Name: conditional genetic transsynaptic tracing in the embryonic mouse brain
Uploaded: 2014-12-22T14:00:00.000+00:00
Duration: 11 min 3 s
Description: Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

הערה: אתיקה הצהרה: נהלים כרוכים בנושאי בעלי חיים אושרו על ידי ועדת רווחת בעלי החיים של אוניברסיטת המבורג ובאוניברסיטת Saarland. 1. הכנה וקיבוע של רקמה העוברית <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מסדרים את כל הציוד הדרוש ללנתח את העוברים ולהכין פתרונות לקיבעון הבא של הרקמה לפני להקריב בעלי החיים. הערה: תמיד להכין פתרון paraformaldehyde 4% טריים (PFA) (4% PFA ב 0.1 M מלוח פוספט (PBS), להתאים את ה- pH 7.4). </li><li style=";text-align:right;direction:rtl"> להרדים נקבת עכבר בהריון בעיתוי בנוהל שאושר מבחינה אתית. </li><li style=";text-align:right;direction:rtl"> העבר את העכבר על גבי פלטפורמה. להרטיב את הצד הגחוני של הבטן עם 70% אתנול ו לעשות חתך אנכי באמצעות מספריים חדים לחשוף את חלל הבטן. </li><li style=";text-align:right;direction:rtl"> זהה את השרשרת העוברית ולמשוך אותו החוצה מלקחיים בוטים באמצעות זהירות ולמקם אותו לתוך PBS קר כקרח. </li><li style=";text-align:right;direction:rtl"> הסר את העוברים הבודדים מהשרשרת העוברית באמצעות מספריים ומלקחיים בסדר. הסרה של רקמה נוספת סביב העוברים ולשטוף אותם בPBS קר כקרח. </li><li style=";text-align:right;direction:rtl"> לקחת ביופסיה זנב קטנה (לפני העברת העובר לPFA) ודגירה אותו במאגר תמוגה זנב לזיהוי המין וgenotyping אלל נותב PCR. </li><li style=";text-align:right;direction:rtl"> תתחיל מהעובר בצד לרוחב ביותר ולהעביר כל עובר בנפרד לתוך צינור המכיל 4% PFA קר כקרח על קרח על שייקר. </li><li style=";text-align:right;direction:rtl"> משרים את העוברים בגיל צעיר יותר E13.5 או עבור 1.5 שעות על קרח עם רעד קבוע. משרים את העוברים בE14.5 הגיל וE15.5 תמורת 2.5 שעות על קרח עם רעד קבוע. </li><li style=";text-align:right;direction:rtl"> לE16.5 גיל עוברים או יותר, לערוף ולהסיר את העור החיצוני לפני השריית הראש בפתרון PFA. ראשי עוברי E16.5 יכולים להיות טבולים תמורת 4.5 שעות על קרח עם רעד קבוע. </li><li style=";text-align:right;direction:rtl"> לאחר הקיבוע מתאים, לשטוף את העוברים שלוש פעמים עם PBS קר כקרח. מעביר את העוברים לתוך סוכרוז 30% בפתרון PBS על 4 מעלות צלזיוס עד שהם שוקעיםלתחתית. </li></ol> 2. הקפאה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לסדר את כל החומרים הדרושים לפני שמתחיל את תהליך ההקפאה: cryo-עובש, cryo-כפפות, מלקחיים אנטומולוגיה במשקל הנוצה, בטוש ומתחם טמפרטורה אופטימלי חיתוך (אוקטובר) </li><li style=";text-align:right;direction:rtl"> תווית cryo-העובש עם סמן אלכוהול עמיד קבוע (להזכיר את הכיוון של רקמות, תאריך וגנוטיפ). הכן רפש של קרח יבש כתוש ו 100% אתנול בדלי קרח. מניחים כוס זכוכית בתוך המכיל איזופנטאן. חכה 10 דקות לאיזופנטאן להתקרר. </li><li style=";text-align:right;direction:rtl"> בינתיים להסיר את הרקמה מפתרון סוכרוז, נגב את סוכרוז העודף סביב הרקמות באמצעות מגבוני מעבדה. העברת הרקמה לתוך cryo-עובש שכותרתו מראש עם אוקטובר מספיק כדי לכסות את הרקמה. הימנע מכל בועות אוויר ב- OCT; במיוחד סביב הרקמה. </li><li style=";text-align:right;direction:rtl"> כוון את הרקמה ב אוקטובר באמצעות מלקחיים אנטומולוגיה במשקל נוצה, כדי למנוע נזק לרקמות. התחל הקפאה על ידי העברת cryo-molד לאמבטיה איזופנטאן מקורר מראש. לא להתיז איזופנטאן ל- OCT כפי שהוא לא להקפיא כראוי. עטוף את הדגימות ברדיד אלומיניום ולאחסן ב -80 ° C. </li></ol> 3. Cryosectioning <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לחתוך 14 מיקרומטר חלקים סידוריים דקים בסדרה &quot;חמש באמצעות cryostat ולאסוף בשקופיות זכוכית SuperFrost® פלוס עבור immunofluorescence ניתוח (IF). אחסן את השקופיות ב -80 ° C עד מנוצל. </li></ol> 4. הדמיה Tracer שימוש בפרוטוקול Tyramide איתותים ההגברה (TSA) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן את המאגרים וחומרים כימיים הנדרשים לצביעה. תמיד טרי להכין את חיץ טריס-NaCl-Tween (TNT) ביום השימוש. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן חיץ TNT באמצעות 100 מיליליטר של 1 M טריס- HCl pH 7.5, 30 מיליליטר של 5 M NaCl וDDH 2 O עד נפח סופי של 1 ל הוסף 500 μl של Tween 20 בעזרת פיפטה 1 מיליליטר. הוסף את Tween 20 לאט ולשטוף את פיפטה מעלה ומטה מספר פעמים כדי לוודא שכל Tween 20 הוא בפתרון. </li><li style=";text-align:right;direction:rtl"> הכן טריס-NaCl-חסימת חיץ (TNB) באמצעות של 1 M טריס-HCl 100 מיליליטר 7.5 pH, 30 מיליליטר של 5 M NaCl וDDH 2 O עד נפח סופי של 1 ל הוסף 5 גרם חסימה מגיב (מסופק עם ערכה) לאט במרווחים קטנים למאגר תוך ערבוב. מחממים את הפתרון בהדרגה ל -55 מעלות צלזיוס עם ערבוב רציף לפזר מגיב חסימה לחלוטין (זה לא צריך לקחת יותר מ30-60 דקות). כדי להשיג חימום אחיד להשתמש אמבט מים ב 55 ° C. הפתרון יופיע חלבי. להביא את הפתרון לטמפרטורת חדר לפני השימוש. Aliquot ולאחסן ב -20 ° C לאחסון לטווח ארוך. </li><li style=";text-align:right;direction:rtl"> מחדש מגיב ביוטין tyramide (מצורף לערכה) בכיתה HPLC-ביולוגיה מולקולרית / DMSO. תלוי איזה ערכה משמשת את הכמות המתאימה של DMSO עשויה להשתנות. אחסן את פתרון המניות ב 4 מעלות צלזיוס. הערה: סעיפים מבעלי חיים הטרוזיגוטיים לאללים Cre וR26 המתאימים יכולים לשמש לניתוח מעגל. שימוש שלections מהמלטת ביצוע Cre אחד או אחת אלל R26, בהתאמה, כפקדים שליליים. פנק את שקופיות בקרה שליליות בדיוק כמו שקופיות מבעלי חיים כפולים הטרוזיגוטיים. בנוסף, כולל שקופיות שליטה אחד מבעלי חיים כפולים הטרוזיגוטיים אבל להשאיר את מגיב TSA (שליטת unamplified). </li></ol></li><li style=";text-align:right;direction:rtl"> באמצעות אזמל טרי חד להסיר אוקטובר העודף המקיף את חלקי רקמות ולסמן את הגבול סביב החלקים עם עט PAP. </li><li style=";text-align:right;direction:rtl"> ייבש את השקופיות במשך 2-3 דקות בטמפרטורת חדר (RT). שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד. דגירה השקופיות ב RT למשך 30 דקות בשיעור של 0.3% פתרון H 2 O 2 במתנול קר כקרח כדי להרוות את פעילות peroxidase אנדוגני. </li><li style=";text-align:right;direction:rtl"> 3x לשטוף עם PBS במשך 5 דקות כל אחד ב RT. דגירה של 10 דקות ב 0.5% Triton-X 100 בPBS לpermeabilization רקמות. שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד. </li><li style=";text-align:right;direction:rtl"> בלוק עם TNB (חסימת פתרון, 200-300 μl לכל שקופית) במשך 30דקות ב RT בתא humidified. ודא שכל החלקים מכוסים לחלוטין על ידי TNB. אל תתנו לשקופיות להתייבש בין הצעדים. </li><li style=";text-align:right;direction:rtl"> מסננים את חיץ חסימת עודף ולהחיל antiserum העיקרי הכרה נותב (1: 1,000 העז נגד WGA לBL, 1: 15,000 ארנב נגד GFP לGTT) מדולל בTNB לשעה 2 ב RT או הלילה ב 4 מעלות צלזיוס. הקפד להשתמש נפח מספיק כדי לכסות את קטע הרקמה (200-300 μl לכל שקופית) לחלוטין. הערה: דילולים antisera העיקריים המומלצים כאן עשויים להיות מותאמים. </li><li style=";text-align:right;direction:rtl"> שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד עם תסיסה. </li><li style=";text-align:right;direction:rtl"> דגירה הקטעים עם antiserum המשני biotinylated הכרה בשורה של antiserum הראשון (1: IgG 500 הסוס האנטי-העז לאנטי-WGA, 1: IgG נגד ארנב העז 5,000 לאנטי-GFP בTNB עבור שעה 1 ב RT). </li><li style=";text-align:right;direction:rtl"> 3x לשטוף עם TNT ב RT במשך 5 דקות כל אחד עם תסיסה. דגירה ב 1: 100 streptavidin (SA) peroxidase חזרת -conjugated (SA-HRP wi, ובלבדth הערכה) בTNB למשך 30 דקות ב RT בתא humidified. שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד. בינתיים להפשיר TSA. </li><li style=";text-align:right;direction:rtl"> לדלל TSA 01:50 בdiluent ההגברה TSA (מצורפת לערכה; להשתמש בערכת TSA להדמיה של BL וערכת TSA + לGTT). דגירה סעיפי הרקמות בTSA המדולל לבדיוק 10 דקות ב RT. לדלל TSA רק לפני השימוש, באופן אידיאלי בשלב הכביסה הקודם, לא להשתמש בכל מגיב TSA מדולל שנותר לניסויים עתידיים; תמיד להכין טרי. </li><li style=";text-align:right;direction:rtl"> שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד עם תסיסה. דגירה עם 1: 500 המצומד Alexa Fluor® 546 streptavidin בTNB למשך 30 דקות ב RT. שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד עם תסיסה. </li><li style=";text-align:right;direction:rtl"> דגירה של 10 דקות ב 5% פתרון bisbenzimide PBS ב RT עבור מכתים גרעיני. שטוף את השקופיות ב3x RT עם TNT במשך 5 דקות כל אחד עם תסיסה. הר עם Fluromount G ולבצע epifluorescence או confocal. <em&gt; פתרון בעיות: יעילות של העברה נותב תהיה תלויה ברמת הביטוי של מוקד ROSA26 בתאים המייצרים (שנקבע על ידי קו נהג Cre בשימוש) ועל המעגלים העצביים ניתחה (למשל מספר הנוירונים הפקה נותב, וכו &#39;התכנסות). לכן דילולים antisera העיקריים המומלצים כאן עשויים להיות מותאמים כדי למנוע אות נמוכה או עודפת. רקע תמיד צריך לנתח באמצעות שקופיות בקרה מתאימות (ראה לעיל). </li></ol> 5. τlacZ מכתים לסעיפים עובריים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן את המאגרים וחומרים כימיים הנדרשים לצביעה. תמיד טרי להכין את חיץ C LacZ לפני השימוש. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן 5-bromo-4-כלורו-3-indolyl-β-D-galactopyranoside (X-gal) פתרון מניות (40 מ&quot;ג / מיליליטר) על ידי הוספת 40 גרם של X-gal עד 1 dimethylformamide מיליליטר 70% (DMF). מכסה ברדיד האלומיניום ולאחסן ב -20 ° C לאחסון לטווח ארוך. </li><li style=";text-align:right;direction:rtl"> הכן tetrazolium הכחול ניטרו (NBT) stפתרון Ock (50 מ&quot;ג / מיליליטר) על ידי הוספת 50 גרם של NBT לDMF 1 מיליליטר 70%. מכסה ברדיד האלומיניום ולאחסן ב -20 ° C לאחסון לטווח ארוך. </li><li style=";text-align:right;direction:rtl"> הכן LacZ קוֹבֵעַ באמצעות 80 μl של glutaraldehyde 25%, 5 מיליליטר של 4% PFA, 20 μl של 1 M MgCl 2, של 500 מ&quot;מ EGTA 100 μl, 1 מיליליטר של חיץ pH M פוספט 1 7.4 וDDH 2 O עד גמר נפח של 10 מיליליטר. </li><li style=";text-align:right;direction:rtl"> הכן LacZ חיץ 1 מיליליטר באמצעות של 1 M MgCl 2, 5 מיליליטר של 500 מ&quot;מ EGTA, 50 מיליליטר של 1 M pH חיץ פוספט 7.4 וDDH 2 O עד נפח סופי של 500 מיליליטר. </li><li style=";text-align:right;direction:rtl"> הכן B חיץ LacZ באמצעות 1 מיליליטר של 1 M MgCl 2, 5 מיליליטר של 500 מ&quot;מ EGTA, 5 deoxycholate מיליליטר של 1% נתרן, 10% NP-40 100 מיליליטר, 50 מיליליטר של חיץ פוספט pH 1 M 7.4 וDDH 2 O עד נפח סופי של 500 מיליליטר. </li><li style=";text-align:right;direction:rtl"> הכן חיץ C LacZ על ידי הוספת 10 μl של פתרון מניות NBT ו12.5 μl של מניות פתרון X-gal עד 1 מיליליטר של חיץ B. LacZ הפוך טרי רק לפני השימוש ומכסים ברדיד אלומיניום. </li></ol&gt; </li><li style=";text-align:right;direction:rtl"> ייבש את השקופיות ב RT לפחות במשך 10-15 דקות (בינתיים להכין שקופיות עם עט PAP). </li><li style=";text-align:right;direction:rtl"> לתקן את הסעיף עם LacZ קוֹבֵעַ למשך 2 דקות בטמפרטורת חדר בתא humidified בתוך קטר-מנדף כימי. לשטוף 3 פעמים עם PBS בתוספת 2 מ&quot;מ MgCl 2. </li><li style=";text-align:right;direction:rtl"> יש לשטוף את השקופיות עם א &#39;חיץ LacZ שטוף את השקופיות עם LacZ חיץ 3 פעמים במשך 10 דקות כל אחד ב RT. לשטוף 2 פעמים עם החיץ B LacZ במשך 5 דקות כל אחד. דגירה השקופיות בC חיץ LacZ ב30-37 מעלות צלזיוס במשך שעה 6 או לילה בתא humidified. הערה: הוספת נפח מספיק של חיץ C LacZ; שקופיות לא צריכים להתייבש במהלך דגירה. </li><li style=";text-align:right;direction:rtl"> לאחר הדגירה מתאימה לשטוף את השקופיות עם PBS בתוספת 2 מ&quot;מ MgCl 2. יש לשטוף את החלקים בקצרה עם DDH 2 O. Coverslip עם ג&#39;לטין גליצין של מאיר. מתאים למיקרוסקופ אור מצויד בסט-אפ הדמיה התערבות ההפרש לעומת זאת (DIC). </li></ol> 6. Gendאה וGenotyping Tracer <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן מאגר תמוגה זנב באמצעות 1 מיליליטר של 1 M טריס- HCl pH 8.5, של 500 מ&quot;מ EGTA 100 μl, 200 μl של 10% SDS, 400 μl של 5 M NaCl וDDH 2 O כדי לפצות נפח סופי של 10 מיליליטר. </li><li style=";text-align:right;direction:rtl"> הוסף 500 μl של חיץ תמוגה זנב לכל צינור Eppendorf המכיל ביופסית זנב. להוסיף K proteinase לריכוז סופי של 100 מ&quot;ג / מיליליטר. דגירה הלילה על שייקר ב 55 ° C. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה דגימות 17,000 XG במשך 10 דקות ב RT. מעביר את supernatant לצינור צנטריפוגות חדש. הוסף 500 μl של isopropanol לsupernatant. מערבבים במשך לפחות 5 דקות על ידי היפוך הצינורות למעלה ולמטה. </li><li style=";text-align:right;direction:rtl"> ספין בצנטריפוגות ב 17,000 XG במשך 5 דקות בRT. יוצקים את supernatant. הוסף 200 μl של 70% אתנול. לנער במשך 5 דקות לפחות. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה ב17,000 XG במשך 5 דקות. הסר supernatant עם Pipetman (לא לשפוך את). ייבש את הכדור בתא חם (37 מעלות צלזיוס) במשך 15-30 דקות. </li><li style=";text-align:right;direction:rtl"> גלולה גלולה ב100 μlpH הנמוך TE 8.0 או מים באמצעות טיפים רחבים נשא מסוננים. שים ב -55 מעלות צלזיוס במשך שעה 1 ועל 37 מעלות צלזיוס למשך הלילה להמסה נכונה. חנות ב 4 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> השתמש μl 1 של ה- DNA לתגובת PCR (תערובת תגובת 50 μl המכילה 1 μl של DNA זנב, 2.5 μl DMSO, 10:00 של כל צבע יסוד, 25 מיקרומטר של כל dNTP, וbetaine 1M). פריימרים PCR לgenotyping וזיהוי מין רשומים בטבלת חומרים. </li></ol>

