Name: conditional genetic transsynaptic tracing in the embryonic mouse brain
Uploaded: 2014-12-22T14:00:00.000+00:00
Duration: 11 min 3 s
Description: Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

NOTA: Etica Dichiarazione: procedure che coinvolgono soggetti animali sono stati approvati dal comitato il benessere degli animali dell&#39;Università di Amburgo e l&#39;Università di Saarland. 1. Preparazione e fissaggio del tessuto embrionale <ol><li> Disporre tutte le attrezzature necessarie per sezionare gli embrioni e preparare soluzioni per il successivo fissaggio del tessuto prima di sacrificare gli animali. NOTA: preparare sempre una soluzione fresca 4% paraformaldeide (PFA) (4% PFA in 0.1 M tampone fosfato salino (PBS), regolare il pH a 7,4). </li><li> Euthanize cronometrato femmina incinta mouse con una procedura eticamente approvati. </li><li> Trasferire il mouse su una piattaforma. Bagnare la parte ventrale dell&#39;addome con il 70% di etanolo e fare una incisione verticale usando forbici affilate per esporre la cavità addominale. </li><li> Identificare la catena embrionale ed estrarlo con cautela utilizzando una pinza smussato e metterlo in ghiaccio freddo PBS. </li><li> Rimuovere i singoli embrioni dala catena embrionale con le forbici sottili e pinze. Rimuovere il tessuto in più intorno gli embrioni e lavarli in ghiacciata PBS. </li><li> Prendete una piccola biopsia coda (prima di trasferire l&#39;embrione in PFA) e incubare in coda tampone di lisi per l&#39;identificazione di genere e tracciante allele genotipizzazione PCR. </li><li> Avviare dall&#39;embrione al lato più laterale e trasferire ogni embrione separatamente in una provetta contenente ghiacciata 4% PFA su ghiaccio su un agitatore. </li><li> Immergere gli embrioni all&#39;età di E13.5 o più giovani per 1,5 ore sul ghiaccio con costante agitazione. Immergere gli embrioni a E14.5 età e E15.5 per 2,5 ore sul ghiaccio con costante agitazione. </li><li> Per E16.5 embrioni età o più anziani, decapitate e togliere la pelle esterna prima immersione della testa in soluzione PFA. Capi di embrioni E16.5 possono essere messi a bagno per 4,5 ore sul ghiaccio con costante agitazione. </li><li> Dopo la fissazione del caso, lavare gli embrioni tre volte con PBS freddo. Trasferire gli embrioni in 30% di saccarosio in soluzione PBS a 4 ° C fino affondanoal fondo. </li></ol> 2. Congelamento <ol><li> Disporre tutti i materiali necessari prima di iniziare il processo di congelamento: crio-muffa, crio-guanti, pinze piuma entomologia, pennarello e composti temperatura di taglio ottimale (OCT) </li><li> Etichettare la crio-stampo con un pennarello resistente all&#39;alcool permanente (citare l&#39;orientamento del tessuto, la data e il genotipo). Preparare una granita di ghiaccio secco tritato e il 100% di etanolo in un secchio di ghiaccio. Posizionare un bicchiere di vetro all&#39;interno contenente isopentano. Attendere 10 minuti per il isopentano raffreddare. </li><li> Nel frattempo rimuovere il tessuto dalla soluzione di saccarosio, eliminare l&#39;eccesso di saccarosio in tutto il tessuto con salviette di laboratorio. Trasferire il tessuto in una pre-etichettati crio-stampo con sufficiente ottobre per coprire il tessuto. Evitare eventuali bolle d&#39;aria nel ottobre; soprattutto intorno il tessuto. </li><li> Orientare il tessuto in ottobre con pinze entomologia piuma per evitare danni ai tessuti. Inizia congelamento trasferendo la crio-mold nel bagno isopentano pre-raffreddato. Non schizzare isopentano in ottobre in quanto non congelerà correttamente. Avvolgere i campioni in un foglio di alluminio e conservare a -80 ° C. </li></ol> 3. criosezionamento <ol><li> Tagliare 14 micron sezioni seriali sottili in serie &#39;di cinque con un criostato e raccogliere su SuperFrost® Plus Il vetrini per immunofluorescenza (IF) analisi. Conservare i vetrini a -80 ° C fino utilizzato. </li></ol> 4. Tracer visualizzazione Utilizzando la (TSA) Protocol Tyramide amplificazione del segnale <ol><li> Preparare i tamponi e reagenti necessari per la colorazione. Sempre fresco preparare il tampone Tris-NaCl-Tween (TNT) il giorno di utilizzo. <ol><li> Preparare tampone TNT usando 100 ml di 1 M Tris-HCl pH 7,5, 30 ml di NaCl 5 M e DDH 2 O fino ad un volume finale di 1 L. Aggiungere 500 ml di Tween 20 con una pipetta 1 ml. Aggiungere il Tween 20 lentamente e lavare la pipetta su e giù più volte per garantire che tutti Tween 20 è insoluzione. </li><li> Preparare Tris-NaCl-bloccante (TNB) tampone con 100 ml di 1 M Tris-HCl pH 7,5, 30 ml di NaCl 5 M e DDH 2 O fino ad un volume finale di 1 L. Aggiungere 5 g Blocking Reagent (disponibile con il kit) lentamente in piccoli incrementi nel buffer agitando. Riscaldare la soluzione gradualmente a 55 ° C con agitazione continua per sciogliere completamente i reagenti blocco (non dovrebbe richiedere più di 30-60 min). Per ottenere il riscaldamento omogeneo utilizzare un bagno d&#39;acqua a 55 ° C. La soluzione appare lattiginosa. Portare la soluzione a temperatura ambiente prima dell&#39;uso. Aliquota e conservare a -20 ° C per la conservazione a lungo termine. </li><li> Ricostituire biotina reagente tiramide (fornito con il kit) in Biologia Molecolare / HPLC-grade DMSO. A seconda del kit viene utilizzato l&#39;appropriata quantità di DMSO può variare. Conservare la soluzione di riserva a 4 ° C. NOTA: Sezioni di animali eterozigoti per i rispettivi alleli Cre e R26 possono essere utilizzati per l&#39;analisi del circuito. Usa sessioni da littermates trasportano una Cre o un allele R26, rispettivamente, come controlli negativi. Trattare vetrini di controllo negativi esattamente come diapositive di animali doppi eterozigoti. Inoltre, include una diapositiva di controllo da una doppia animale eterozigote, ma lasciare fuori il reagente TSA (controllo non amplificato). </li></ol></li><li> Usando un bisturi affilato fresco rimuovere l&#39;eccesso di ottobre che circonda le sezioni di tessuto e segnare il confine intorno sezioni con una penna PAP. </li><li> Essiccare i vetrini per 2-3 minuti a temperatura ambiente (RT). Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuna. Incubare i vetrini a temperatura ambiente per 30 minuti a 0,3% H soluzione 2 O 2 in metanolo ghiacciata per placare la perossidasi endogena. </li><li> Lavare 3x con PBS per 5 minuti ciascuna a RT. Incubare per 10 minuti a 0,5% Triton X-100 in PBS per permeabilizzazione tessuto. Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuna. </li><li> Block con TNB (soluzione bloccante, 200-300 ml per vetrino) per 30min a RT in una camera umidificata. Assicurarsi che tutte le sezioni sono completamente coperti da TNB. Non lasciate che le diapositive asciugare tra le fasi. </li><li> Scolare il tampone di blocco in eccesso e applicare l&#39;antisiero primario riconoscere il tracciante (1: 1.000 capra anti-WGA per BL, 1: 15.000 coniglio anti-GFP per GTT) diluito in TNB per 2 ore a temperatura ambiente o per una notte a 4 ° C. Assicurarsi di utilizzare un volume sufficiente per coprire completamente la sezione di tessuto (200-300 ml per vetrino). NOTA: Le diluizioni sieri specifici primari raccomandati qui possono avere da regolare. </li><li> Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuno con agitazione. </li><li> Incubare le sezioni con biotinilato antisiero secondario riconoscono l&#39;ospite della prima dell&#39;antisiero (1: 500 cavalli IgG anti-capra anti-WGA, 1: IgG anti-coniglio di capra 5.000 per anti-GFP in TNB per 1 ora a RT). </li><li> Lavare 3x con TNT a temperatura ambiente per 5 minuti ciascuno con agitazione. Incubare in 1: 100 streptavidina (SA) -conjugated perossidasi (SA-HRP, fornito with kit) in TNB per 30 minuti a RT in una camera umidificata. Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuna. Intanto scongelare il TSA. </li><li> Diluire TSA 1:50 TSA amplificazione diluente (fornito con il kit; utilizzare il kit TSA per la visualizzazione di BL e il kit + TSA per GTT). Incubare le sezioni di tessuto in diluita TSA proprio per 10 minuti a temperatura ambiente. Diluire TSA al momento dell&#39;uso, ideale durante la fase di lavaggio precedente, non utilizzare alcun residuo reattivo TSA diluito per futuri esperimenti; sempre preparare fresco. </li><li> Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuno con agitazione. Incubare con 1: 500 Alexa Fluor® 546 streptavidina coniugato in TNB per 30 minuti a RT. Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuno con agitazione. </li><li> Incubare per 10 min in soluzione Bisbenzimide 5% in PBS a temperatura ambiente per colorazione nucleare. Lavare i vetrini a RT 3x con TNT per 5 minuti ciascuno con agitazione. Montare con Fluromount G ed eseguire epifluorescenza o microscopia confocale. <em&gt; Risoluzione: Efficacia di trasferimento tracciante dipenderà dal livello di espressione del locus ROSA26 nelle cellule che producono (determinata dalla linea pilota Cre utilizzato) e sul circuito neurale analizzato (ad esempio numero di neuroni che producono il tracciante, convergenza etc.). Pertanto, le diluizioni sieri specifici primari raccomandati qui possono essere adeguati per evitare segnale basso o in eccesso. Background dovrebbe sempre essere analizzati utilizzando appositi vetrini di controllo (vedi sopra). </li></ol> 5. τlacZ colorazione per sezioni embrionali <ol><li> Preparare i tamponi e reagenti necessari per la colorazione. Sempre fresco preparare il LacZ tampone C prima dell&#39;uso. <ol><li> Preparare 5-bromo-4-cloro-3-indolil-β-D-galattopiranoside (X-gal) soluzione madre (40 mg / ml) aggiungendo 40 g di X-gal a 1 ml 70% dimetilformammide (DMF). Coprire con un foglio di alluminio e conservare a -20 ° C per la conservazione a lungo termine. </li><li> Preparare nitro blu tetrazolio (NBT) stock soluzione (50 mg / ml) aggiungendo 50 g di NBT per 1 ml 70% DMF. Coprire con un foglio di alluminio e conservare a -20 ° C per la conservazione a lungo termine. </li><li> Preparare LacZ fissativo utilizzando 80 ml ​​di 25% glutaraldeide, 5 ml di 4% PFA, 20 ml di 1 M MgCl 2, 100 ml di EGTA 500 ​​mM, 1 ml di 1 M tampone fosfato pH 7,4 e DDH 2 O fino a un finale volume di 10 ml. </li><li> Preparare tampone LacZ A con 1 ml di 1 M MgCl 2, 5 ml di EGTA 500 ​​mM, 50 ml di 1 M tampone fosfato pH 7,4 e DDH 2 O fino ad un volume finale di 500 ml. </li><li> Preparare LacZ tampone B con 1 ml di 1 M MgCl 2, 5 ml di EGTA 500 ​​mm, 5 ml di 1% sodio desossicolato, 100 ml di 10% NP-40, 50 ml di 1 M tampone fosfato pH 7,4 e DDH 2 O fino ad un volume finale di 500 ml. </li><li> Preparare LacZ tampone C con l&#39;aggiunta di 10 ml di soluzione madre NBT e 12,5 ml di soluzione madre X-gal a 1 ml di LacZ tampone B. Trucco fresco appena prima dell&#39;uso e coprire con un foglio di alluminio. </li></ol&gt; </li><li> Asciugare i vetrini a RT almeno per 10-15 minuti (nel frattempo preparare i vetrini con una penna PAP). </li><li> Fissare la sezione con LacZ fissante per 2 minuti a temperatura ambiente in una camera umidificata all&#39;interno di una sostanza chimica fumi-cappuccio. Lavare 3 volte con PBS completato con 2 mM MgCl 2. </li><li> Sciacquare i vetrini con LacZ tampone A. Lavare i vetrini con LacZ tampone A 3 volte per 10 minuti ciascuno a RT. Lavare 2 volte con LacZ tampone B per 5 minuti ciascuno. Incubare i vetrini in LacZ tampone C a 30-37 ° C per 6 ore o durante la notte in una camera umidificata. NOTA: Aggiungere un volume sufficiente di LacZ buffer di C; scivoli non devono asciugare durante l&#39;incubazione. </li><li> Dopo adeguata incubazione lavare i vetrini con PBS integrato con 2 mM MgCl 2. Sciacquare sezioni brevemente con DDH 2 O. Coverslip con glicina gelatina di Mayer. Adatta per un microscopio ottico equipaggiato con un contrasto interferenziale differenziale (DIC) di imaging set-up. </li></ol> 6. Gender e Tracer genotipizzazione <ol><li> Preparare coda tampone di lisi utilizzando 1 ml di 1 M Tris-HCl pH 8,5, 100 ml di EGTA 500 ​​mM, 200 ml di 10% SDS, 400 ml di NaCl 5 M e DDH 2 O per fare un volume finale di 10 ml. </li><li> Aggiungere 500 pl di tampone di lisi coda a ciascuna provetta Eppendorf contenente una biopsia coda. Aggiungere proteinasi K ad una concentrazione finale di 100 mg / ml. Incubare per una notte su un agitatore a 55 ° C. </li><li> Centrifugare i campioni a 17.000 xg per 10 minuti a temperatura ambiente. Trasferire il surnatante in una nuova provetta da centrifuga. Aggiungere 500 ml di isopropanolo al supernatante. Mescolare per almeno 5 minuti invertendo i tubi su e giù. </li><li> Spin in centrifugare a 17.000 xg per 5 minuti a temperatura ambiente. Eliminare il surnatante. Aggiungere 200 ml di etanolo al 70%. Agitare per almeno 5 minuti. </li><li> Centrifugare a 17.000 g per 5 min. Rimuovere il surnatante con una Pipetman (non versare off). Essiccare il pellet in una camera calda (37 ° C) per 15-30 min. </li><li> Risospendere pellet in 100 mlbassa TE pH 8,0 o acqua con punte ampio tunnel filtrata. Mettere in 55 ° C per 1 ora ea 37 ° C per una notte per una corretta dissoluzione. Conservare a 4 ° C. </li><li> Usare 1 ml di DNA per reazione PCR (miscela di reazione 50 microlitri contenente 1 ml di DNA coda, 2,5 microlitri DMSO, 10:00 di ciascun primer, 25 mM di ciascun dNTP, e betaina 1M). Primer PCR per la genotipizzazione e l&#39;identificazione di genere sono elencati nella tabella dei materiali. </li></ol>

