5-10038</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SA-Alexa Fluor 546</td>
			<td style="width:219px;">Life Technologies</td>
			<td>S-11225</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Primers</td>
			<td style="width:219px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Fwd (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;ATGAAGATGATGAGCACCAG 
			GGC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Rev&#160; (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;AGCCCTCGCCGCAGAACTC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Fwd&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCGATGCAACGAGTGATGAG 
			GTTCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Rev&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCAGGCTAAGTGCCTTCTCTAC 
			ACCTGC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Fwd&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">AGCAAGGGCGAGGAGCTGTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Rev&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCTTGTAGTTGCCGTCGTCCT 
			TGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Fwd (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">TGAAGCTTTTGGCTTTGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Rev&#160; (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCGCTGCCAAATTCTTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ROSA26 Fwd</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">ROSA26 Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">GCAGATGGAGCGGGAGAAAT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">SA Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
	</tbody>
</table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

סעיף זה מציג תוצאות נציג שניתן להשיג בעבודה עם R26-BIZ (Z RES-τlac L- אני B) וR26-GTT (G FP- TT C) אללים. כאן אנו משתמשים R26-BIZ ואללים R26-GTT לנתח את ההבשלה של המעגלים העצביים המסדירים את ציר הרבייה. הרבייה בבעלי החוליות נשלטת מרכזית על ידי קבוצה קטנה של תאי עצב בהי...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

מותנה הגנטי Transsynaptic איתור במוח העכבר עוברי

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.6K Views.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

Video: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Manual Drainage of the Zebrafish Embryonic Brain Ventricles

Cerebrospinal fluid (CSF) is a protein rich fluid contained within the brain ventricles. It is present during early vertebrate embryonic development and persists throughout life. Adult CSF is thought to cushion the brain, remove waste, and carry secreted molecules1,2. In the adult and older embryo, the majority of CSF is made by the choroid plexus, a series of highly vascularized secretory regions located adjacent to the brain ventricles3-5. In zebrafish, the choroid plexus is fully formed at 144 hours post fertilization (hpf)6. Prior to this, in both zebrafish and other vertebrate embryos including mouse, a significant amount of embryonic CSF (eCSF) is present . These data and studies in chick suggest that the neuroepithelium is secretory early in development and may be the major source of eCSF prior to choroid plexus development7.
eCSF contains about three times more protein than adult CSF, suggesting that it may have an important role during development8,9. Studies in chick and mouse demonstrate that secreted factors in the eCSF, fluid pressure, or a combination of these, are important for neurogenesis, gene expression, cell proliferation, and cell survival in the neuroepithelium10-20. Proteomic analyses of human, rat, mouse, and chick eCSF have identified many proteins that may be necessary for CSF function. These include extracellular matrix components, apolipoproteins, osmotic pressure regulating proteins, and proteins involved in cell death and proliferation21-24. However, the complex functions of the eCSF are largely unknown.
We have developed a method for removing eCSF from zebrafish brain ventricles, thus allowing for identification of eCSF components and for analysis of the eCSF requirement during development. Although more eCSF can be collected from other vertebrate systems with larger embryos, eCSF can be collected from the earliest stages of zebrafish development, and under genetic or environmental conditions that lead to abnormal brain ventricle volume or morphology. Removal and collection of eCSF allows for mass spectrometric analysis, investigation of eCSF function, and reintroduction of select factors into the ventricles to assay their function. Thus the accessibility of the early zebrafish embryo allows for detailed analysis of eCSF function during development.

We present a method to collect cerebrospinal fluid (CSF) and to create a system which lacks CSF within the embryonic zebrafish brain ventricular system. This allows for further examination of CSF composition and its requirement during embryonic brain development.

ניקוז ידני של חדרי המוח העוברי דג הזברה

Cerebrospinal fluid  (CSF) is a protein rich fluid contained within the brain ventricles. It is  present during early vertebrate embryonic development and ...