<ol>
	<li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals.">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li><li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+approaches+to+neural+circuits+in+the+mouse.">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li><li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+half+century+of+experimental+neuroanatomical+tracing.">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li><li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus.">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li><li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero.">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li><li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+approach+to+trace+neural+circuits.">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li><li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice.">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li><li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54.">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li><li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GPR54+gene+as+a+regulator+of+puberty.">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li><li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons.">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li><li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice.">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67 (2005).</li><li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene.">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li><li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-activated+site-specific+recombination+in+mice.">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li></ol>

No conflict of interest declared.

יש להביע קליעים נותבים transsynaptic כtransgenes להתחקות המעגלים העצביים של אוכלוסיות נוירונים מוגדרות גנטי יש מספר יתרונות בהשוואה להזרקת stereotaxic של קליעים נותבים או וירוסי neurotopic. ראשית, נותב מופק כחלבון אנדוגני ולכן אינו מפיק כל תגובה חיסונית ומסלול עצבי סלקטיבית ניתן לנתח ב?...

מעקב נתיב האנטומי הוא אחד הכלים הנפוצים ביותר בשימוש לפענח את הקשר בין המוח והתנהגות 1. קידום בטכנולוגיות מעגל התחקות עצביות העניק מדעני מוח עם היכולת לעקוב אחר מעגלים עצביים מאוכלוסיות נוירון זיהו גנטי בעכברים 2. למרות התקדמות הטכנולוגית אלה נותרים מאתגרים לפענח את היווצרותם של מעגלים עצביים במיוחד בתקופת התבגרות עוברית. סיבה לכך הוא שרוב שיטות המעקב שפותחו עד היום מבוססים על הזרקת stereotaxic של קליעים נותבים transsynaptic או וירוסי neurotropic מהונדסים גנטי (איור 1) 2,3. בעוד טכניקות אלה להשיג רזולוציה מרחב ובזמן של קישוריות, כמה מגבלות מובנות כגון זריקות נותב מאתגרות מבחינה טכנית למוח המתפתח, שחזור של אתר הזרקה, דלקת פוטנציאלית במקום ההזרקה וimpor ביותרcytotoxicity tantly נגרמת על ידי וירוסי neurotropic להגביל את השימוש בם 4. שיטה חלופית היא להביע קליעים נותבים transsynaptic כtransgenes בעכברים שעברו מוטציה גנטית. יש לנו לאחרונה שונו בטכניקה זו ופיתחתי מערכת בינארית transsynaptic גנטי התחקות למפות את המעגלים העצביים של כל אוכלוסייה עצבית מזוהה גנטי 5. האסטרטגיה הניסיונית שלנו מבוססת על שני זנים חדשים לדפוק בעכבר, המבטאים גם לקטינים שעורה נותב דו-כיווני (BL) 6 או בר רעלנים נותב מדרדר C התמזג GFP (GTT) 7 מלוקוס ROSA 26 לאחר Cre תיווך רקומבינציה. כאן אנו משמשים זני עכבר אלו כדי להביע את BL וGTT בתאי עצב המייצרים kisspeptin, neuropeptide שמעורב בויסות ההתבגרות של ציר הרבייה 8,9 באופן סלקטיבי. אנו מראים כי טכניקה זו היא מתאימה כדי לחזות את ההתפתחות והתבגרות של נשיקהמעגלים עצביים peptin במהלך התפתחות עוברית של מוח העכבר נקבת 5. אסטרטגית רבייה R26-BL-IRES-τlacZ (BIZ) והקווים נותב R26-GFP-TTC (GTT) הם לדפוק בזנים 5 שנושאים אללים ROSA26 רקומביננטי. R26-BIZ ואללים R26-GTT הם תעתיק שקטים בשל נוכחותם של איתות חזקה תעתיק תחנה, שמעוטרת בשני אתרי loxP 5. ביטוי של transgene BIZ וGTT מופעל על ידי ההסרה בתיווך Cre של אות תחנת תעתיק. ניתן להשתמש אללים R26-BIZ וR26-GTT באופן עצמאי על ידי פשוט חצייה עם קו נהג Cre. להטרוזיגוטיים בעלי חיים ניתוח לאללים Cre וR26 המתאימים ניתן להשתמש. המלטת ביצוע Cre אחד או אחת אלל R26, בהתאמה, צריכה לשמש כקבוצת ביקורת. לחלופין, אפשר גם ליצור triple לדפוק בבעלי חיים שנשאו את אללים Cre, R26-BIZ וR26-GTT, אולם זה יחייב צלב אחד נוסף.

<table><tbody><tr><td>Bisbenzimide (Hoechst 33258 dye)</td><td>Sigma</td><td>14530-100MG</td><td></td></tr><tr><td>Ethanol</td><td>Sigma</td><td>32205-1L</td><td></td></tr><tr><td>Cryo mold (Peel-a-way)</td><td>Polyscience Inc.</td><td>18646A-1</td><td>22 x 22 x 20mm</td></tr><tr><td>DMSO</td><td>Sigma</td><td>D8418-100ML</td><td></td></tr><tr><td>Dimethyl Formamide (DMF)</td><td>VWR Chemicals</td><td>23470,293</td><td></td></tr><tr><td>EGTA</td><td>ROTH</td><td>3054.3</td><td></td></tr><tr><td>Fluoromount G</td><td>Southern Biotech</td><td>0100-01</td><td></td></tr><tr><td>Glutaraldehyde</td><td>Sigma</td><td>G5882-50ML</td><td></td></tr><tr><td>Hydrogen peroxide</td><td>Sigma</td><td>34988-7</td><td></td></tr><tr><td>Isopentane (Methyl 2-butane)</td><td>Sigma</td><td>M32631-2.5L</td><td></td></tr><tr><td>Kaiser&#039;s glycine gelatin</td><td>Merck</td><td>1092420100</td><td></td></tr><tr><td>Methanol</td><td>Sigma</td><td>494437-1L</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>M2670-100G</td><td></td></tr><tr><td>NaCl</td><td>ROTH</td><td>HN00.2</td><td></td></tr><tr><td>NBT</td><td>Sigma</td><td>298-83-9</td><td></td></tr><tr><td>Nonidet P40 substitute</td><td>Fluka</td><td>743.85</td><td></td></tr><tr><td>OCT</td><td>Leica</td><td>14020108926</td><td></td></tr><tr><td>PAP pen</td><td>Dako</td><td>S2002</td><td></td></tr><tr><td>Parafarmaldehyde</td><td>Sigma</td><td>P6148-1KG</td><td></td></tr><tr><td>Sodium deoxycholate</td><td>Sigma</td><td>D6750-25G</td><td></td></tr><tr><td>Sucrose</td><td>Sigma</td><td>S7903-1KG</td><td></td></tr><tr><td>Superfrost slides</td><td>Thermo Scientific</td><td>FT4981GLPLUS</td><td></td></tr><tr><td>TSA kit</td><td>PerkinElmer</td><td>NEL700</td><td></td></tr><tr><td>TSA plus kit</td><td>PerkinElmer</td><td>NEL749A001KT</td><td></td></tr><tr><td>Tris</td><td>ROTH</td><td>AE15.2</td><td></td></tr><tr><td>Triton-X 100</td><td>ROTH</td><td>3051.2</td><td></td></tr><tr><td>Tween 20</td><td>ROTH</td><td>9127.1</td><td></td></tr><tr><td>X-gal</td><td>ROTH</td><td>2315.1</td><td></td></tr><tr><td>Cryostat</td><td>Leica</td><td>na</td><td></td></tr><tr><td>Light microscope equipped with DIC imaging</td><td>Zeiss</td><td>Axioskop2 equipped with Axio Vision software</td><td></td></tr><tr><td>Fluroscence microscope</td><td>Zeiss</td><td>Axioskop2 equipped with Axio Vision software</td><td></td></tr><tr><td>Photoshop</td><td>Adobe</td><td>PS6</td><td></td></tr><tr><td>Goat anti-WGA (recognizes BL)</td><td>Vector Laboatories</td><td>AS-2024</td><td></td></tr><tr><td>Biotinylayted horse anti-goat IgG</td><td>Vector Laboatories</td><td>BA-9500</td><td></td></tr><tr><td>Biotinylated goat anti-rabbit IgG</td><td>Vector Laboatories</td><td>BA-1000</td><td></td></tr><tr><td>Rabbit anti-GFP (recognizes GTT)</td><td>Invitrogen</td><td>A11122</td><td></td></tr><tr><td>Rabbit anti-GnRH</td><td>Affinity Bio Reagent</td><td>PA1-121</td><td></td></tr><tr><td>Dylight488-donkey anti-rabbit IgG</td><td>Thermo Scientific</td><td>SA5-10038</td><td></td></tr><tr><td>SA-Alexa Fluor 546</td><td>Life Technologies</td><td>S-11225</td><td></td></tr><tr><td colspan="4">Primers</td></tr><tr><td>BL Fwd (for BIZ genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>ATGAAGATGATGAGCACCAGGGC</td></tr><tr><td>BL Rev (for BIZ genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>AGCCCTCGCCGCAGAACTC</td></tr><tr><td>Cre Fwd (for Cre genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>GTCGATGCAACGAGTGATGAGGTTCG</td></tr><tr><td>Cre Rev (for Cre genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>CCAGGCTAAGTGCCTTCTCTACACCTGC</td></tr><tr><td>TTC Fwd (for GTT genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>AGCAAGGGCGAGGAGCTGTT</td></tr><tr><td>TTC Rev (for GTT genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>GTCTTGTAGTTGCCGTCGTCCTTGAA</td></tr><tr><td>XY Fwd (for gender genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>TGAAGCTTTTGGCTTTGA</td></tr><tr><td>XY Rev (for gender genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>CCGCTGCCAAATTCTTTG</td></tr><tr><td>ROSA26 Fwd</td><td>Eurofins MWG Operon</td><td></td><td>CGAAGTCGCTCTGAGTTGTTATC</td></tr><tr><td>ROSA26 Rev</td><td>Eurofins MWG Operon</td><td></td><td>GCAGATGGAGCGGGAGAAAT</td></tr><tr><td>SA Rev</td><td>Eurofins MWG Operon</td><td></td><td>CGAAGTCGCTCTGAGTTGTTATC</td></tr></tbody></table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

סעיף זה מציג תוצאות נציג שניתן להשיג בעבודה עם R26-BIZ (Z RES-τlac L- אני B) וR26-GTT (G FP- TT C) אללים. כאן אנו משתמשים R26-BIZ ואללים R26-GTT לנתח את ההבשלה של המעגלים העצביים המסדירים את ציר הרבייה. הרבייה בבעלי החוליות נשלטת מרכזית על ידי קבוצה קטנה של תאי עצב בהי...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

מותנה הגנטי Transsynaptic איתור במוח העכבר עוברי

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.6K Views.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

Video: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Mouse in Utero Electroporation: Controlled Spatiotemporal Gene Transfection

In order to understand the function of genes expressed in specific region of the developing brain, including signaling molecules and axon guidance molecules, local gene transfer or knock- out is required. Gene targeting knock-in or knock-out into local regions is possible to perform with combination with a specific CRE line, which is laborious, costly, and time consuming. Therefore, a simple transfection method, an in utero electroporation technique, which can be performed with short time, will be handy to test the possible function of candidate genes prior to the generation of transgenic animals 1,2. In addition to this, in utero electroporation targets areas of the brain where no specific CRE line exists, and will limit embryonic lethality 3,4. Here, we present a method of in utero electroporation combining two different types of electrodes for simple and convenient gene transfer into target areas of the developing brain. First, a unique holding method of embryos using an optic fiber optic light cable will make small embryos (from E9.5) visible for targeted DNA solution injection into ventricles and needle type electrodes insertion to the targeted brain area 5,6. The patterning of the brain such as cortical area occur at early embryonic stage, therefore, these early electroporation from E9.5 make a big contribution to understand entire area patterning event. Second, the precise shape of a capillary prevents uterine damage by making holes by insertion of the capillary. Furthermore, the precise shape of the needle electrodes are created with tungsten and platinum wire and sharpened using sand paper and insulated with nail polish 7, a method which is described in great detail in this protocol. This unique technique allows transfection of plasmid DNA into restricted areas of the brain and will enable small embryos to be electroporated. This will help to, open a new window for many scientists who are working on cell differentiation, cell migration, axon guidance in very early embryonic stage. Moreover, this technique will allow scientists to transfect plasmid DNA into deep parts of the developing brain such as thalamus and hypothalamus, where not many region-specific CRE lines exist for gain of function (GOF) or loss of function (LOF) analyses.

Mouse in Utero Electroporation: Controlled Spatiotemporal Gene Transfection

A gene transfer method into the developing mouse brain is described by using a unique surgical method and special shape of electrodes. This unique technique allows transfection of plasmid DNA temporally and spatially, which will aid many neuroscientists in studying brain development.

עכבר בתוך הרחם Electroporation: ג&#39;ין מבוקרת transfection Spatiotemporal

In order to understand the function of genes expressed in specific region of the developing brain, including signaling molecules and axon guidance ...

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date this tool has been widely used to study the regulation of cellular proliferation, differentiation and neuronal migration especially in the developing cerebral cortex 6-8. Here we detail our protocol to electroporate in utero the cerebral cortex and the hippocampus and provide evidence that this approach can be used to study dendrites and spines in these two cerebral regions.
Visualization and manipulation of neurons in primary cultures have contributed to a better understanding of the processes involved in dendrite, spine and synapse development. However neurons growing in vitro are not exposed to all the physiological cues that can affect dendrite and/or spine formation and maintenance during normal development. Our knowledge of dendrite and spine structures in vivo in wild-type or mutant mice comes mostly from observations using the Golgi-Cox method 9. However, Golgi staining is considered to be unpredictable. Indeed, groups of nerve cells and fiber tracts are labeled randomly, with particular areas often appearing completely stained while adjacent areas are devoid of staining. Recent studies have shown that IUE of fluorescent constructs represents an attractive alternative method to study dendrites, spines as well as synapses in mutant / wild-type mice 10-11 (Figure 1A). Moreover in comparison to the generation of mouse knockouts, IUE represents a rapid approach to perform gain and loss of function studies in specific population of cells during a specific time window. In addition, IUE has been successfully used with inducible gene expression or inducible RNAi approaches to refine the temporal control over the expression of a gene or shRNA 12. These advantages of IUE have thus opened new dimensions to study the effect of gene expression/suppression on dendrites and spines not only in specific cerebral structures (Figure 1B) but also at a specific time point of development (Figure 1C).
Finally, IUE provides a useful tool to identify functional interactions between genes involved in dendrite, spine and/or synapse development. Indeed, in contrast to other gene transfer methods such as virus, it is straightforward to combine multiple RNAi or transgenes in the same population of cells. 
In summary, IUE is a powerful method that has already contributed to the characterization of molecular mechanisms underlying brain function and disease and it should also be useful in the study of dendrites and spines.

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

This article describes in detail a protocol to electroporate in utero the cerebral cortex and the hippocampus at E14.5 in mice. We also show that this is a valuable method to study dendrites and spines in these two cerebral regions.

להדמיה מניפולציה גנטית של דנדריטים עם קוצים בקליפת עכבר היפוקמפוס מוחין באמצעות<em&gt; ברחם</em&gt; Electroporation

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date ...

Viral Tracing of Genetically Defined Neural Circuitry

Classical methods for studying neuronal circuits are fairly low throughput. Transsynaptic viruses, particularly the pseudorabies (PRV) and rabies virus (RABV), and more recently vesicular stomatitis virus (VSV), for studying circuitry, is becoming increasingly popular. These higher throughput methods use viruses that transmit between neurons in either the anterograde or retrograde direction.
Recently, a modified RABV for monosynaptic retrograde tracing was developed. (Figure 1A). In this method, the glycoprotein (G) gene is deleted from the viral genome, and resupplied only in targeted neurons. Infection specificity is achieved by substituting a chimeric G, composed of the extracellular domain of the ASLV-A glycoprotein and the cytoplasmic domain of the RABV-G (A/RG), for the normal RABV-G1. This chimeric G specifically infects cells expressing the TVA receptor1. The gene encoding TVA can been delivered by various methods2-8. Following RABV-G infection of a TVA-expressing neuron, the RABV can transmit to other, synaptically connected neurons in a retrograde direction by nature of its own G which was co-delivered with the TVA receptor. This technique labels a relatively large number of inputs (5-10%)2 onto a defined cell type, providing a sampling of all of the inputs onto a defined starter cell type.
We recently modified this technique to use VSV as a transsynaptic tracer9. VSV has several advantages, including the rapidity of gene expression. Here we detail a new viral tracing system using VSV useful for probing microcircuitry with increased resolution. While the original published strategies by Wickersham et al.4 and Beier et al.9 permit labeling of any neurons that project onto initially-infected TVA-expressing-cells, here VSV was engineered to transmit only to TVA-expressing cells (Figure 1B). The virus is first pseudotyped with RABV-G to permit infection of neurons downstream of TVA-expressing neurons. After infecting this first population of cells, the virus released can only infect TVA-expressing cells. Because the transsynaptic viral spread is limited to TVA-expressing cells, presence of absence of connectivity from defined cell types can be explored with high resolution. An experimental flow chart of these experiments is shown in Figure 2. Here we show a model circuit, that of direction-selectivity in the mouse retina. We examine the connectivity of starburst amacrine cells (SACs) to retinal ganglion cells (RGCs).

A method of tracing synaptically connected neurons is described. We use TVA specificity of an upstream cell to probe whether a cell population of interest receives synaptic input from genetically defined cell types.

איתור נגיפי של מעגלים עצביים מוגדרים גנטי

Classical methods for studying neuronal circuits are fairly low throughput. Transsynaptic viruses, particularly the pseudorabies (PRV) and rabies virus ...

Electroporation of the Hindbrain to Trace Axonal Trajectories and Synaptic Targets in the Chick Embryo

Electroporation of the chick embryonic neural tube has many advantages such as being quick and efficient for the expression of foreign genes into neuronal cells. In this manuscript we provide a method that demonstrates uniquely how to electroporate DNA into the avian hindbrain at E2.75 in order to specifically label a subset of neuronal progenitors, and how to follow their axonal projections and synaptic targets at much advanced stages of development, up to E14.5. We have utilized novel genetic tools including specific enhancer elements, Cre/Lox - based plasmids and the PiggyBac-mediated DNA transposition system to drive GFP expression in a subtype of hindbrain cells (the dorsal most subgroup of interneurons, dA1). Axonal trajectories and targets of dA1 axons are followed at early and late embryonic stages at various brainstem regions. This strategy contributes advanced techniques for targeting cells of interest in the embryonic hindbrain and for tracing circuit formation at multiple stages of development.

How neuronal networks are established in the embryonic brain is a fundamental question in developmental neurobiology. Here we combined an electroporation technique with novel genetic tools, such as Cre/Lox&#x2013;plasmids and PiggyBac-mediated DNA transposition system in the avian hindbrain to label dorsal interneurons and track their axonal projections and synaptic targets at various developmental stages.

Electroporation של המוח האחורי כדי לעקוב אחר מסלולים ויעדי axonal Synaptic בעובר האפרוח

Electroporation of  the chick embryonic neural tube has many advantages such as being quick and efficient  for the expression of foreign genes into ...

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Genetic modification of specific regions of the developing mammalian brain is a very powerful experimental approach. However, generating novel mouse mutants is often frustratingly slow. It has been shown that access to the mouse brain developing in utero with reasonable post-operatory survival is possible. Still, results with this procedure have been reported almost exclusively for the most superficial and easily accessible part of the developing brain, i.e. the cortex. The thalamus, a narrower and more medial region, has proven more difficult to target. Transfection into deeper nuclei, especially those of the hypothalamus, is perhaps the most challenging and therefore very few results have been reported. Here we demonstrate a procedure to target the entire hypothalamic neuroepithelium or part of it (hypothalamic regions) for transfection through electroporation. The keys to our approach are longer narcosis times, injection in the third ventricle, and appropriate kind and positioning of the electrodes. Additionally, we show results of targeting and subsequent histological analysis of the most recessed hypothalamic nucleus, the mammillary body.

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Despite the functional and medical importance of the hypothalamus, in utero genetic manipulation of its development has rarely been attempted. We show a detailed procedure for in utero electroporation into the mouse hypothalamus and show representative results of total and partial (regional) hypothalamic transfection.

מניפולציה גנטית של העכבר באמצעות פיתוח היפותלמוס<em&gt; ברחם</em&gt; Electroporation

Genetic  modification of specific regions of the developing mammalian brain is a very  powerful experimental approach. However, generating novel mouse ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

הדמיה חיה של מיטוזה בCortex עכבר עוברי פיתוח

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the ...

Two-Photon in vivo Imaging of Dendritic Spines in the Mouse Cortex Using a Thinned-skull Preparation

In the mammalian cortex, neurons form extremely complicated networks and exchange information at synapses. Changes in synaptic strength, as well as addition/removal of synapses, occur in an experience-dependent manner, providing the structural foundation of neuronal plasticity. As postsynaptic components of the most excitatory synapses in the cortex, dendritic spines are considered to be a good proxy of synapses. Taking advantages of mouse genetics and fluorescent labeling techniques, individual neurons and their synaptic structures can be labeled in the intact brain. Here we introduce a transcranial imaging protocol using two-photon laser scanning microscopy to follow fluorescently labeled postsynaptic dendritic spines over time in vivo. This protocol utilizes a thinned-skull preparation, which keeps the skull intact and avoids inflammatory effects caused by exposure of the meninges and the cortex. Therefore, images can be acquired immediately after surgery is performed. The experimental procedure can be performed repetitively over various time intervals ranging from hours to years. The application of this preparation can also be expanded to investigate different cortical regions and layers, as well as other cell types, under physiological and pathological conditions.

Two-Photon in vivo Imaging of Dendritic Spines in the Mouse Cortex Using a Thinned-skull Preparation

Time-lapse imaging in the living animal provides valuable information on structural reorganization in the intact brain. Here, we introduce a thinned-skull preparation that allows transcranial imaging of fluorescently labeled synaptic structures in the living mouse cortex by two-photon microscopy.

שני פוטונים<em&gt; In vivo</em&gt; הדמיה של קוצים הדנדריטים בCortex העכבר באמצעות דלילה, גולגולת הכנה

In the mammalian cortex, neurons form extremely complicated networks and exchange information at synapses. Changes in synaptic strength, as well as ...

Laser-guided Neuronal Tracing In Brain Explants

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake through electroporation in brain explants with targeted laser illumination and matching filter goggles during the procedure. The described technique of in vitro electroporation by itself yields relatively good visual control for targetting certain areas of the brain. By combining it with laser excitation of fluorescent genetic markers and their read-out through band-passing filter goggles, which can pick up the emissions of the genetically labeled cells/nuclei and the fluorescent tracing dye, a researcher can substantially increase the accuracy of injections by finding the area of interest and controlling for the dye-spread/uptake in the injection area much more efficiently. In addition, the laser illumination technique allows to study the functionality of a given neurocircuit by providing information about the type of neurons projecting to a certain area in cases where the GFP expression is linked to the type of transmitter expressed by a subpopulation of neurons.

We describe a technique to label neurons and their processes via anterograde or retrograde tracer injections into brain nuclei using an in vitro preparation. We modified an existing method of in vitro tracer electroporation by taking advantage of fluorescently labeled mouse mutants and basic optical equipment in order to increase labeling accuracy.

Explants מוח מונחי לייזר עצבי איתור ב

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake ...

Time-lapse Confocal Imaging of Migrating Neurons in Organotypic Slice Culture of Embryonic Mouse Brain Using In Utero Electroporation

In utero electroporation is a rapid and powerful approach to study the process of radial migration in the cerebral cortex of developing mouse embryos. It has helped to describe the different steps of radial migration and characterize the molecular mechanisms controlling this process. To directly and dynamically analyze migrating neurons they have to be traced over time. This protocol describes a workflow that combines in utero electroporation with organotypic slice culture and time-lapse confocal imaging, which allows for a direct examination and dynamic analysis of radially migrating cortical neurons. Furthermore, detailed characterization of migrating neurons, such as migration speed, speed profiles, as well as radial orientation changes, is possible. The method can easily be adapted to perform functional analyses of genes of interest in radially migrating cortical neurons by loss and gain of function as well as rescue experiments. Time-lapse imaging of migrating neurons is a state-of-the-art technique that once established is a potent tool to study the development of the cerebral cortex in mouse models of neuronal migration disorders.

Time-lapse Confocal Imaging of Migrating Neurons in Organotypic Slice Culture of Embryonic Mouse Brain Using In Utero Electroporation

This protocol provides instructions for direct observation of radially migrating cortical neurons. In utero electroporation, organotypic slice culture, and time-lapse confocal imaging are combined to directly and dynamically study the effects of overexpression or downregulation of genes of interest in migrating neurons and to analyze their differentiation during development.

זמן לשגות Confocal הדמיה של נוירונים נודדים תרבות פרוסה Organotypic של המוח עכבר עובריים באמצעות<em&gt; באוטרו</em&gt; Electroporation

In utero electroporation is a rapid and powerful approach to study the process of radial migration in the cerebral cortex of developing mouse embryos. It ...

Stereotaxic Surgical Approach to Microinject the Caudal Brainstem and Upper Cervical Spinal Cord via the Cisterna Magna in Mice

Stereotaxic surgery to target brain sites in mice is commonly guided by skull landmarks. Access is then obtained via burr holes drilled through the skull. This standard approach can be challenging for targets in the caudal brainstem and upper cervical cord due to specific anatomical challenges as these sites are remote from skull landmarks, leading to imprecision. Here we outline an alternative stereotaxic approach via the cisterna magna that has been used to target discrete regions of interest in the caudal brainstem and upper cervical cord. The cisterna magna extends from the occipital bone to the atlas (i.e., the second vertebral bone), is filled with cerebrospinal fluid, and is covered by dura mater. This approach provides a reproducible route of access to select central nervous system (CNS) structures that are otherwise hard to reach due to anatomical barriers. Furthermore, it allows for direct visualization of brainstem landmarks in close proximity to the target sites, increasing accuracy when delivering small injection volumes to restricted regions of interest in the caudal brainstem and upper cervical cord. Finally, this approach provides an opportunity to avoid the cerebellum, which can be important for motor and sensorimotor studies.

Stereotaxic Surgical Approach to Microinject the Caudal Brainstem and Upper Cervical Spinal Cord via the Cisterna Magna in Mice

Stereotaxic surgery to target brain sites in mice commonly involves access through the skull bones and is guided by skull landmarks. Here we outline an alternative stereotaxic approach to target the caudal brainstem and upper cervical spinal cord via the cisterna magna that relies on direct visualization of brainstem landmarks.

גישה כירורגית סטריאוטקסית למיקרו-איניג'קט גזע המוח הקאודלי וחוט השדרה הצווארי העליון באמצעות ציסטרנה מגנה בעכברים

Stereotaxic surgery to target brain sites in mice is commonly guided by skull landmarks. Access is then obtained via burr holes drilled through the skull. ...

מותנה הגנטי Transsynaptic איתור במוח העכבר עוברי

Summary

Explore More Videos

Chapters in this video

עכבר בתוך הרחם Electroporation: ג'ין מבוקרת transfection Spatiotemporal

להדמיה מניפולציה גנטית של דנדריטים עם קוצים בקליפת עכבר היפוקמפוס מוחין באמצעות

איתור נגיפי של מעגלים עצביים מוגדרים גנטי

Electroporation של המוח האחורי כדי לעקוב אחר מסלולים ויעדי axonal Synaptic בעובר האפרוח

מניפולציה גנטית של העכבר באמצעות פיתוח היפותלמוס

הדמיה חיה של מיטוזה בCortex עכבר עוברי פיתוח

שני פוטונים

Explants מוח מונחי לייזר עצבי איתור ב

זמן לשגות Confocal הדמיה של נוירונים נודדים תרבות פרוסה Organotypic של המוח עכבר עובריים באמצעות

גישה כירורגית סטריאוטקסית למיקרו-איניג'קט גזע המוח הקאודלי וחוט השדרה הצווארי העליון באמצעות ציסטרנה מגנה בעכברים