<ol>
	<li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals.">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li><li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+approaches+to+neural+circuits+in+the+mouse.">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li><li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+half+century+of+experimental+neuroanatomical+tracing.">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li><li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus.">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li><li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero.">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li><li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+approach+to+trace+neural+circuits.">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li><li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice.">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li><li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54.">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li><li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GPR54+gene+as+a+regulator+of+puberty.">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li><li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons.">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li><li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice.">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67 (2005).</li><li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene.">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li><li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-activated+site-specific+recombination+in+mice.">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li></ol>

No conflict of interest declared.

Esprimendo traccianti transsynaptic come transgeni per rintracciare i circuiti neurali di popolazioni di neuroni geneticamente definiti ha diversi vantaggi rispetto alla iniezione stereotassica di traccianti o virus neurotopic. Innanzitutto, il tracciante viene prodotta come proteina endogena e pertanto non suscitare una risposta immunitaria e un percorso neurale selettiva può essere analizzato in diversi animali con elevata riproducibilità. In secondo luogo, perché questo è un metodo non invasivo può essere utiliz...

Anatomico percorso tracciato è uno degli strumenti più comunemente utilizzati per decifrare il rapporto tra cervello e comportamento 1. Avanzamento in tecnologie dei circuiti neurali tracciatura ha concesso neuroscienziati con la possibilità di ricostruire i circuiti neurali da popolazioni di neuroni geneticamente identificati nei topi 2. Nonostante questi progressi tecnici rimane difficile da svelare la formazione dei circuiti neurali soprattutto durante la maturazione embrionale. Questo perché la maggior parte dei metodi di tracciamento sviluppati fino ad oggi sono basate su iniezione stereotassica di rivelatori transsynaptic o virus neurotropici geneticamente modificati (Figura 1) 2,3. Mentre queste tecniche raggiungono risoluzione spaziale e temporale della connettività, alcuni limiti intrinseci, come tecnicamente impegnativi iniezioni traccianti nel cervello in via di sviluppo, la riproducibilità del sito di iniezione, potenziale infiammazione al sito di iniezione e più importanza citotossicità causata da virus neurotropici limitare il loro utilizzo 4. Un metodo alternativo è quello di esprimere i traccianti transsynaptic come transgeni in topi geneticamente modificati. Abbiamo recentemente modificato questa tecnica e sviluppato un sistema binario transsynaptic genetico analisi per mappare i circuiti neurali di qualsiasi popolazione neuronale geneticamente identificato 5. La nostra strategia sperimentale si basa su due nuovi ceppi di topi knock-in, che esprimono sia la lectina bidirezionale tracciante orzo (BL) 6 o il tracciante retrogrado tossina tetanica frammento C fusa a GFP (GTT) 7 dalla ROSA 26 locus dopo Cre-mediata ricombinazione. Qui abbiamo usato questi ceppi di topi per esprimere selettivamente BL e GTT in neuroni che producono kisspeptin, un neuropeptide che è implicato nella regolazione della maturazione dell&#39;asse riproduttivo 8,9. Dimostriamo che questa tecnica è adatta per visualizzare lo sviluppo e la maturazione del baciopeptin circuiti neurali durante lo sviluppo embrionale del topo cervello femminile 5. Strategia di allevamento La R26-BL-IRES-τlacZ (BIZ) e R26-GFP-TTC (GTT) linee traccianti sono knock-in ceppi 5 che portano alleli ROSA26 ricombinanti. La R26-BIZ e gli alleli R26-GTT sono trascrizionalmente silente a causa della presenza di un forte segnale di arresto della trascrizione, che è affiancato da due siti loxP 5. Espressione del transgene BIZ e GTT è attivato dalla rimozione Cre-mediata del segnale di arresto trascrizionale. Gli alleli R26-BIZ e R26-GTT possono essere utilizzati indipendentemente attraversando semplicemente con una linea pilota Cre. Per gli animali di analisi eterozigoti per i rispettivi alleli Cre e R26 può essere utilizzato. Nidiata che trasportano una Cre o un allele R26, rispettivamente, dovrebbero essere utilizzati come controlli. In alternativa, è anche possibile generare tRiple knock-in animali portatori degli alleli Cre, R26-BIZ e R26-GTT, tuttavia ciò richiederà una croce supplementare.

<table><tbody><tr><td>Bisbenzimide (Hoechst 33258 dye)</td><td>Sigma</td><td>14530-100MG</td><td></td></tr><tr><td>Ethanol</td><td>Sigma</td><td>32205-1L</td><td></td></tr><tr><td>Cryo mold (Peel-a-way)</td><td>Polyscience Inc.</td><td>18646A-1</td><td>22 x 22 x 20mm</td></tr><tr><td>DMSO</td><td>Sigma</td><td>D8418-100ML</td><td></td></tr><tr><td>Dimethyl Formamide (DMF)</td><td>VWR Chemicals</td><td>23470,293</td><td></td></tr><tr><td>EGTA</td><td>ROTH</td><td>3054.3</td><td></td></tr><tr><td>Fluoromount G</td><td>Southern Biotech</td><td>0100-01</td><td></td></tr><tr><td>Glutaraldehyde</td><td>Sigma</td><td>G5882-50ML</td><td></td></tr><tr><td>Hydrogen peroxide</td><td>Sigma</td><td>34988-7</td><td></td></tr><tr><td>Isopentane (Methyl 2-butane)</td><td>Sigma</td><td>M32631-2.5L</td><td></td></tr><tr><td>Kaiser&#039;s glycine gelatin</td><td>Merck</td><td>1092420100</td><td></td></tr><tr><td>Methanol</td><td>Sigma</td><td>494437-1L</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>M2670-100G</td><td></td></tr><tr><td>NaCl</td><td>ROTH</td><td>HN00.2</td><td></td></tr><tr><td>NBT</td><td>Sigma</td><td>298-83-9</td><td></td></tr><tr><td>Nonidet P40 substitute</td><td>Fluka</td><td>743.85</td><td></td></tr><tr><td>OCT</td><td>Leica</td><td>14020108926</td><td></td></tr><tr><td>PAP pen</td><td>Dako</td><td>S2002</td><td></td></tr><tr><td>Parafarmaldehyde</td><td>Sigma</td><td>P6148-1KG</td><td></td></tr><tr><td>Sodium deoxycholate</td><td>Sigma</td><td>D6750-25G</td><td></td></tr><tr><td>Sucrose</td><td>Sigma</td><td>S7903-1KG</td><td></td></tr><tr><td>Superfrost slides</td><td>Thermo Scientific</td><td>FT4981GLPLUS</td><td></td></tr><tr><td>TSA kit</td><td>PerkinElmer</td><td>NEL700</td><td></td></tr><tr><td>TSA plus kit</td><td>PerkinElmer</td><td>NEL749A001KT</td><td></td></tr><tr><td>Tris</td><td>ROTH</td><td>AE15.2</td><td></td></tr><tr><td>Triton-X 100</td><td>ROTH</td><td>3051.2</td><td></td></tr><tr><td>Tween 20</td><td>ROTH</td><td>9127.1</td><td></td></tr><tr><td>X-gal</td><td>ROTH</td><td>2315.1</td><td></td></tr><tr><td>Cryostat</td><td>Leica</td><td>na</td><td></td></tr><tr><td>Light microscope equipped with DIC imaging</td><td>Zeiss</td><td>Axioskop2 equipped with Axio Vision software</td><td></td></tr><tr><td>Fluroscence microscope</td><td>Zeiss</td><td>Axioskop2 equipped with Axio Vision software</td><td></td></tr><tr><td>Photoshop</td><td>Adobe</td><td>PS6</td><td></td></tr><tr><td>Goat anti-WGA (recognizes BL)</td><td>Vector Laboatories</td><td>AS-2024</td><td></td></tr><tr><td>Biotinylayted horse anti-goat IgG</td><td>Vector Laboatories</td><td>BA-9500</td><td></td></tr><tr><td>Biotinylated goat anti-rabbit IgG</td><td>Vector Laboatories</td><td>BA-1000</td><td></td></tr><tr><td>Rabbit anti-GFP (recognizes GTT)</td><td>Invitrogen</td><td>A11122</td><td></td></tr><tr><td>Rabbit anti-GnRH</td><td>Affinity Bio Reagent</td><td>PA1-121</td><td></td></tr><tr><td>Dylight488-donkey anti-rabbit IgG</td><td>Thermo Scientific</td><td>SA5-10038</td><td></td></tr><tr><td>SA-Alexa Fluor 546</td><td>Life Technologies</td><td>S-11225</td><td></td></tr><tr><td colspan="4">Primers</td></tr><tr><td>BL Fwd (for BIZ genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>ATGAAGATGATGAGCACCAGGGC</td></tr><tr><td>BL Rev (for BIZ genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>AGCCCTCGCCGCAGAACTC</td></tr><tr><td>Cre Fwd (for Cre genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>GTCGATGCAACGAGTGATGAGGTTCG</td></tr><tr><td>Cre Rev (for Cre genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>CCAGGCTAAGTGCCTTCTCTACACCTGC</td></tr><tr><td>TTC Fwd (for GTT genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>AGCAAGGGCGAGGAGCTGTT</td></tr><tr><td>TTC Rev (for GTT genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>GTCTTGTAGTTGCCGTCGTCCTTGAA</td></tr><tr><td>XY Fwd (for gender genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>TGAAGCTTTTGGCTTTGA</td></tr><tr><td>XY Rev (for gender genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>CCGCTGCCAAATTCTTTG</td></tr><tr><td>ROSA26 Fwd</td><td>Eurofins MWG Operon</td><td></td><td>CGAAGTCGCTCTGAGTTGTTATC</td></tr><tr><td>ROSA26 Rev</td><td>Eurofins MWG Operon</td><td></td><td>GCAGATGGAGCGGGAGAAAT</td></tr><tr><td>SA Rev</td><td>Eurofins MWG Operon</td><td></td><td>CGAAGTCGCTCTGAGTTGTTATC</td></tr></tbody></table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

Questa sezione mostra i risultati rappresentativi che possono essere ottenuti lavorando con la R26-BIZ (B L- I RES-τlac Z) e la R26-GTT (G FP TT C) alleli. Qui usiamo la R26-BIZ e gli alleli R26-GTT per analizzare la maturazione dei circuiti neurali che regolano l&#39;asse riproduttivo. La riproduzione in vertebrati è controllata centralmente da un piccolo sottogruppo di neuroni dell&#39;ipotalamo, che secernono l&#39;ormone di rilascio delle gonadotropin...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

Condizionale genetica Transsynaptic Tracing nel cervello embrionali di topo

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.6K Views.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

Video: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Mouse in Utero Electroporation: Controlled Spatiotemporal Gene Transfection

In order to understand the function of genes expressed in specific region of the developing brain, including signaling molecules and axon guidance molecules, local gene transfer or knock- out is required. Gene targeting knock-in or knock-out into local regions is possible to perform with combination with a specific CRE line, which is laborious, costly, and time consuming. Therefore, a simple transfection method, an in utero electroporation technique, which can be performed with short time, will be handy to test the possible function of candidate genes prior to the generation of transgenic animals 1,2. In addition to this, in utero electroporation targets areas of the brain where no specific CRE line exists, and will limit embryonic lethality 3,4. Here, we present a method of in utero electroporation combining two different types of electrodes for simple and convenient gene transfer into target areas of the developing brain. First, a unique holding method of embryos using an optic fiber optic light cable will make small embryos (from E9.5) visible for targeted DNA solution injection into ventricles and needle type electrodes insertion to the targeted brain area 5,6. The patterning of the brain such as cortical area occur at early embryonic stage, therefore, these early electroporation from E9.5 make a big contribution to understand entire area patterning event. Second, the precise shape of a capillary prevents uterine damage by making holes by insertion of the capillary. Furthermore, the precise shape of the needle electrodes are created with tungsten and platinum wire and sharpened using sand paper and insulated with nail polish 7, a method which is described in great detail in this protocol. This unique technique allows transfection of plasmid DNA into restricted areas of the brain and will enable small embryos to be electroporated. This will help to, open a new window for many scientists who are working on cell differentiation, cell migration, axon guidance in very early embryonic stage. Moreover, this technique will allow scientists to transfect plasmid DNA into deep parts of the developing brain such as thalamus and hypothalamus, where not many region-specific CRE lines exist for gain of function (GOF) or loss of function (LOF) analyses.

Mouse in Utero Electroporation: Controlled Spatiotemporal Gene Transfection

A gene transfer method into the developing mouse brain is described by using a unique surgical method and special shape of electrodes. This unique technique allows transfection of plasmid DNA temporally and spatially, which will aid many neuroscientists in studying brain development.

Mouse in Utero elettroporazione: controllato Transefection Gene spazio-temporale

In order to understand the function of genes expressed in specific region of the developing brain, including signaling molecules and axon guidance ...

Ricerca

Neuroscienze

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date this tool has been widely used to study the regulation of cellular proliferation, differentiation and neuronal migration especially in the developing cerebral cortex 6-8. Here we detail our protocol to electroporate in utero the cerebral cortex and the hippocampus and provide evidence that this approach can be used to study dendrites and spines in these two cerebral regions.
Visualization and manipulation of neurons in primary cultures have contributed to a better understanding of the processes involved in dendrite, spine and synapse development. However neurons growing in vitro are not exposed to all the physiological cues that can affect dendrite and/or spine formation and maintenance during normal development. Our knowledge of dendrite and spine structures in vivo in wild-type or mutant mice comes mostly from observations using the Golgi-Cox method 9. However, Golgi staining is considered to be unpredictable. Indeed, groups of nerve cells and fiber tracts are labeled randomly, with particular areas often appearing completely stained while adjacent areas are devoid of staining. Recent studies have shown that IUE of fluorescent constructs represents an attractive alternative method to study dendrites, spines as well as synapses in mutant / wild-type mice 10-11 (Figure 1A). Moreover in comparison to the generation of mouse knockouts, IUE represents a rapid approach to perform gain and loss of function studies in specific population of cells during a specific time window. In addition, IUE has been successfully used with inducible gene expression or inducible RNAi approaches to refine the temporal control over the expression of a gene or shRNA 12. These advantages of IUE have thus opened new dimensions to study the effect of gene expression/suppression on dendrites and spines not only in specific cerebral structures (Figure 1B) but also at a specific time point of development (Figure 1C).
Finally, IUE provides a useful tool to identify functional interactions between genes involved in dendrite, spine and/or synapse development. Indeed, in contrast to other gene transfer methods such as virus, it is straightforward to combine multiple RNAi or transgenes in the same population of cells. 
In summary, IUE is a powerful method that has already contributed to the characterization of molecular mechanisms underlying brain function and disease and it should also be useful in the study of dendrites and spines.

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

This article describes in detail a protocol to electroporate in utero the cerebral cortex and the hippocampus at E14.5 in mice. We also show that this is a valuable method to study dendrites and spines in these two cerebral regions.

Visualizzazione e manipolazione genetica di dendriti e spine nella corteccia cerebrale e nell&#39;ippocampo mouse utilizzando<em&gt; In utero</em&gt; Elettroporazione

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date ...

Viral Tracing of Genetically Defined Neural Circuitry

Classical methods for studying neuronal circuits are fairly low throughput. Transsynaptic viruses, particularly the pseudorabies (PRV) and rabies virus (RABV), and more recently vesicular stomatitis virus (VSV), for studying circuitry, is becoming increasingly popular. These higher throughput methods use viruses that transmit between neurons in either the anterograde or retrograde direction.
Recently, a modified RABV for monosynaptic retrograde tracing was developed. (Figure 1A). In this method, the glycoprotein (G) gene is deleted from the viral genome, and resupplied only in targeted neurons. Infection specificity is achieved by substituting a chimeric G, composed of the extracellular domain of the ASLV-A glycoprotein and the cytoplasmic domain of the RABV-G (A/RG), for the normal RABV-G1. This chimeric G specifically infects cells expressing the TVA receptor1. The gene encoding TVA can been delivered by various methods2-8. Following RABV-G infection of a TVA-expressing neuron, the RABV can transmit to other, synaptically connected neurons in a retrograde direction by nature of its own G which was co-delivered with the TVA receptor. This technique labels a relatively large number of inputs (5-10%)2 onto a defined cell type, providing a sampling of all of the inputs onto a defined starter cell type.
We recently modified this technique to use VSV as a transsynaptic tracer9. VSV has several advantages, including the rapidity of gene expression. Here we detail a new viral tracing system using VSV useful for probing microcircuitry with increased resolution. While the original published strategies by Wickersham et al.4 and Beier et al.9 permit labeling of any neurons that project onto initially-infected TVA-expressing-cells, here VSV was engineered to transmit only to TVA-expressing cells (Figure 1B). The virus is first pseudotyped with RABV-G to permit infection of neurons downstream of TVA-expressing neurons. After infecting this first population of cells, the virus released can only infect TVA-expressing cells. Because the transsynaptic viral spread is limited to TVA-expressing cells, presence of absence of connectivity from defined cell types can be explored with high resolution. An experimental flow chart of these experiments is shown in Figure 2. Here we show a model circuit, that of direction-selectivity in the mouse retina. We examine the connectivity of starburst amacrine cells (SACs) to retinal ganglion cells (RGCs).

A method of tracing synaptically connected neurons is described. We use TVA specificity of an upstream cell to probe whether a cell population of interest receives synaptic input from genetically defined cell types.

Viral Tracciamento di geneticamente definito circuiti neurali

Classical methods for studying neuronal circuits are fairly low throughput. Transsynaptic viruses, particularly the pseudorabies (PRV) and rabies virus ...

Electroporation of the Hindbrain to Trace Axonal Trajectories and Synaptic Targets in the Chick Embryo

Electroporation of the chick embryonic neural tube has many advantages such as being quick and efficient for the expression of foreign genes into neuronal cells. In this manuscript we provide a method that demonstrates uniquely how to electroporate DNA into the avian hindbrain at E2.75 in order to specifically label a subset of neuronal progenitors, and how to follow their axonal projections and synaptic targets at much advanced stages of development, up to E14.5. We have utilized novel genetic tools including specific enhancer elements, Cre/Lox - based plasmids and the PiggyBac-mediated DNA transposition system to drive GFP expression in a subtype of hindbrain cells (the dorsal most subgroup of interneurons, dA1). Axonal trajectories and targets of dA1 axons are followed at early and late embryonic stages at various brainstem regions. This strategy contributes advanced techniques for targeting cells of interest in the embryonic hindbrain and for tracing circuit formation at multiple stages of development.

How neuronal networks are established in the embryonic brain is a fundamental question in developmental neurobiology. Here we combined an electroporation technique with novel genetic tools, such as Cre/Lox&#x2013;plasmids and PiggyBac-mediated DNA transposition system in the avian hindbrain to label dorsal interneurons and track their axonal projections and synaptic targets at various developmental stages.

Elettroporazione del romboencefalo tracciare traiettorie assonale e Obiettivi Synaptic in embrione di pollo

Electroporation of  the chick embryonic neural tube has many advantages such as being quick and efficient  for the expression of foreign genes into ...

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Genetic modification of specific regions of the developing mammalian brain is a very powerful experimental approach. However, generating novel mouse mutants is often frustratingly slow. It has been shown that access to the mouse brain developing in utero with reasonable post-operatory survival is possible. Still, results with this procedure have been reported almost exclusively for the most superficial and easily accessible part of the developing brain, i.e. the cortex. The thalamus, a narrower and more medial region, has proven more difficult to target. Transfection into deeper nuclei, especially those of the hypothalamus, is perhaps the most challenging and therefore very few results have been reported. Here we demonstrate a procedure to target the entire hypothalamic neuroepithelium or part of it (hypothalamic regions) for transfection through electroporation. The keys to our approach are longer narcosis times, injection in the third ventricle, and appropriate kind and positioning of the electrodes. Additionally, we show results of targeting and subsequent histological analysis of the most recessed hypothalamic nucleus, the mammillary body.

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Despite the functional and medical importance of the hypothalamus, in utero genetic manipulation of its development has rarely been attempted. We show a detailed procedure for in utero electroporation into the mouse hypothalamus and show representative results of total and partial (regional) hypothalamic transfection.

La manipolazione genetica del topo sviluppo dell&#39;ipotalamo attraverso<em&gt; In utero</em&gt; Elettroporazione

Genetic  modification of specific regions of the developing mammalian brain is a very  powerful experimental approach. However, generating novel mouse ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

Immagini dal vivo della mitosi in via di sviluppo embrionali di topo Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the ...

Two-Photon in vivo Imaging of Dendritic Spines in the Mouse Cortex Using a Thinned-skull Preparation

In the mammalian cortex, neurons form extremely complicated networks and exchange information at synapses. Changes in synaptic strength, as well as addition/removal of synapses, occur in an experience-dependent manner, providing the structural foundation of neuronal plasticity. As postsynaptic components of the most excitatory synapses in the cortex, dendritic spines are considered to be a good proxy of synapses. Taking advantages of mouse genetics and fluorescent labeling techniques, individual neurons and their synaptic structures can be labeled in the intact brain. Here we introduce a transcranial imaging protocol using two-photon laser scanning microscopy to follow fluorescently labeled postsynaptic dendritic spines over time in vivo. This protocol utilizes a thinned-skull preparation, which keeps the skull intact and avoids inflammatory effects caused by exposure of the meninges and the cortex. Therefore, images can be acquired immediately after surgery is performed. The experimental procedure can be performed repetitively over various time intervals ranging from hours to years. The application of this preparation can also be expanded to investigate different cortical regions and layers, as well as other cell types, under physiological and pathological conditions.

Two-Photon in vivo Imaging of Dendritic Spines in the Mouse Cortex Using a Thinned-skull Preparation

Time-lapse imaging in the living animal provides valuable information on structural reorganization in the intact brain. Here, we introduce a thinned-skull preparation that allows transcranial imaging of fluorescently labeled synaptic structures in the living mouse cortex by two-photon microscopy.

Two-Photon<em&gt; In vivo</em&gt; Imaging di spine dendritiche nella corteccia mouse Uso un teschio Diluito-Preparazione

In the mammalian cortex, neurons form extremely complicated networks and exchange information at synapses. Changes in synaptic strength, as well as ...

Laser-guided Neuronal Tracing In Brain Explants

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake through electroporation in brain explants with targeted laser illumination and matching filter goggles during the procedure. The described technique of in vitro electroporation by itself yields relatively good visual control for targetting certain areas of the brain. By combining it with laser excitation of fluorescent genetic markers and their read-out through band-passing filter goggles, which can pick up the emissions of the genetically labeled cells/nuclei and the fluorescent tracing dye, a researcher can substantially increase the accuracy of injections by finding the area of interest and controlling for the dye-spread/uptake in the injection area much more efficiently. In addition, the laser illumination technique allows to study the functionality of a given neurocircuit by providing information about the type of neurons projecting to a certain area in cases where the GFP expression is linked to the type of transmitter expressed by a subpopulation of neurons.

We describe a technique to label neurons and their processes via anterograde or retrograde tracer injections into brain nuclei using an in vitro preparation. We modified an existing method of in vitro tracer electroporation by taking advantage of fluorescently labeled mouse mutants and basic optical equipment in order to increase labeling accuracy.

Neuronal Tracing negli espianti cerebrali a guida laser

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake ...

Time-lapse Confocal Imaging of Migrating Neurons in Organotypic Slice Culture of Embryonic Mouse Brain Using In Utero Electroporation

In utero electroporation is a rapid and powerful approach to study the process of radial migration in the cerebral cortex of developing mouse embryos. It has helped to describe the different steps of radial migration and characterize the molecular mechanisms controlling this process. To directly and dynamically analyze migrating neurons they have to be traced over time. This protocol describes a workflow that combines in utero electroporation with organotypic slice culture and time-lapse confocal imaging, which allows for a direct examination and dynamic analysis of radially migrating cortical neurons. Furthermore, detailed characterization of migrating neurons, such as migration speed, speed profiles, as well as radial orientation changes, is possible. The method can easily be adapted to perform functional analyses of genes of interest in radially migrating cortical neurons by loss and gain of function as well as rescue experiments. Time-lapse imaging of migrating neurons is a state-of-the-art technique that once established is a potent tool to study the development of the cerebral cortex in mouse models of neuronal migration disorders.

Time-lapse Confocal Imaging of Migrating Neurons in Organotypic Slice Culture of Embryonic Mouse Brain Using In Utero Electroporation

This protocol provides instructions for direct observation of radially migrating cortical neurons. In utero electroporation, organotypic slice culture, and time-lapse confocal imaging are combined to directly and dynamically study the effects of overexpression or downregulation of genes of interest in migrating neurons and to analyze their differentiation during development.

Impressione confocale dei migratori dei neuroni nella cultura di fetta organotipica del cervello embrionale del mouse usando<em&gt; In Utero</em&gt; Elettroporazione

In utero electroporation is a rapid and powerful approach to study the process of radial migration in the cerebral cortex of developing mouse embryos. It ...

Stereotaxic Surgical Approach to Microinject the Caudal Brainstem and Upper Cervical Spinal Cord via the Cisterna Magna in Mice

Stereotaxic surgery to target brain sites in mice is commonly guided by skull landmarks. Access is then obtained via burr holes drilled through the skull. This standard approach can be challenging for targets in the caudal brainstem and upper cervical cord due to specific anatomical challenges as these sites are remote from skull landmarks, leading to imprecision. Here we outline an alternative stereotaxic approach via the cisterna magna that has been used to target discrete regions of interest in the caudal brainstem and upper cervical cord. The cisterna magna extends from the occipital bone to the atlas (i.e., the second vertebral bone), is filled with cerebrospinal fluid, and is covered by dura mater. This approach provides a reproducible route of access to select central nervous system (CNS) structures that are otherwise hard to reach due to anatomical barriers. Furthermore, it allows for direct visualization of brainstem landmarks in close proximity to the target sites, increasing accuracy when delivering small injection volumes to restricted regions of interest in the caudal brainstem and upper cervical cord. Finally, this approach provides an opportunity to avoid the cerebellum, which can be important for motor and sensorimotor studies.

Stereotaxic Surgical Approach to Microinject the Caudal Brainstem and Upper Cervical Spinal Cord via the Cisterna Magna in Mice

Stereotaxic surgery to target brain sites in mice commonly involves access through the skull bones and is guided by skull landmarks. Here we outline an alternative stereotaxic approach to target the caudal brainstem and upper cervical spinal cord via the cisterna magna that relies on direct visualization of brainstem landmarks.

Approccio chirurgico stereotassico per microiniettare il tronco encefalico caudale e il midollo spinale cervicale superiore tramite la Cisterna Magna nei topi

Stereotaxic surgery to target brain sites in mice is commonly guided by skull landmarks. Access is then obtained via burr holes drilled through the skull. ...

Condizionale genetica Transsynaptic Tracing nel cervello embrionali di topo

Riepilogo

Esplora Altri Video

Capitoli in questo video

Mouse in Utero elettroporazione: controllato Transefection Gene spazio-temporale

Visualizzazione e manipolazione genetica di dendriti e spine nella corteccia cerebrale e nell'ippocampo mouse utilizzando

Viral Tracciamento di geneticamente definito circuiti neurali

Elettroporazione del romboencefalo tracciare traiettorie assonale e Obiettivi Synaptic in embrione di pollo

La manipolazione genetica del topo sviluppo dell'ipotalamo attraverso

Immagini dal vivo della mitosi in via di sviluppo embrionali di topo Cortex

Two-Photon

Neuronal Tracing negli espianti cerebrali a guida laser

Impressione confocale dei migratori dei neuroni nella cultura di fetta organotipica del cervello embrionale del mouse usando

Approccio chirurgico stereotassico per microiniettare il tronco encefalico caudale e il midollo spinale cervicale superiore tramite la Cisterna Magna nei topi