Selective Tracing of Auditory Fibers in the Avian Embryonic Vestibulocochlear Nerve

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling of auditory axons within the VIIIth cranial nerve would enhance the study of central auditory circuit development. This approach is challenging because multiple sensory organs of the inner ear contribute to the VIIIth nerve 1. Moreover, markers that reliably distinguish auditory versus vestibular groups of axons within the avian VIIIth nerve have yet to be identified. Auditory and vestibular pathways cannot be distinguished functionally in early embryos, as sensory-evoked responses are not present before the circuits are formed. Centrally projecting VIIIth nerve axons have been traced in some studies, but auditory axon labeling was accompanied by labeling from other VIIIth nerve components 2,3. Here, we describe a method for anterograde tracing from the acoustic ganglion to selectively label auditory axons within the developing VIIIth nerve. First, after partial dissection of the anterior cephalic region of an 8-day chick embryo immersed in oxygenated artificial cerebrospinal fluid, the cochlear duct is identified by anatomical landmarks. Next, a fine pulled glass micropipette is positioned to inject a small amount of rhodamine dextran amine into the duct and adjacent deep region where the acoustic ganglion cells are located. Within thirty minutes following the injection, auditory axons are traced centrally into the hindbrain and can later be visualized following histologic preparation. This method provides a useful tool for developmental studies of peripheral to central auditory circuit formation.

Here we describe a microdissection technique followed by fluorescent dye injection into the acoustic ganglion of early chick embryos for selective tracing of auditory axon fibers in the nerve and hindbrain.

איתור סלקטיבי של סיבי עצב שמיעה בVestibulocochlear העוברי העופות

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling ...

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

הזרקת Stereotaxic של וקטור ויראלי למניפולציה גנטית מותנית בחוט השדרה המאוס

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

Angiogenesis is the complex process of new blood vessel formation defined by the sprouting of new blood vessels from a pre-existing vessel network. Angiogenesis plays a key role not only in normal development of organs and tissues, but also in many diseases in which blood vessel formation is dysregulated, such as cancer, blindness and ischemic diseases. In adult life, blood vessels are generally quiescent so angiogenesis is an important target for novel drug development to try and regulate new vessel formation specifically in disease. In order to better understand angiogenesis and to develop appropriate strategies to regulate it, models are required that accurately reflect the different biological steps that are involved. The mouse neonatal retina provides an excellent model of angiogenesis because arteries, veins and capillaries develop to form a vascular plexus during the first week after birth. This model also has the advantage of having a two-dimensional (2D) structure making analysis straightforward compared with the complex 3D anatomy of other vascular networks. By analyzing the retinal vascular plexus at different times after birth, it is possible to observe the various stages of angiogenesis under the microscope. This article demonstrates a straightforward procedure for analyzing the vasculature of a mouse retina using fluorescent staining with isolectin and vascular specific antibodies.

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

The neonatal murine retina provides a well characterized physiological model of angiogenesis, which permits investigations of the roles of different genes or drugs that modulate angiogenesis in an in vivo context. Immunofluorescent staining to accurately visualize the vascular plexus is pivotal to the success of these types of studies.

מכתים Immunofluorescent הר שלם של רשתית עכבר ילודים לחקר אנגיוגנזה<em&gt; בvivo</em

Angiogenesis  is the complex process of new blood vessel formation defined by the sprouting  of new blood vessels from a pre-existing vessel network. ...

Transsynaptic Tracing from Peripheral Targets with Pseudorabies Virus Followed by Cholera Toxin and Biotinylated Dextran Amines Double Labeling

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This approach has been most extensively used in the brain by utilizing the swine pathogen pseudorabies virus (PRV)1. PRV does not infect great apes, including humans, so it is most commonly used in studies on small mammals, especially rodents. The pseudorabies strain PRV152 expresses the enhanced green fluorescent protein (eGFP) reporter gene and only crosses functional synapses retrogradely through the hierarchical sequence of synaptic connections away from the infection site2,3. Other PRV strains have distinct microbiological properties and may be transported in both directions (PRV-Becker and PRV-Kaplan)4,5&#160;.&#160;This protocol will deal exclusively with PRV152. By delivering the virus at a peripheral site, such as muscle, it is possible to limit the entry of the virus into the brain through a specific set of neurons. The resulting pattern of eGFP signal throughout the brain then resolves the neurons that are connected to the initially infected cells. As the distributed nature of transsynaptic tracing with pseudorabies virus makes interpreting specific connections within an identified network difficult, we present a sensitive and reliable method employing biotinylated dextran amines (BDA) and cholera toxin subunit b (CTb) for confirming the connections between cells identified using PRV152. Immunochemical detection of BDA and CTb with peroxidase and DAB (3, 3&#39;-diaminobenzidine) was chosen because they are effective at revealing cellular processes including distal dendrites6-11.

Transsynaptic tracing has become a powerful tool for analyzing central efferents regulating peripheral targets through multi-synaptic circuits. Here we present a protocol that exploits the transsynaptic pseudorabies virus to identify and localize a functional brain circuit, followed by classical tract tracing techniques to validate specific connections in the circuit between identified groups of neurons.

Transsynaptic איתור ממטרות היקפית עם וירוס Pseudorabies אחריו רעלן כולרה ותיוג Biotinylated Dextran אמינים זוגי

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

בידוד והתרבות של תאי האנדותל מהמוח הקדמי עוברי

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow for an in-depth characterization to identify pathways involved in these events. Cerebellar granule neurons (CGNs) that are derived from the developing cerebellum are an ideal model system that allows for morphological analyses. Here, we describe a method of how to genetically manipulate CGNs and how to study axono- and dendritogenesis of individual neurons. With this method the effects of RNA interference, overexpression or small molecules can be compared to control neurons. In addition, the rodent cerebellar cortex is an easily accessible in vivo system owing to its predominant postnatal development. We also present an in vivo electroporation technique to genetically manipulate the developing cerebella and describe subsequent cerebellar analyses to assess neuronal morphology and migration.

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Neuronal morphogenesis and migration are crucial events underlying proper brain development. Here, we describe methods to genetically manipulate cultured cerebellar granule neurons and the developing cerebellum for the assessment of morphology and migratory characteristics of neurons.

מניפולציה גנטית של Cerebellar גרגיר נוירונים<em&gt; במבחנה</em&gt; ו<em&gt; בVivo</em&gt; ללמוד עצבי מורפולוגיה וגירה

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow ...

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this information to the brain. As such, determining how olfactory information is transferred to the brain, modifying both perception and behavior, merits investigation. Interestingly, there is emerging evidence that cellular transduction and transcriptional factors are involved in the diversification of olfactory receptor neuron. Here we provide a robust whole mount immunological labeling method to assay in vivo olfactory receptor neuron organization. Using this method, we identified all olfactory receptor neurons with anti-ELAV antibody, a known pan-neural marker and Or49a-mCD8::GFP, an olfactory receptor neuron specifically expressed in Nba neuron using anti-GFP antibody.

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Herein we describe the process of whole mount immunostaining of Drosophila antennae, which enables us to better understand the molecular mechanisms involved in the diversification of olfactory receptor neurons (ORN)s.

הר immunolabeling השלם של חוש הריח קולטן נוירונים<em&gt; דרוזופילה</em&gt; אנטנה

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

הדמיה חיה של מיטוזה בCortex עכבר עוברי פיתוח

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the ...

Laser-guided Neuronal Tracing In Brain Explants

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake through electroporation in brain explants with targeted laser illumination and matching filter goggles during the procedure. The described technique of in vitro electroporation by itself yields relatively good visual control for targetting certain areas of the brain. By combining it with laser excitation of fluorescent genetic markers and their read-out through band-passing filter goggles, which can pick up the emissions of the genetically labeled cells/nuclei and the fluorescent tracing dye, a researcher can substantially increase the accuracy of injections by finding the area of interest and controlling for the dye-spread/uptake in the injection area much more efficiently. In addition, the laser illumination technique allows to study the functionality of a given neurocircuit by providing information about the type of neurons projecting to a certain area in cases where the GFP expression is linked to the type of transmitter expressed by a subpopulation of neurons.

We describe a technique to label neurons and their processes via anterograde or retrograde tracer injections into brain nuclei using an in vitro preparation. We modified an existing method of in vitro tracer electroporation by taking advantage of fluorescently labeled mouse mutants and basic optical equipment in order to increase labeling accuracy.

Explants מוח מונחי לייזר עצבי איתור ב

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake ...