We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

NOTA: Etica Dichiarazione: procedure che coinvolgono soggetti animali sono stati approvati dal comitato il benessere degli animali dell&#39;Università di Amburgo e l&#39;Università di Saarland. 1. Preparazione e fissaggio del tessuto embrionale <ol><li> Disporre tutte le attrezzature necessarie per sezionare gli embrioni e preparare soluzioni per il successivo fissaggio del tessuto prima di sacrificare gli animali. NOTA: preparare sempre una soluzione fresca 4% paraformaldeide (PFA) (4% PFA in 0.1 M tampone fosfato salino (PBS), regolare il pH a 7,4). </li><li> Euthanize cronometrato femmina incinta mouse con una procedura eticamente approvati. </li><li> Trasferire il mouse su una piattaforma. Bagnare la parte ventrale dell&#39;addome con il 70% di etanolo e fare una incisione verticale usando forbici affilate per esporre la cavità addominale. </li><li> Identificare la catena embrionale ed estrarlo con cautela utilizzando una pinza smussato e metterlo in ghiaccio freddo PBS. </li><li> Rimuovere i singoli embrioni dala catena embrionale con le forbici sottili e pinze. Rimuovere il tessuto in più intorno gli embrioni e lavarli in ghiacciata PBS. </li><li> Prendete una piccola biopsia coda (prima di trasferire l&#39;embrione in PFA) e incubare in coda tampone di lisi per l&#39;identificazione di genere e tracciante allele genotipizzazione PCR. </li><li> Avviare dall&#39;embrione al lato più laterale e trasferire ogni embrione separatamente in una provetta contenente ghiacciata 4% PFA su ghiaccio su un agitatore. </li><li> Immergere gli embrioni all&#39;età di E13.5 o più giovani per 1,5 ore sul ghiaccio con costante agitazione. Immergere gli embrioni a E14.5 età e E15.5 per 2,5 ore sul ghiaccio con costante agitazione. </li><li> Per E16.5 embrioni età o più anziani, decapitate e togliere la pelle esterna prima immersione della testa in soluzione PFA. Capi di embrioni E16.5 possono essere messi a bagno per 4,5 ore sul ghiaccio con costante agitazione. </li><li> Dopo la fissazione del caso, lavare gli embrioni tre volte con PBS freddo. Trasferire gli embrioni in 30% di saccarosio in soluzione PBS a 4 ° C fino affondanoal fondo. </li></ol> 2. Congelamento <ol><li> Disporre tutti i materiali necessari prima di iniziare il processo di congelamento: crio-muffa, crio-guanti, pinze piuma entomologia, pennarello e composti temperatura di taglio ottimale (OCT) </li><li> Etichettare la crio-stampo con un pennarello resistente all&#39;alcool permanente (citare l&#39;orientamento del tessuto, la data e il genotipo). Preparare una granita di ghiaccio secco tritato e il 100% di etanolo in un secchio di ghiaccio. Posizionare un bicchiere di vetro all&#39;interno contenente isopentano. Attendere 10 minuti per il isopentano raffreddare. </li><li> Nel frattempo rimuovere il tessuto dalla soluzione di saccarosio, eliminare l&#39;eccesso di saccarosio in tutto il tessuto con salviette di laboratorio. Trasferire il tessuto in una pre-etichettati crio-stampo con sufficiente ottobre per coprire il tessuto. Evitare eventuali bolle d&#39;aria nel ottobre; soprattutto intorno il tessuto. </li><li> Orientare il tessuto in ottobre con pinze entomologia piuma per evitare danni ai tessuti. Inizia congelamento trasferendo la crio-mold nel bagno isopentano pre-raffreddato. Non schizzare isopentano in ottobre in quanto non congelerà correttamente. Avvolgere i campioni in un foglio di alluminio e conservare a -80 ° C. </li></ol> 3. criosezionamento <ol><li> Tagliare 14 micron sezioni seriali sottili in serie &#39;di cinque con un criostato e raccogliere su SuperFrost® Plus Il vetrini per immunofluorescenza (IF) analisi. Conservare i vetrini a -80 ° C fino utilizzato. </li></ol> 4. Tracer visualizzazione Utilizzando la (TSA) Protocol Tyramide amplificazione del segnale <ol><li> Preparare i tamponi e reagenti necessari per la colorazione. Sempre fresco preparare il tampone Tris-NaCl-Tween (TNT) il giorno di utilizzo. <ol><li> Preparare tampone TNT usando 100 ml di 1 M Tris-HCl pH 7,5, 30 ml di NaCl 5 M e DDH 2 O fino ad un volume finale di 1 L. Aggiungere 500 ml di Tween 20 con una pipetta 1 ml. Aggiungere il Tween 20 lentamente e lavare la pipetta su e giù più volte per garantire che tutti Tween 20 è insoluzione. </li><li> Preparare Tris-NaCl-bloccante (TNB) tampone con 100 ml di 1 M Tris-HCl pH 7,5, 30 ml di NaCl 5 M e DDH 2 O fino ad un volume finale di 1 L. Aggiungere 5 g Blocking Reagent (disponibile con il kit) lentamente in piccoli incrementi nel buffer agitando. Riscaldare la soluzione gradualmente a 55 ° C con agitazione continua per sciogliere completamente i reagenti blocco (non dovrebbe richiedere più di 30-60 min). Per ottenere il riscaldamento omogeneo utilizzare un bagno d&#39;acqua a 55 ° C. La soluzione appare lattiginosa. Portare la soluzione a temperatura ambiente prima dell&#39;uso. Aliquota e conservare a -20 ° C per la conservazione a lungo termine. </li><li> Ricostituire biotina reagente tiramide (fornito con il kit) in Biologia Molecolare / HPLC-grade DMSO. A seconda del kit viene utilizzato l&#39;appropriata quantità di DMSO può variare. Conservare la soluzione di riserva a 4 ° C. NOTA: Sezioni di animali eterozigoti per i rispettivi alleli Cre e R26 possono essere utilizzati per l&#39;analisi del circuito. Usa sessioni da littermates trasportano una Cre o un allele R26, rispettivamente, come controlli negativi. Trattare vetrini di controllo negativi esattamente come diapositive di animali doppi eterozigoti. Inoltre, include una diapositiva di controllo da una doppia animale eterozigote, ma lasciare fuori il reagente TSA (controllo non amplificato). </li></ol></li><li> Usando un bisturi affilato fresco rimuovere l&#39;eccesso di ottobre che circonda le sezioni di tessuto e segnare il confine intorno sezioni con una penna PAP. </li><li> Essiccare i vetrini per 2-3 minuti a temperatura ambiente (RT). Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuna. Incubare i vetrini a temperatura ambiente per 30 minuti a 0,3% H soluzione 2 O 2 in metanolo ghiacciata per placare la perossidasi endogena. </li><li> Lavare 3x con PBS per 5 minuti ciascuna a RT. Incubare per 10 minuti a 0,5% Triton X-100 in PBS per permeabilizzazione tessuto. Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuna. </li><li> Block con TNB (soluzione bloccante, 200-300 ml per vetrino) per 30min a RT in una camera umidificata. Assicurarsi che tutte le sezioni sono completamente coperti da TNB. Non lasciate che le diapositive asciugare tra le fasi. </li><li> Scolare il tampone di blocco in eccesso e applicare l&#39;antisiero primario riconoscere il tracciante (1: 1.000 capra anti-WGA per BL, 1: 15.000 coniglio anti-GFP per GTT) diluito in TNB per 2 ore a temperatura ambiente o per una notte a 4 ° C. Assicurarsi di utilizzare un volume sufficiente per coprire completamente la sezione di tessuto (200-300 ml per vetrino). NOTA: Le diluizioni sieri specifici primari raccomandati qui possono avere da regolare. </li><li> Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuno con agitazione. </li><li> Incubare le sezioni con biotinilato antisiero secondario riconoscono l&#39;ospite della prima dell&#39;antisiero (1: 500 cavalli IgG anti-capra anti-WGA, 1: IgG anti-coniglio di capra 5.000 per anti-GFP in TNB per 1 ora a RT). </li><li> Lavare 3x con TNT a temperatura ambiente per 5 minuti ciascuno con agitazione. Incubare in 1: 100 streptavidina (SA) -conjugated perossidasi (SA-HRP, fornito with kit) in TNB per 30 minuti a RT in una camera umidificata. Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuna. Intanto scongelare il TSA. </li><li> Diluire TSA 1:50 TSA amplificazione diluente (fornito con il kit; utilizzare il kit TSA per la visualizzazione di BL e il kit + TSA per GTT). Incubare le sezioni di tessuto in diluita TSA proprio per 10 minuti a temperatura ambiente. Diluire TSA al momento dell&#39;uso, ideale durante la fase di lavaggio precedente, non utilizzare alcun residuo reattivo TSA diluito per futuri esperimenti; sempre preparare fresco. </li><li> Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuno con agitazione. Incubare con 1: 500 Alexa Fluor® 546 streptavidina coniugato in TNB per 30 minuti a RT. Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuno con agitazione. </li><li> Incubare per 10 min in soluzione Bisbenzimide 5% in PBS a temperatura ambiente per colorazione nucleare. Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuno con agitazione. Montare con Fluromount G ed eseguire epifluorescenza o microscopia confocale. <em&gt; Risoluzione: Efficacia di trasferimento tracciante dipenderà dal livello di espressione del locus ROSA26 nelle cellule che producono (determinata dalla linea pilota Cre utilizzato) e sul circuito neurale analizzato (ad esempio numero di neuroni che producono il tracciante, convergenza etc.). Pertanto, le diluizioni sieri specifici primari raccomandati qui possono essere adeguati per evitare segnale basso o in eccesso. Background dovrebbe sempre essere analizzati utilizzando appositi vetrini di controllo (vedi sopra). </li></ol> 5. τlacZ colorazione per sezioni embrionali <ol><li> Preparare i tamponi e reagenti necessari per la colorazione. Sempre fresco preparare il LacZ tampone C prima dell&#39;uso. <ol><li> Preparare 5-bromo-4-cloro-3-indolil-β-D-galattopiranoside (X-gal) soluzione madre (40 mg / ml) aggiungendo 40 g di X-gal a 1 ml 70% dimetilformammide (DMF). Coprire con un foglio di alluminio e conservare a -20 ° C per la conservazione a lungo termine. </li><li> Preparare nitro blu tetrazolio (NBT) stock soluzione (50 mg / ml) aggiungendo 50 g di NBT per 1 ml 70% DMF. Coprire con un foglio di alluminio e conservare a -20 ° C per la conservazione a lungo termine. </li><li> Preparare LacZ fissativo utilizzando 80 ml ​​di 25% glutaraldeide, 5 ml di 4% PFA, 20 ml di 1 M MgCl 2, 100 ml di EGTA 500 ​​mM, 1 ml di 1 M tampone fosfato pH 7,4 e DDH 2 O fino a un finale volume di 10 ml. </li><li> Preparare tampone LacZ A con 1 ml di 1 M MgCl 2, 5 ml di EGTA 500 ​​mM, 50 ml di 1 M tampone fosfato pH 7,4 e DDH 2 O fino ad un volume finale di 500 ml. </li><li> Preparare LacZ tampone B con 1 ml di 1 M MgCl 2, 5 ml di EGTA 500 ​​mm, 5 ml di 1% sodio desossicolato, 100 ml di 10% NP-40, 50 ml di 1 M tampone fosfato pH 7,4 e DDH 2 O fino ad un volume finale di 500 ml. </li><li> Preparare LacZ tampone C con l&#39;aggiunta di 10 ml di soluzione madre NBT e 12,5 ml di soluzione madre X-gal a 1 ml di LacZ tampone B. Trucco fresco appena prima dell&#39;uso e coprire con un foglio di alluminio. </li></ol&gt; </li><li> Asciugare i vetrini a RT almeno per 10-15 minuti (nel frattempo preparare i vetrini con una penna PAP). </li><li> Fissare la sezione con LacZ fissante per 2 minuti a temperatura ambiente in una camera umidificata all&#39;interno di una sostanza chimica fumi-cappuccio. Lavare 3 volte con PBS completato con 2 mM MgCl 2. </li><li> Sciacquare i vetrini con LacZ tampone A. Lavare i vetrini con LacZ tampone A 3 volte per 10 minuti ciascuno a RT. Lavare 2 volte con LacZ tampone B per 5 minuti ciascuno. Incubare i vetrini in LacZ tampone C a 30-37 ° C per 6 ore o durante la notte in una camera umidificata. NOTA: Aggiungere un volume sufficiente di LacZ buffer di C; scivoli non devono asciugare durante l&#39;incubazione. </li><li> Dopo adeguata incubazione lavare i vetrini con PBS integrato con 2 mM MgCl 2. Sciacquare sezioni brevemente con DDH 2 O. Coverslip con glicina gelatina di Mayer. Adatta per un microscopio ottico equipaggiato con un contrasto interferenziale differenziale (DIC) di imaging set-up. </li></ol> 6. Gender e Tracer genotipizzazione <ol><li> Preparare coda tampone di lisi utilizzando 1 ml di 1 M Tris-HCl pH 8,5, 100 ml di EGTA 500 ​​mM, 200 ml di 10% SDS, 400 ml di NaCl 5 M e DDH 2 O per fare un volume finale di 10 ml. </li><li> Aggiungere 500 pl di tampone di lisi coda a ciascuna provetta Eppendorf contenente una biopsia coda. Aggiungere proteinasi K ad una concentrazione finale di 100 mg / ml. Incubare per una notte su un agitatore a 55 ° C. </li><li> Centrifugare i campioni a 17.000 xg per 10 minuti a temperatura ambiente. Trasferire il surnatante in una nuova provetta da centrifuga. Aggiungere 500 ml di isopropanolo al supernatante. Mescolare per almeno 5 minuti invertendo i tubi su e giù. </li><li> Spin in centrifugare a 17.000 xg per 5 minuti a temperatura ambiente. Eliminare il surnatante. Aggiungere 200 ml di etanolo al 70%. Agitare per almeno 5 minuti. </li><li> Centrifugare a 17.000 g per 5 min. Rimuovere il surnatante con una Pipetman (non versare off). Essiccare il pellet in una camera calda (37 ° C) per 15-30 min. </li><li> Risospendere pellet in 100 mlbassa TE pH 8,0 o acqua con punte ampio tunnel filtrata. Mettere in 55 ° C per 1 ora ea 37 ° C per una notte per una corretta dissoluzione. Conservare a 4 ° C. </li><li> Usare 1 ml di DNA per reazione PCR (miscela di reazione 50 microlitri contenente 1 ml di DNA coda, 2,5 microlitri DMSO, 10:00 di ciascun primer, 25 mM di ciascun dNTP, e betaina 1M). Primer PCR per la genotipizzazione e l&#39;identificazione di genere sono elencati nella tabella dei materiali. </li></ol>

<ol>
	<li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals.">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li><li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+approaches+to+neural+circuits+in+the+mouse.">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li><li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+half+century+of+experimental+neuroanatomical+tracing.">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li><li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus.">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li><li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero.">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li><li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+approach+to+trace+neural+circuits.">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li><li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice.">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li><li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54.">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li><li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GPR54+gene+as+a+regulator+of+puberty.">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li><li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons.">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li><li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice.">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67 (2005).</li><li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene.">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li><li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-activated+site-specific+recombination+in+mice.">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li></ol>

No conflict of interest declared.

Esprimendo traccianti transsynaptic come transgeni per rintracciare i circuiti neurali di popolazioni di neuroni geneticamente definiti ha diversi vantaggi rispetto alla iniezione stereotassica di traccianti o virus neurotopic. Innanzitutto, il tracciante viene prodotta come proteina endogena e pertanto non suscitare una risposta immunitaria e un percorso neurale selettiva può essere analizzato in diversi animali con elevata riproducibilità. In secondo luogo, perché questo è un metodo non invasivo può essere utiliz...

Anatomico percorso tracciato è uno degli strumenti più comunemente utilizzati per decifrare il rapporto tra cervello e comportamento 1. Avanzamento in tecnologie dei circuiti neurali tracciatura ha concesso neuroscienziati con la possibilità di ricostruire i circuiti neurali da popolazioni di neuroni geneticamente identificati nei topi 2. Nonostante questi progressi tecnici rimane difficile da svelare la formazione dei circuiti neurali soprattutto durante la maturazione embrionale. Questo perché la maggior parte dei metodi di tracciamento sviluppati fino ad oggi sono basate su iniezione stereotassica di rivelatori transsynaptic o virus neurotropici geneticamente modificati (Figura 1) 2,3. Mentre queste tecniche raggiungono risoluzione spaziale e temporale della connettività, alcuni limiti intrinseci, come tecnicamente impegnativi iniezioni traccianti nel cervello in via di sviluppo, la riproducibilità del sito di iniezione, potenziale infiammazione al sito di iniezione e più importanza citotossicità causata da virus neurotropici limitare il loro utilizzo 4. Un metodo alternativo è quello di esprimere i traccianti transsynaptic come transgeni in topi geneticamente modificati. Abbiamo recentemente modificato questa tecnica e sviluppato un sistema binario transsynaptic genetico analisi per mappare i circuiti neurali di qualsiasi popolazione neuronale geneticamente identificato 5. La nostra strategia sperimentale si basa su due nuovi ceppi di topi knock-in, che esprimono sia la lectina bidirezionale tracciante orzo (BL) 6 o il tracciante retrogrado tossina tetanica frammento C fusa a GFP (GTT) 7 dalla ROSA 26 locus dopo Cre-mediata ricombinazione. Qui abbiamo usato questi ceppi di topi per esprimere selettivamente BL e GTT in neuroni che producono kisspeptin, un neuropeptide che è implicato nella regolazione della maturazione dell&#39;asse riproduttivo 8,9. Dimostriamo che questa tecnica è adatta per visualizzare lo sviluppo e la maturazione del baciopeptin circuiti neurali durante lo sviluppo embrionale del topo cervello femminile 5. Strategia di allevamento La R26-BL-IRES-τlacZ (BIZ) e R26-GFP-TTC (GTT) linee traccianti sono knock-in ceppi 5 che portano alleli ROSA26 ricombinanti. La R26-BIZ e gli alleli R26-GTT sono trascrizionalmente silente a causa della presenza di un forte segnale di arresto della trascrizione, che è affiancato da due siti loxP 5. Espressione del transgene BIZ e GTT è attivato dalla rimozione Cre-mediata del segnale di arresto trascrizionale. Gli alleli R26-BIZ e R26-GTT possono essere utilizzati indipendentemente attraversando semplicemente con una linea pilota Cre. Per gli animali di analisi eterozigoti per i rispettivi alleli Cre e R26 può essere utilizzato. Nidiata che trasportano una Cre o un allele R26, rispettivamente, dovrebbero essere utilizzati come controlli. In alternativa, è anche possibile generare tRiple knock-in animali portatori degli alleli Cre, R26-BIZ e R26-GTT, tuttavia ciò richiederà una croce supplementare.

<table border="0" cellpadding="0" cellspacing="0" width="721">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:219px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bisbenzimide (Hoechst 33258 dye)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">14530-100MG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">32205-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryo mold (Peel-a-way)</td>
			<td style="width:219px;">Polyscience Inc.</td>
			<td style="width:119px;">18646A-1</td>
			<td>22mm x 22mm x 20mm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DMSO</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D8418-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Dimethyl Formamide (DMF)</td>
			<td style="width:219px;">VWR Chemicals</td>
			<td style="width:119px;">23470,293</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EGTA</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3054.3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fluoromount G</td>
			<td style="width:219px;">Southern Biotech</td>
			<td style="width:119px;">0100-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glutaraldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">G5882-50ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hydrogen peroxide</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">34988-7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Isopentane (Methyl 2-butane)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">M32631-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kaiser&#39;s Glycine gelatin</td>
			<td style="width:219px;">Merck</td>
			<td style="width:119px;">1092420100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Methanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">494437-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">MgCl2</td>
			<td style="width:219px;">Sigma</td>
			<td>M2670-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NaCl</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">HN00.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NBT</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">298-83-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Nonidet P40 substitute</td>
			<td style="width:219px;">Fluka</td>
			<td style="width:119px;">743.85</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">OCT</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">14020108926</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PAP pen</td>
			<td style="width:219px;">Dako</td>
			<td style="width:119px;">S2002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Parafarmaldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">P6148-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium deoxycholate</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D6750-25G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sucrose</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">S7903-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Superfrost slides</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">FT4981GLPLUS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL700</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA plus kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL749A001KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">AE15.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Triton-X 100</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3051.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tween 20</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">9127.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">X-gal</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">2315.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryostat</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">na</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Light microscope equipped with DIC imaging&#160;</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Fluroscence microscope</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Photoshop</td>
			<td style="width:219px;">Adobe</td>
			<td style="width:119px;">PS6</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Goat anti-WGA (recognizes BL)</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">AS-2024</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylayted horse anti-goat IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-9500&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated goat anti-rabbit IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-1000&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Rabbit anti-GFP (recognizes GTT)</td>
			<td style="width:219px;">Invitrogen</td>
			<td style="width:119px;">A11122</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rabbit anti-GnRH</td>
			<td style="width:219px;">Affinity Bio Reagent</td>
			<td style="width:119px;">PA1-121</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dylight488-donkey anti-rabbit IgG</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">SA5-10038</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SA-Alexa Fluor 546</td>
			<td style="width:219px;">Life Technologies</td>
			<td>S-11225</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Primers</td>
			<td style="width:219px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Fwd (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;ATGAAGATGATGAGCACCAG 
			GGC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Rev&#160; (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;AGCCCTCGCCGCAGAACTC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Fwd&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCGATGCAACGAGTGATGAG 
			GTTCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Rev&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCAGGCTAAGTGCCTTCTCTAC 
			ACCTGC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Fwd&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">AGCAAGGGCGAGGAGCTGTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Rev&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCTTGTAGTTGCCGTCGTCCT 
			TGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Fwd (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">TGAAGCTTTTGGCTTTGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Rev&#160; (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCGCTGCCAAATTCTTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ROSA26 Fwd</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">ROSA26 Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">GCAGATGGAGCGGGAGAAAT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">SA Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
	</tbody>
</table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

Questa sezione mostra i risultati rappresentativi che possono essere ottenuti lavorando con la R26-BIZ (B L- I RES-τlac Z) e la R26-GTT (G FP TT C) alleli. Qui usiamo la R26-BIZ e gli alleli R26-GTT per analizzare la maturazione dei circuiti neurali che regolano l&#39;asse riproduttivo. La riproduzione in vertebrati è controllata centralmente da un piccolo sottogruppo di neuroni dell&#39;ipotalamo, che secernono l&#39;ormone di rilascio delle gonadotropin...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

Condizionale genetica Transsynaptic Tracing nel cervello embrionali di topo

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.6K Views.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

Video: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Manual Drainage of the Zebrafish Embryonic Brain Ventricles

Cerebrospinal fluid (CSF) is a protein rich fluid contained within the brain ventricles. It is present during early vertebrate embryonic development and persists throughout life. Adult CSF is thought to cushion the brain, remove waste, and carry secreted molecules1,2. In the adult and older embryo, the majority of CSF is made by the choroid plexus, a series of highly vascularized secretory regions located adjacent to the brain ventricles3-5. In zebrafish, the choroid plexus is fully formed at 144 hours post fertilization (hpf)6. Prior to this, in both zebrafish and other vertebrate embryos including mouse, a significant amount of embryonic CSF (eCSF) is present . These data and studies in chick suggest that the neuroepithelium is secretory early in development and may be the major source of eCSF prior to choroid plexus development7.
eCSF contains about three times more protein than adult CSF, suggesting that it may have an important role during development8,9. Studies in chick and mouse demonstrate that secreted factors in the eCSF, fluid pressure, or a combination of these, are important for neurogenesis, gene expression, cell proliferation, and cell survival in the neuroepithelium10-20. Proteomic analyses of human, rat, mouse, and chick eCSF have identified many proteins that may be necessary for CSF function. These include extracellular matrix components, apolipoproteins, osmotic pressure regulating proteins, and proteins involved in cell death and proliferation21-24. However, the complex functions of the eCSF are largely unknown.
We have developed a method for removing eCSF from zebrafish brain ventricles, thus allowing for identification of eCSF components and for analysis of the eCSF requirement during development. Although more eCSF can be collected from other vertebrate systems with larger embryos, eCSF can be collected from the earliest stages of zebrafish development, and under genetic or environmental conditions that lead to abnormal brain ventricle volume or morphology. Removal and collection of eCSF allows for mass spectrometric analysis, investigation of eCSF function, and reintroduction of select factors into the ventricles to assay their function. Thus the accessibility of the early zebrafish embryo allows for detailed analysis of eCSF function during development.

We present a method to collect cerebrospinal fluid (CSF) and to create a system which lacks CSF within the embryonic zebrafish brain ventricular system. This allows for further examination of CSF composition and its requirement during embryonic brain development.

Drenaggio manuale dei ventricoli cerebrali embrionali zebrafish

Cerebrospinal fluid  (CSF) is a protein rich fluid contained within the brain ventricles. It is  present during early vertebrate embryonic development and ...

Ricerca

Neuroscienze

Selective Tracing of Auditory Fibers in the Avian Embryonic Vestibulocochlear Nerve

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling of auditory axons within the VIIIth cranial nerve would enhance the study of central auditory circuit development. This approach is challenging because multiple sensory organs of the inner ear contribute to the VIIIth nerve 1. Moreover, markers that reliably distinguish auditory versus vestibular groups of axons within the avian VIIIth nerve have yet to be identified. Auditory and vestibular pathways cannot be distinguished functionally in early embryos, as sensory-evoked responses are not present before the circuits are formed. Centrally projecting VIIIth nerve axons have been traced in some studies, but auditory axon labeling was accompanied by labeling from other VIIIth nerve components 2,3. Here, we describe a method for anterograde tracing from the acoustic ganglion to selectively label auditory axons within the developing VIIIth nerve. First, after partial dissection of the anterior cephalic region of an 8-day chick embryo immersed in oxygenated artificial cerebrospinal fluid, the cochlear duct is identified by anatomical landmarks. Next, a fine pulled glass micropipette is positioned to inject a small amount of rhodamine dextran amine into the duct and adjacent deep region where the acoustic ganglion cells are located. Within thirty minutes following the injection, auditory axons are traced centrally into the hindbrain and can later be visualized following histologic preparation. This method provides a useful tool for developmental studies of peripheral to central auditory circuit formation.

Here we describe a microdissection technique followed by fluorescent dye injection into the acoustic ganglion of early chick embryos for selective tracing of auditory axon fibers in the nerve and hindbrain.

L&#39;analisi selettiva delle fibre uditive nel aviaria Nerve Embryonic vestibolococleare

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling ...

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Iniezione stereotassica di un vettore virale per la manipolazione del gene condizionale nel midollo spinale del mouse

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

Angiogenesis is the complex process of new blood vessel formation defined by the sprouting of new blood vessels from a pre-existing vessel network. Angiogenesis plays a key role not only in normal development of organs and tissues, but also in many diseases in which blood vessel formation is dysregulated, such as cancer, blindness and ischemic diseases. In adult life, blood vessels are generally quiescent so angiogenesis is an important target for novel drug development to try and regulate new vessel formation specifically in disease. In order to better understand angiogenesis and to develop appropriate strategies to regulate it, models are required that accurately reflect the different biological steps that are involved. The mouse neonatal retina provides an excellent model of angiogenesis because arteries, veins and capillaries develop to form a vascular plexus during the first week after birth. This model also has the advantage of having a two-dimensional (2D) structure making analysis straightforward compared with the complex 3D anatomy of other vascular networks. By analyzing the retinal vascular plexus at different times after birth, it is possible to observe the various stages of angiogenesis under the microscope. This article demonstrates a straightforward procedure for analyzing the vasculature of a mouse retina using fluorescent staining with isolectin and vascular specific antibodies.

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

The neonatal murine retina provides a well characterized physiological model of angiogenesis, which permits investigations of the roles of different genes or drugs that modulate angiogenesis in an in vivo context. Immunofluorescent staining to accurately visualize the vascular plexus is pivotal to the success of these types of studies.

Tutta Monte immunofluorescenza del mouse Retina neonatale per Indagare Angiogenesi<em&gt; In vivo</em

Angiogenesis  is the complex process of new blood vessel formation defined by the sprouting  of new blood vessels from a pre-existing vessel network. ...

Transsynaptic Tracing from Peripheral Targets with Pseudorabies Virus Followed by Cholera Toxin and Biotinylated Dextran Amines Double Labeling

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This approach has been most extensively used in the brain by utilizing the swine pathogen pseudorabies virus (PRV)1. PRV does not infect great apes, including humans, so it is most commonly used in studies on small mammals, especially rodents. The pseudorabies strain PRV152 expresses the enhanced green fluorescent protein (eGFP) reporter gene and only crosses functional synapses retrogradely through the hierarchical sequence of synaptic connections away from the infection site2,3. Other PRV strains have distinct microbiological properties and may be transported in both directions (PRV-Becker and PRV-Kaplan)4,5&#160;.&#160;This protocol will deal exclusively with PRV152. By delivering the virus at a peripheral site, such as muscle, it is possible to limit the entry of the virus into the brain through a specific set of neurons. The resulting pattern of eGFP signal throughout the brain then resolves the neurons that are connected to the initially infected cells. As the distributed nature of transsynaptic tracing with pseudorabies virus makes interpreting specific connections within an identified network difficult, we present a sensitive and reliable method employing biotinylated dextran amines (BDA) and cholera toxin subunit b (CTb) for confirming the connections between cells identified using PRV152. Immunochemical detection of BDA and CTb with peroxidase and DAB (3, 3&#39;-diaminobenzidine) was chosen because they are effective at revealing cellular processes including distal dendrites6-11.

Transsynaptic tracing has become a powerful tool for analyzing central efferents regulating peripheral targets through multi-synaptic circuits. Here we present a protocol that exploits the transsynaptic pseudorabies virus to identify and localize a functional brain circuit, followed by classical tract tracing techniques to validate specific connections in the circuit between identified groups of neurons.

Transsynaptic Tracing da obiettivi periferiche con Pseudorabies virus seguito da tossina colerica e Biotinilato Dextran ammine doppia etichettatura

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Isolamento e coltura di cellule endoteliali dal embrionali Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow for an in-depth characterization to identify pathways involved in these events. Cerebellar granule neurons (CGNs) that are derived from the developing cerebellum are an ideal model system that allows for morphological analyses. Here, we describe a method of how to genetically manipulate CGNs and how to study axono- and dendritogenesis of individual neurons. With this method the effects of RNA interference, overexpression or small molecules can be compared to control neurons. In addition, the rodent cerebellar cortex is an easily accessible in vivo system owing to its predominant postnatal development. We also present an in vivo electroporation technique to genetically manipulate the developing cerebella and describe subsequent cerebellar analyses to assess neuronal morphology and migration.

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Neuronal morphogenesis and migration are crucial events underlying proper brain development. Here, we describe methods to genetically manipulate cultured cerebellar granule neurons and the developing cerebellum for the assessment of morphology and migratory characteristics of neurons.

Manipolazione genetica delle cerebellare granuli neuroni<em&gt; In Vitro</em&gt; E<em&gt; In Vivo</em&gt; Per studiare neuronale Morfologia e migrazione

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow ...

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this information to the brain. As such, determining how olfactory information is transferred to the brain, modifying both perception and behavior, merits investigation. Interestingly, there is emerging evidence that cellular transduction and transcriptional factors are involved in the diversification of olfactory receptor neuron. Here we provide a robust whole mount immunological labeling method to assay in vivo olfactory receptor neuron organization. Using this method, we identified all olfactory receptor neurons with anti-ELAV antibody, a known pan-neural marker and Or49a-mCD8::GFP, an olfactory receptor neuron specifically expressed in Nba neuron using anti-GFP antibody.

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Herein we describe the process of whole mount immunostaining of Drosophila antennae, which enables us to better understand the molecular mechanisms involved in the diversification of olfactory receptor neurons (ORN)s.

Tutta Monte immunomarcatura di recettore olfattivo neuroni nel<em&gt; Drosophila</em&gt; Antenna

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

Immagini dal vivo della mitosi in via di sviluppo embrionali di topo Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the ...

Laser-guided Neuronal Tracing In Brain Explants

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake through electroporation in brain explants with targeted laser illumination and matching filter goggles during the procedure. The described technique of in vitro electroporation by itself yields relatively good visual control for targetting certain areas of the brain. By combining it with laser excitation of fluorescent genetic markers and their read-out through band-passing filter goggles, which can pick up the emissions of the genetically labeled cells/nuclei and the fluorescent tracing dye, a researcher can substantially increase the accuracy of injections by finding the area of interest and controlling for the dye-spread/uptake in the injection area much more efficiently. In addition, the laser illumination technique allows to study the functionality of a given neurocircuit by providing information about the type of neurons projecting to a certain area in cases where the GFP expression is linked to the type of transmitter expressed by a subpopulation of neurons.

We describe a technique to label neurons and their processes via anterograde or retrograde tracer injections into brain nuclei using an in vitro preparation. We modified an existing method of in vitro tracer electroporation by taking advantage of fluorescently labeled mouse mutants and basic optical equipment in order to increase labeling accuracy.

Neuronal Tracing negli espianti cerebrali a guida laser

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake ...