We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

NOT: Etik Açıklama: hayvan denekleri Prosedürleri Hamburg Üniversitesi ve Saarland Üniversitesi hayvan koruma kurulu tarafından onaylanmıştır. 1. Hazırlık ve Embriyonik Doku Fixation <ol><li> Embriyoların teşrih ve hayvanlar kurban edilmeden önce doku sonraki tespiti için çözümler hazırlamak için gerekli tüm ekipman düzenleyin. NOT: Her zaman (7.4 pH değerinin, 0.1 M fosfat tamponlu salin (PBS) içinde% 4 PFA), taze% 4 paraformaldehit (PFA) solüsyon hazırlanır. </li><li> Bir etik onaylı prosedüre zamanlı hamile kadın fare Euthanize. </li><li> Bir platform üzerine fare aktarın. % 70 etanol ile karın ventral tarafı ıslatın ve karın boşluğuna maruz keskin bir makas kullanarak dikey bir kesi yapmak. </li><li> Embriyonik zinciri tanımlamak ve dikkatle kullanarak künt forseps çekin ve buz gibi soğuk PBS içine yerleştirin. </li><li> Bireysel embriyolar çıkarınince makas ve forseps kullanarak embriyonik zinciri. Embriyoların etrafında ekstra doku çıkarın ve buz gibi soğuk PBS yıkayın. </li><li> (PFA içine embriyo transferinden önce) küçük bir kuyruk biyopsisi alın ve cinsiyet tanımlama ve izleyici alel genotiplemesi PCR için kuyruk lizis tamponu içinde kuluçkaya yatmaktadır. </li><li> En dıştaki tarafında embriyodan başlayın ve bir çalkalayıcı üzerinde buz üzerinde buz soğukluğunda% 4 PFA içeren bir tüp içine ayrı ayrı embriyo transferi. </li><li> Sabit sallayarak E13.5 yaş veya buz üzerinde 1.5 saat genç embriyolar bekletin. Sabit sallayarak buz üzerinde 2.5 saat yaş E14.5 ve E15.5 embriyolar bekletin. </li><li> Embriyolar yaş E16.5 veya yaşlı için, başını kesmek ve PFA çözeltisi içinde kafa iliklerine önce dış deri kaldırmak. E16.5 embriyo Başlıkları sürekli çalkalanarak buz üzerinde 4.5 saat süreyle batırılmış olabilir. </li><li> Uygun tespit edildikten sonra, buz gibi soğuk PBS ile embriyolar üç kez yıkayın. Batarlarsa kadar 4 ° C de PBS çözeltisi içinde% 30 sakroz içine embriyo transferinealt. </li></ol> 2. Donma <ol><li> Dondurma işlemine başlamadan önce gerekli tüm malzemeleri düzenleyin: cryo-kalıp, cryo-eldivenler, tüy entomolojisi forseps, işaretleyici kalem ve optimal kesim sıcaklığının bileşik (Ekim) </li><li> Kalıcı alkole dirençli işaretleyici ile cryo-kalıp Etiket (doku, tarih ve genotip yönünü söz). Bir buz kovası ezilmiş kuru buz ve% 100 etanol içinde bir çamuru hazırlanır. Izopentanın içeren iç cam beher yerleştirin. İzopentan soğuması için 10 dakika bekleyin. </li><li> Bu arada, sukroz çözeltisi doku kaldırmak laboratuvar mendil kullanarak doku çevresinde aşırı sukroz silin. Doku karşılamak için yeterli Ekim ile önceden etiketlenmiş cryo-kalıba doku aktarın. Ekim herhangi bir hava kabarcıkları kaçının; Özellikle doku etrafında. </li><li> Doku hasarı önlemek için tüy entomoloji forseps kullanarak Ekim doku yönlendirin. Cryo-mol aktararak dondurma başlayınönceden soğutulmuş izopentan banyosuna ö. Düzgün donma olmaz gibi OCT içine izopentanın sıçrama yok. -80 ° C de, alüminyum folyo ve mağaza örnekleri sarın. </li></ol> 3. Cryosectioning <ol><li> Bir sirostat kullanılarak beş serisi &#39;14 mikron ince seri bölümleri kesin ve immünofloresan (IF) analizi için Superfrost® Plus cam slaytlar üzerinde toplamak. Kullanılan kadar -80 ° C &#39;de slaytlar saklayın. </li></ol> Tyramide Sinyal Amplifikasyon (TSA) Protokolü kullanma 4. Tracer görselleştirme <ol><li> Boyama için gerekli olan tamponlar ve reaktifler hazırlayın. Her zaman taze kullanım gününde Tris-NaCI-Tween (TNT) tamponu hazırlayın. <ol><li> 1 L&#39;lik bir son hacme kadar 1 ml pipet kullanarak Tween 20 500 ul ekle, 1 M Tris-HCl, pH 7.5, 5 mM NaCl, 30 ml ve GKD 2 O 100 ml ile TNT tamponu hazırlayın. Yavaş yavaş Tween 20 ekleyin ve tüm Tween 20 olmasını sağlamak için yukarı ve aşağı birkaç kez pipet floşÇözelti. </li><li> Tris-NaCI-Blokaj kadar 1 L&#39;lik bir son hacme pH 7.5, 5 mM NaCl, 30 ml ve GKD 2 O, 1 M Tris-HCl, 100 ml kullanılarak (TNB), tampon Engelleme Reaktif 5 g ekleyin hazırlanması ile (Resim yavaş yavaş tampon küçük artışlarla kiti) karıştırılırken. (Bu, 30-60 dakika daha uzun zaman almak gerekir) tamamen bloke edici tepkin madde çözünmesi için sürekli karıştırılarak 55 ° C&#39;ye yavaş yavaş solüsyon ısıtın. Homojen ısıtma 55 ° C&#39;de su banyosu kullanın ulaşmak için. çözüm sütlü görünecektir. Kullanmadan önce oda sıcaklığına getirin çözüm. Uzun süreli depolama için -20 ° C&#39;de kısım saklayın. </li><li> Moleküler Biyolojisi / HPLC-grade DMSO (takımla birlikte verilmektedir), biyotin tiramid reaktifi sulandırın. Bunun üzerine bağlı olarak kit, DMSO uygun miktarı değişebilir kullanılır. 4 ° C &#39;de stok solüsyonu saklayın. NOT: İlgili Cre ve R26 allelleri için heterozigot hayvanlardan Bölümler devre analizi için kullanılabilir. Kullanım sveriliş negatif kontrol olarak sırasıyla bir Cre veya bir R26 alel, taşıma littermates. Tam çift heterozigot hayvanlardan slaytlar gibi negatif kontrol slaytlar davranın. Buna ek olarak, bir çift heterozigot hayvandan bir kontrol slayt bunlarla TSA ayıracı (Yükseltilmemiş kontrol) dışarıda bırakın. </li></ol></li><li> Keskin bir neşter taze doku bölümleri çevreleyen aşırı Ekim kaldırmak ve bir PAP kalemle bölümler etrafında sınır işareti kullanma. </li><li> Oda sıcaklığında 2-3 dakika boyunca (RT) slaytlar kurutun. 5 dakika her TNT RT 3x slaytlar yıkayın. Endojen peroksidaz aktivitesi söndürmek için% 0.3 30 dakika boyunca buz soğukluğunda metanol içinde H2O 2 solüsyonu oda sıcaklığında slaytlar inkübe edin. </li><li> 5 dakika boyunca PBS ile yıkayın 3x oda sıcaklığında her biri. Doku geçirgenliği için PBS içinde% 0.5 Triton-X 100, 10 dakika boyunca inkübe edin. 5 dakika her TNT RT 3x slaytlar yıkayın. </li><li> TNB ile Blok 30 için (slayt başına 200-300 ul engelleme çözümü)nemli bir oda içinde oda sıcaklığında Min. Tüm bölümleri tamamen TNB tarafından karşılanmaktadır emin olun. Slaytlar adımlar arasında kurumasına izin vermeyin. </li><li> Fazla engelleme tamponu süzün ve izleyici kabul primer antiserumun uygulamak oda sıcaklığında ya da gece boyunca 4 ° C &#39;de 2 saat TNB içinde seyreltildi (1: GTT 15.000 tavşan anti-GFP: BL 1000 keçi anti-WGA, 1). Tamamen doku bölümü (slayt başına 200-300 ul) karşılamak için yeterli hacim kullandığınızdan emin olun. NOT: Burada önerilen primer antiserumlar dilüsyonları ayarlanması gerekebilir. </li><li> 5 dakika ajitasyon ile her TNT RT 3x slaytlar yıkayın. </li><li> (: Anti-WGA 500 at anti-keçi IgG&#39;si, 1: oda sıcaklığında 1 saat TNB içinde, anti-GFP için 5000 keçi anti-tavşan IgG 1), ilk antiserum ana tanıyan biyotinlenmiş sekonder antiserumu ile bölümleri inkübe edin. </li><li> 5 dakika çalkalanarak her biri için oda sıcaklığında, TNT ile yıkayın 3x. 100 streptavidin (SA) ile birleştirilmiş bayır yaban turpu peroksidaz (SA-HRP, Resim wi: 1 inkübenemli bir oda içinde oda sıcaklığında 30 dakika için TNB içinde kiti) th. 5 dakika her TNT RT 3x slaytlar yıkayın. Bu arada TSA eritin. </li><li> (Kit ile sağlanan, BL görselleştirme ve GTT için TSA + kiti için TSA kiti kullanın) TSA amplifikasyon seyreltici içinde TSA 01:50 seyreltin. Oda sıcaklığında tam olarak 10 dakika için seyreltilmiş TSA doku bölümleri inkübe edin. Gelecek deneyler için kalan seyreltilmiş TSA reaktifi kullanmayın, ideal bir önceki yıkama aşamasında, kullanımdan hemen önce TSA Seyreltik; her zaman taze hazırlayın. </li><li> 5 dakika ajitasyon ile her TNT RT 3x slaytlar yıkayın. Oda sıcaklığında 30 dakika için TNB içinde 500 Alexa Fluor® 546 streptavidin: 1 ile inkübe edin. 5 dakika ajitasyon ile her TNT RT 3x slaytlar yıkayın. </li><li> Nükleer boyama için oda sıcaklığında PBS içinde% 5 bisbenzimid çözelti içinde 10 dakika süreyle inkübe edin. 5 dakika ajitasyon ile her TNT RT 3x slaytlar yıkayın. Fluromount G ile monte ve Epifloresans veya konfokal mikroskopi gerçekleştirin. <em&gt; Sorun giderme: Tracer transferi etkinliği (kullanılan Cre sürücü hattı ile belirlenir) üreten hücrelerde ROSA26 mahalinin ifade düzeyine bağlıdır ve nöral devre üzerinde (izleyici, yakınsama vb üreten nöronların sayısı örneğin) analiz edecektir. Bu nedenle burada önerilen primer antiserumlar dilüsyonları düşük ya da aşırı sinyal önlemek için ayarlanması gerekebilir. Arka plan her zaman uygun kontrol slaytlar (yukarıya bakınız) kullanılarak analiz edilmelidir. </li></ol> Embriyonik Bölüm 5. τlacZ Boyama <ol><li> Boyama için gerekli olan tamponlar ve reaktifler hazırlayın. Her zaman taze Kullanmadan önce LacZ tampon C hazırlamak. <ol><li> 1 mi% 70 dimetilformamit (DMF), X-gal 40 gramı ekleyerek, 5-bromo-4-kloro-3-indolil-β-D-galaktopiranosid (X-gal) stok çözeltisi (40 mg / ml) hazırlayın. Uzun süreli depolama için -20 ° C&#39;de alüminyum folyo ve mağaza ile kaplayın. </li><li> Hazırlayın nitro mavi tetrazolyum (NBT) st1 mi% 70 DMF NBT 50 gramı ekleyerek ock çözeltisi (50 mg / ml). Uzun süreli depolama için -20 ° C&#39;de alüminyum folyo ve mağaza ile kaplayın. </li><li> LacZ% 25 glutaraldehid 80 ul,% 4 5 ml PFA, 1 M 20 ul kullanılarak MgCI2, 500 mM EGTA, 100 ul bir son 1, 1 M fosfat tampon maddesi pH 7.4 içinde çözdürülür ve GKD 2 O kadar tespit maddesi hazırlanması 10 ml hacmi. </li><li> LacZ 500 mM EGTA, 5 ml, 500 ml&#39;lik bir nihai hacme kadar 50 mi ile kombine edilmiştir fosfat tamponu, pH 7.4 ve 1 M, 2, O, MgCl2 1 M A izlenerek ve 1 ml tampon hazırlayın. </li><li> 1 mi 1 M MgCI2, 500 mM EGTA, 5 ml, 5 mi% 1 sodyum deoksikolat,% 10 NP-40, 100 mi, 50 1 M fosfat tampon maddesi pH 7.4 içinde çözdürülür ve GKD 2 O kullanılarak LacZ tampon B hazırlanması 500 ml&#39;lik bir nihai hacme kadar. </li><li> NBT stok çözeltisi 10 ul ve LacZ tampon B, 1 ml X-gal stok çözeltisi 12.5 ul kullanımdan hemen önce taze sağlayın ve alüminyum folyo ile kapak ekleyerek LacZ tampon C hazırlayın. </li></ol&gt; </li><li> (Bu arada, bir PAB kalem ile preparatların hazırlanması), en az 10-15 dakika boyunca oda sıcaklığında slaytlar kurutun. </li><li> LacZ ile bölüm kimyasal buhar-başlığın içinde, nemlendirilmiş bir odacıkta, oda sıcaklığında 2 dakika boyunca tespit maddesi düzeltildi. 3 kez PBS ile yıkayın, 2 mM MgCl2 ile desteklenmesiydi. </li><li> LacZ slaytlar oda sıcaklığında 10 dakika her biri için bir 3 kez yıkama tamponu LacZ tampon A ile slaytlar durulayın. 5 dakika her LacZ tampon B ile 2 kez yıkayın. Nemli bir oda içinde 6 saat veya gece boyunca 30-37 ° C&#39;de LacZ tampon C slaytlar inkübe edin. NOT: LacZ tampon C yeterli hacmi ekleyin; slaytlar inkübasyon sırasında kurumasına olmamalıdır. </li><li> Uygun bir inkübasyon süresinden sonra, PBS ile kayar, 2 mM MgCl2 ile desteklenmesiydi yıkayın. Kısaca GKD 2 O. ile bölümleri durulayın Mayer&#39;in glisin jelatin ile lamel. Bir diferansiyel girişim kontrast (DIC) görüntüleme set-up ile donatılmış bir ışık mikroskobu için uygundur. </li></ol> 6. Gender ve Tracer Genotipleme <ol><li> 1 M Tris-HCl, pH 8.5, 500 mM EGTA, 100 ul 1 ml&#39;si kullanılarak kuyruk liziz tamponu,% 10 SDS, 200 ul 5 M NaCl ve GKD 2 O 400 ul, 10 ml lik bir son hacim yapmak için. </li><li> Bir kuyruk biyopsi içeren her Eppendorf tüpüne kuyruk lizis tamponu 500 ul ekleyin. 100 mg / ml &#39;lik bir nihai konsantrasyona kadar proteinaz K ilave. 55 ° C&#39;de bir çalkalayıcı üzerinde gece boyunca inkübe edin. </li><li> Oda sıcaklığında 10 dakika için 17,000 x g&#39;de santrifüjleyin örnekleri. Yeni bir santrifüj tüpüne süpernatant aktarın. Yüzer izopropanol 500 ul ekle. Yukarı ve aşağı tüpler ters çevrilerek en az 5 dakika boyunca karıştırın. </li><li> Oda sıcaklığında 5 dakika boyunca 17,000 x g&#39;de santrifüj dönerler. Süpernatantı dökün. % 70 etanol içinde 200 ul ekle. En az 5 dakika boyunca çalkalanır. </li><li> 5 dakika için 17,000 x g&#39;de santrifüjleyin. Bir Pipetman (kapalı dökmek değil) ile süpernatantı. 15-30 dakika boyunca bir sıcak oda (37 ° C) pelet kurutun. </li><li> 100 ul süspanse peletgeniş çaplı süzülmüş ipuçlarını kullanarak düşük TE pH 8.0 ya da su. Uygun erimesi için gece boyunca ° C&#39;de 1 saat boyunca ve 37 ° C&#39;de 55 ° C olarak koyun. 4 ° C&#39;de saklayın. </li><li> PCR reaksiyonu (kuyruk DNA&#39;sının 1 ul, her bir primerden 2.5 ul DMSO, 10:00, 25 her dNTP uM ve 1 M betain ihtiva eden 50 ul reaksiyon karışımı) için DNA 1 ul kullanın. Genotipleme ve cinsiyet tespiti için PCR primerleri malzemeleri tabloda listelenmiştir. </li></ol>

<ol><li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals%5BTitle%5D)+AND+%22Brain.+Res.+Bull%22%5BJournal%5D)">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li>
<li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genetic+approaches+to+neural+circuits+in+the+mouse%5BTitle%5D)+AND+%22Annu.+Rev.+Neurosci%22%5BJournal%5D)">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li>
<li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+half+century+of+experimental+neuroanatomical+tracing%5BTitle%5D)+AND+%22J.+Chem.+Neuroanat%22%5BJournal%5D)">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li>
<li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li>
<li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero%5BTitle%5D)+AND+%22J.+Neurosci%22%5BJournal%5D)">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li>
<li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+genetic+approach+to+trace+neural+circuits%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.S.A%22%5BJournal%5D)">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li>
<li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.S.A%22%5BJournal%5D)">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li>
<li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.S.A%22%5BJournal%5D)">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li>
<li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+GPR54+gene+as+a+regulator+of+puberty%5BTitle%5D)+AND+%22N.+Engl.+J.+Med%22%5BJournal%5D)">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li>
<li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.S.A%22%5BJournal%5D)">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li>
<li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain%5BTitle%5D)+AND+%22Nat.+Genet%22%5BJournal%5D)">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li>
<li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67(2005).</li>
<li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene%5BTitle%5D)+AND+%22Int.+J.+Dev.+Neurosci%22%5BJournal%5D)">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li>
<li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ligand-activated+site-specific+recombination+in+mice%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.S.A%22%5BJournal%5D)">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li>
</ol>

No conflict of interest declared.

Genetik olarak tanımlanmış sinirsel nöral devreleri iz transgenler olarak transsinaptik izleyiciler ifade ajanları veya neurotopic virüs stereotaksik enjeksiyonu ile karşılaştırıldığında bir çok avantaja sahiptir. İlk olarak, izleyici, bir endojen protein olarak üretilir ve bu nedenle herhangi bir bağışıklık karşılığını ortaya etmez ve seçici bir sinir yolu yüksek ölçüde tekrarlanabilirliği farklı hayvanlarda analiz edilebilir. Bu bir non-invaziv bir yöntemdir, çünkü İkincisi, bu ...

Anatomik yol izleme beyin ve davranış arasındaki ilişkiyi deşifre 1 en sık kullanılan araçlardan biridir. Nöral devre izleme teknolojileri İlerleme farelerde 2 genetik tanımlanan nöron nüfus nöral devreleri takip yeteneği ile sinirbilimcileri ihsan etmiştir. Bu teknik gelişmelerin rağmen özellikle embriyonik olgunlaşma sırasında nöral devrelerin oluşumunu çözülmeye zor kalır. Bugüne kadar geliştirilen izleme yöntemlerinin çoğu transsinaptik izleyiciler stereotaksik enjeksiyonu ya da genetik olarak tadil edilmiş nörotropik virüsleri (Şekil 1) 2,3 dayalı olmasıdır. Bu teknikler bağlantı mekansal ve zamansal çözünürlük gibi gelişmekte olan beynin, enjeksiyon yerinde ve en impor enjeksiyon yerinde tekrarlanabilirliği, potansiyel inflamasyon içine teknik açıdan zor izleyici enjeksiyonlar gibi çeşitli içsel sınırlamalar elde ederkennörotrop virüslerin neden rı değerlendirilerek sitotoksisite bunların kullanımını sınırlamak 4. Alternatif bir yöntem, genetik olarak değiştirilmiş farelerde transgenler olarak transsinaptik izleyiciler bildirmektir. Son zamanlarda bu tekniği modifiye ve herhangi bir genetik tespit nöronal nüfusun 5 nöral devreleri eşleştirmek için bir ikili genetik transsinaptik izleme sistemi geliştirdik. Kre-aracılı sonra Bizim deneysel strateji çift yönlü izleyici arpa lektin (BL) da 6 ya da ROSA 26 lokusundan GFP (GTT) 7 kaynaşmış retrograd izleyici Tetanos Toksin parçası Cı sergileyen iki yeni knock-in fare suşlarının dayanmaktadır rekombinasyon. Burada seçici Kisspeptin üreten nöronlarda BL ve GTT, üreme eksen 8,9 olgunlaşmasını düzenleyen karıştığı bir neuropeptide ifade etmek, bu fare suşları kullanıldı. Biz bu teknik öpücük gelişimini ve olgunlaşmasını görselleştirmek için uygun olduğunu göstermekdişi fare beyninin 5 embriyonik gelişimi sırasında peptin sinir devresi. Yetiştirme stratejisi R26-BL-IRES-τlacZ (BIZ) ve R26-GFP-TTC (GTT) izleyici hatları knock-rekombinant ROSA26 alleller taşıyan suşlar 5 vardır. R26-dünyası ve R26-GTT aleller bağlı iki loxP sitelerinin 5 tarafından kuşatılır, güçlü transkripsiyon durdurma sinyali, varlığına bağlı olarak, transkripsiyonel olarak sessizdir. Dünyası ve GTT transgenin sentezlenmesi transkripsiyon durdurma sinyali kre-aracılı çıkarılması ile aktive edilir. R26-R26-BIZ ve GTT alleller sadece Cre sürücü hattı ile geçerek bağımsız olarak kullanılabilir. Ilgili Cre ve R26 aleller için analiz hayvanlar heterozigoz için kullanılabilir. Bir Cre ya da bir R26, aleli taşıyan yavrular, sırasıyla, kontrol olarak kullanılır. Seçenek olarak ise, bu t oluşturmak da mümkündürknock-Riple Kre, R26-R26-BIZ ve GTT alleller taşıyan hayvanlar, ancak bu bir ek haçı gerektirir.

<table><tbody><tr><td>Bisbenzimide (Hoechst 33258 dye)</td><td>Sigma</td><td>14530-100MG</td><td></td></tr><tr><td>Ethanol</td><td>Sigma</td><td>32205-1L</td><td></td></tr><tr><td>Cryo mold (Peel-a-way)</td><td>Polyscience Inc.</td><td>18646A-1</td><td>22 x 22 x 20mm</td></tr><tr><td>DMSO</td><td>Sigma</td><td>D8418-100ML</td><td></td></tr><tr><td>Dimethyl Formamide (DMF)</td><td>VWR Chemicals</td><td>23470,293</td><td></td></tr><tr><td>EGTA</td><td>ROTH</td><td>3054.3</td><td></td></tr><tr><td>Fluoromount G</td><td>Southern Biotech</td><td>0100-01</td><td></td></tr><tr><td>Glutaraldehyde</td><td>Sigma</td><td>G5882-50ML</td><td></td></tr><tr><td>Hydrogen peroxide</td><td>Sigma</td><td>34988-7</td><td></td></tr><tr><td>Isopentane (Methyl 2-butane)</td><td>Sigma</td><td>M32631-2.5L</td><td></td></tr><tr><td>Kaiser&#039;s glycine gelatin</td><td>Merck</td><td>1092420100</td><td></td></tr><tr><td>Methanol</td><td>Sigma</td><td>494437-1L</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>M2670-100G</td><td></td></tr><tr><td>NaCl</td><td>ROTH</td><td>HN00.2</td><td></td></tr><tr><td>NBT</td><td>Sigma</td><td>298-83-9</td><td></td></tr><tr><td>Nonidet P40 substitute</td><td>Fluka</td><td>743.85</td><td></td></tr><tr><td>OCT</td><td>Leica</td><td>14020108926</td><td></td></tr><tr><td>PAP pen</td><td>Dako</td><td>S2002</td><td></td></tr><tr><td>Parafarmaldehyde</td><td>Sigma</td><td>P6148-1KG</td><td></td></tr><tr><td>Sodium deoxycholate</td><td>Sigma</td><td>D6750-25G</td><td></td></tr><tr><td>Sucrose</td><td>Sigma</td><td>S7903-1KG</td><td></td></tr><tr><td>Superfrost slides</td><td>Thermo Scientific</td><td>FT4981GLPLUS</td><td></td></tr><tr><td>TSA kit</td><td>PerkinElmer</td><td>NEL700</td><td></td></tr><tr><td>TSA plus kit</td><td>PerkinElmer</td><td>NEL749A001KT</td><td></td></tr><tr><td>Tris</td><td>ROTH</td><td>AE15.2</td><td></td></tr><tr><td>Triton-X 100</td><td>ROTH</td><td>3051.2</td><td></td></tr><tr><td>Tween 20</td><td>ROTH</td><td>9127.1</td><td></td></tr><tr><td>X-gal</td><td>ROTH</td><td>2315.1</td><td></td></tr><tr><td>Cryostat</td><td>Leica</td><td>na</td><td></td></tr><tr><td>Light microscope equipped with DIC imaging</td><td>Zeiss</td><td>Axioskop2 equipped with Axio Vision software</td><td></td></tr><tr><td>Fluroscence microscope</td><td>Zeiss</td><td>Axioskop2 equipped with Axio Vision software</td><td></td></tr><tr><td>Photoshop</td><td>Adobe</td><td>PS6</td><td></td></tr><tr><td>Goat anti-WGA (recognizes BL)</td><td>Vector Laboatories</td><td>AS-2024</td><td></td></tr><tr><td>Biotinylayted horse anti-goat IgG</td><td>Vector Laboatories</td><td>BA-9500</td><td></td></tr><tr><td>Biotinylated goat anti-rabbit IgG</td><td>Vector Laboatories</td><td>BA-1000</td><td></td></tr><tr><td>Rabbit anti-GFP (recognizes GTT)</td><td>Invitrogen</td><td>A11122</td><td></td></tr><tr><td>Rabbit anti-GnRH</td><td>Affinity Bio Reagent</td><td>PA1-121</td><td></td></tr><tr><td>Dylight488-donkey anti-rabbit IgG</td><td>Thermo Scientific</td><td>SA5-10038</td><td></td></tr><tr><td>SA-Alexa Fluor 546</td><td>Life Technologies</td><td>S-11225</td><td></td></tr><tr><td colspan="4">Primers</td></tr><tr><td>BL Fwd (for BIZ genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>ATGAAGATGATGAGCACCAGGGC</td></tr><tr><td>BL Rev (for BIZ genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>AGCCCTCGCCGCAGAACTC</td></tr><tr><td>Cre Fwd (for Cre genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>GTCGATGCAACGAGTGATGAGGTTCG</td></tr><tr><td>Cre Rev (for Cre genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>CCAGGCTAAGTGCCTTCTCTACACCTGC</td></tr><tr><td>TTC Fwd (for GTT genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>AGCAAGGGCGAGGAGCTGTT</td></tr><tr><td>TTC Rev (for GTT genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>GTCTTGTAGTTGCCGTCGTCCTTGAA</td></tr><tr><td>XY Fwd (for gender genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>TGAAGCTTTTGGCTTTGA</td></tr><tr><td>XY Rev (for gender genotyping)</td><td>Eurofins MWG Operon</td><td></td><td>CCGCTGCCAAATTCTTTG</td></tr><tr><td>ROSA26 Fwd</td><td>Eurofins MWG Operon</td><td></td><td>CGAAGTCGCTCTGAGTTGTTATC</td></tr><tr><td>ROSA26 Rev</td><td>Eurofins MWG Operon</td><td></td><td>GCAGATGGAGCGGGAGAAAT</td></tr><tr><td>SA Rev</td><td>Eurofins MWG Operon</td><td></td><td>CGAAGTCGCTCTGAGTTGTTATC</td></tr></tbody></table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

Bu bölümde R26-BIZ (B L I RES-τlac Z) ve R26-GTT (G FP- TT C) allelleri ile çalışma elde edilebilir temsilcisi sonuçları gösterir. Burada üreme ekseni düzenleyen nöral devrelerin olgunlaşmasını analiz R26-R26-BIZ ve GTT allellerini kullanın. Omurgalılarda üreme merkezi gonadotropin salgılatıcı hormon (GnRH), hipotalamus salgılayan nöronların, küçük bir alt grubu ile kontrol edilir. Kisspeptin GnRH nöron için güçlü bir aktivat...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

Embriyonik Fare beyninde İzleme Koşullu Genetik transsinaptik

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.7K Görüntüleme.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

Video: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Mouse in Utero Electroporation: Controlled Spatiotemporal Gene Transfection

In order to understand the function of genes expressed in specific region of the developing brain, including signaling molecules and axon guidance molecules, local gene transfer or knock- out is required. Gene targeting knock-in or knock-out into local regions is possible to perform with combination with a specific CRE line, which is laborious, costly, and time consuming. Therefore, a simple transfection method, an in utero electroporation technique, which can be performed with short time, will be handy to test the possible function of candidate genes prior to the generation of transgenic animals 1,2. In addition to this, in utero electroporation targets areas of the brain where no specific CRE line exists, and will limit embryonic lethality 3,4. Here, we present a method of in utero electroporation combining two different types of electrodes for simple and convenient gene transfer into target areas of the developing brain. First, a unique holding method of embryos using an optic fiber optic light cable will make small embryos (from E9.5) visible for targeted DNA solution injection into ventricles and needle type electrodes insertion to the targeted brain area 5,6. The patterning of the brain such as cortical area occur at early embryonic stage, therefore, these early electroporation from E9.5 make a big contribution to understand entire area patterning event. Second, the precise shape of a capillary prevents uterine damage by making holes by insertion of the capillary. Furthermore, the precise shape of the needle electrodes are created with tungsten and platinum wire and sharpened using sand paper and insulated with nail polish 7, a method which is described in great detail in this protocol. This unique technique allows transfection of plasmid DNA into restricted areas of the brain and will enable small embryos to be electroporated. This will help to, open a new window for many scientists who are working on cell differentiation, cell migration, axon guidance in very early embryonic stage. Moreover, this technique will allow scientists to transfect plasmid DNA into deep parts of the developing brain such as thalamus and hypothalamus, where not many region-specific CRE lines exist for gain of function (GOF) or loss of function (LOF) analyses.

Mouse in Utero Electroporation: Controlled Spatiotemporal Gene Transfection

A gene transfer method into the developing mouse brain is described by using a unique surgical method and special shape of electrodes. This unique technique allows transfection of plasmid DNA temporally and spatially, which will aid many neuroscientists in studying brain development.

Fare Utero Elektroporasyon: Kontrollü Spatiotemporal Gen Transfeksiyon

In order to understand the function of genes expressed in specific region of the developing brain, including signaling molecules and axon guidance ...

Nörobilim

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date this tool has been widely used to study the regulation of cellular proliferation, differentiation and neuronal migration especially in the developing cerebral cortex 6-8. Here we detail our protocol to electroporate in utero the cerebral cortex and the hippocampus and provide evidence that this approach can be used to study dendrites and spines in these two cerebral regions.
Visualization and manipulation of neurons in primary cultures have contributed to a better understanding of the processes involved in dendrite, spine and synapse development. However neurons growing in vitro are not exposed to all the physiological cues that can affect dendrite and/or spine formation and maintenance during normal development. Our knowledge of dendrite and spine structures in vivo in wild-type or mutant mice comes mostly from observations using the Golgi-Cox method 9. However, Golgi staining is considered to be unpredictable. Indeed, groups of nerve cells and fiber tracts are labeled randomly, with particular areas often appearing completely stained while adjacent areas are devoid of staining. Recent studies have shown that IUE of fluorescent constructs represents an attractive alternative method to study dendrites, spines as well as synapses in mutant / wild-type mice 10-11 (Figure 1A). Moreover in comparison to the generation of mouse knockouts, IUE represents a rapid approach to perform gain and loss of function studies in specific population of cells during a specific time window. In addition, IUE has been successfully used with inducible gene expression or inducible RNAi approaches to refine the temporal control over the expression of a gene or shRNA 12. These advantages of IUE have thus opened new dimensions to study the effect of gene expression/suppression on dendrites and spines not only in specific cerebral structures (Figure 1B) but also at a specific time point of development (Figure 1C).
Finally, IUE provides a useful tool to identify functional interactions between genes involved in dendrite, spine and/or synapse development. Indeed, in contrast to other gene transfer methods such as virus, it is straightforward to combine multiple RNAi or transgenes in the same population of cells. 
In summary, IUE is a powerful method that has already contributed to the characterization of molecular mechanisms underlying brain function and disease and it should also be useful in the study of dendrites and spines.

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

This article describes in detail a protocol to electroporate in utero the cerebral cortex and the hippocampus at E14.5 in mice. We also show that this is a valuable method to study dendrites and spines in these two cerebral regions.

Kullanarak Fare Serebral Korteks ve Hippocampus Görselleştirme ve Dendritler ve Spine Genetik Manipülasyon<em&gt; Utero olarak</em&gt; Elektroporasyon

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date ...

Viral Tracing of Genetically Defined Neural Circuitry

Classical methods for studying neuronal circuits are fairly low throughput. Transsynaptic viruses, particularly the pseudorabies (PRV) and rabies virus (RABV), and more recently vesicular stomatitis virus (VSV), for studying circuitry, is becoming increasingly popular. These higher throughput methods use viruses that transmit between neurons in either the anterograde or retrograde direction.
Recently, a modified RABV for monosynaptic retrograde tracing was developed. (Figure 1A). In this method, the glycoprotein (G) gene is deleted from the viral genome, and resupplied only in targeted neurons. Infection specificity is achieved by substituting a chimeric G, composed of the extracellular domain of the ASLV-A glycoprotein and the cytoplasmic domain of the RABV-G (A/RG), for the normal RABV-G1. This chimeric G specifically infects cells expressing the TVA receptor1. The gene encoding TVA can been delivered by various methods2-8. Following RABV-G infection of a TVA-expressing neuron, the RABV can transmit to other, synaptically connected neurons in a retrograde direction by nature of its own G which was co-delivered with the TVA receptor. This technique labels a relatively large number of inputs (5-10%)2 onto a defined cell type, providing a sampling of all of the inputs onto a defined starter cell type.
We recently modified this technique to use VSV as a transsynaptic tracer9. VSV has several advantages, including the rapidity of gene expression. Here we detail a new viral tracing system using VSV useful for probing microcircuitry with increased resolution. While the original published strategies by Wickersham et al.4 and Beier et al.9 permit labeling of any neurons that project onto initially-infected TVA-expressing-cells, here VSV was engineered to transmit only to TVA-expressing cells (Figure 1B). The virus is first pseudotyped with RABV-G to permit infection of neurons downstream of TVA-expressing neurons. After infecting this first population of cells, the virus released can only infect TVA-expressing cells. Because the transsynaptic viral spread is limited to TVA-expressing cells, presence of absence of connectivity from defined cell types can be explored with high resolution. An experimental flow chart of these experiments is shown in Figure 2. Here we show a model circuit, that of direction-selectivity in the mouse retina. We examine the connectivity of starburst amacrine cells (SACs) to retinal ganglion cells (RGCs).

A method of tracing synaptically connected neurons is described. We use TVA specificity of an upstream cell to probe whether a cell population of interest receives synaptic input from genetically defined cell types.

Genetiği Tanımlı Nöral Devre arasında Tracing Viral

Classical methods for studying neuronal circuits are fairly low throughput. Transsynaptic viruses, particularly the pseudorabies (PRV) and rabies virus ...

Electroporation of the Hindbrain to Trace Axonal Trajectories and Synaptic Targets in the Chick Embryo

Electroporation of the chick embryonic neural tube has many advantages such as being quick and efficient for the expression of foreign genes into neuronal cells. In this manuscript we provide a method that demonstrates uniquely how to electroporate DNA into the avian hindbrain at E2.75 in order to specifically label a subset of neuronal progenitors, and how to follow their axonal projections and synaptic targets at much advanced stages of development, up to E14.5. We have utilized novel genetic tools including specific enhancer elements, Cre/Lox - based plasmids and the PiggyBac-mediated DNA transposition system to drive GFP expression in a subtype of hindbrain cells (the dorsal most subgroup of interneurons, dA1). Axonal trajectories and targets of dA1 axons are followed at early and late embryonic stages at various brainstem regions. This strategy contributes advanced techniques for targeting cells of interest in the embryonic hindbrain and for tracing circuit formation at multiple stages of development.

How neuronal networks are established in the embryonic brain is a fundamental question in developmental neurobiology. Here we combined an electroporation technique with novel genetic tools, such as Cre/Lox&#x2013;plasmids and PiggyBac-mediated DNA transposition system in the avian hindbrain to label dorsal interneurons and track their axonal projections and synaptic targets at various developmental stages.

Civciv Embriyo aksonal Yörüngeler ve Synaptic Hedefler Trace için Beyin elektroporasyon

Electroporation of  the chick embryonic neural tube has many advantages such as being quick and efficient  for the expression of foreign genes into ...

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Genetic modification of specific regions of the developing mammalian brain is a very powerful experimental approach. However, generating novel mouse mutants is often frustratingly slow. It has been shown that access to the mouse brain developing in utero with reasonable post-operatory survival is possible. Still, results with this procedure have been reported almost exclusively for the most superficial and easily accessible part of the developing brain, i.e. the cortex. The thalamus, a narrower and more medial region, has proven more difficult to target. Transfection into deeper nuclei, especially those of the hypothalamus, is perhaps the most challenging and therefore very few results have been reported. Here we demonstrate a procedure to target the entire hypothalamic neuroepithelium or part of it (hypothalamic regions) for transfection through electroporation. The keys to our approach are longer narcosis times, injection in the third ventricle, and appropriate kind and positioning of the electrodes. Additionally, we show results of targeting and subsequent histological analysis of the most recessed hypothalamic nucleus, the mammillary body.

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Despite the functional and medical importance of the hypothalamus, in utero genetic manipulation of its development has rarely been attempted. We show a detailed procedure for in utero electroporation into the mouse hypothalamus and show representative results of total and partial (regional) hypothalamic transfection.

Fare Genetik Manipülasyon yoluyla Hipotalamus geliştirilmesi<em&gt; Utero olarak</em&gt; Elektroporasyon

Genetic  modification of specific regions of the developing mammalian brain is a very  powerful experimental approach. However, generating novel mouse ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

Gelişmekte Fare Embriyonik Cortex mitoz Canlı Görüntüleme

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the ...

Two-Photon in vivo Imaging of Dendritic Spines in the Mouse Cortex Using a Thinned-skull Preparation

In the mammalian cortex, neurons form extremely complicated networks and exchange information at synapses. Changes in synaptic strength, as well as addition/removal of synapses, occur in an experience-dependent manner, providing the structural foundation of neuronal plasticity. As postsynaptic components of the most excitatory synapses in the cortex, dendritic spines are considered to be a good proxy of synapses. Taking advantages of mouse genetics and fluorescent labeling techniques, individual neurons and their synaptic structures can be labeled in the intact brain. Here we introduce a transcranial imaging protocol using two-photon laser scanning microscopy to follow fluorescently labeled postsynaptic dendritic spines over time in vivo. This protocol utilizes a thinned-skull preparation, which keeps the skull intact and avoids inflammatory effects caused by exposure of the meninges and the cortex. Therefore, images can be acquired immediately after surgery is performed. The experimental procedure can be performed repetitively over various time intervals ranging from hours to years. The application of this preparation can also be expanded to investigate different cortical regions and layers, as well as other cell types, under physiological and pathological conditions.

Two-Photon in vivo Imaging of Dendritic Spines in the Mouse Cortex Using a Thinned-skull Preparation

Time-lapse imaging in the living animal provides valuable information on structural reorganization in the intact brain. Here, we introduce a thinned-skull preparation that allows transcranial imaging of fluorescently labeled synaptic structures in the living mouse cortex by two-photon microscopy.

İki-Foton<em&gt; In vivo</em&gt; Bir inceltilmiş-kafatası Hazırlık kullanarak Fare Cortex dendritik dikenler Görüntüleme

In the mammalian cortex, neurons form extremely complicated networks and exchange information at synapses. Changes in synaptic strength, as well as ...

Laser-guided Neuronal Tracing In Brain Explants

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake through electroporation in brain explants with targeted laser illumination and matching filter goggles during the procedure. The described technique of in vitro electroporation by itself yields relatively good visual control for targetting certain areas of the brain. By combining it with laser excitation of fluorescent genetic markers and their read-out through band-passing filter goggles, which can pick up the emissions of the genetically labeled cells/nuclei and the fluorescent tracing dye, a researcher can substantially increase the accuracy of injections by finding the area of interest and controlling for the dye-spread/uptake in the injection area much more efficiently. In addition, the laser illumination technique allows to study the functionality of a given neurocircuit by providing information about the type of neurons projecting to a certain area in cases where the GFP expression is linked to the type of transmitter expressed by a subpopulation of neurons.

We describe a technique to label neurons and their processes via anterograde or retrograde tracer injections into brain nuclei using an in vitro preparation. We modified an existing method of in vitro tracer electroporation by taking advantage of fluorescently labeled mouse mutants and basic optical equipment in order to increase labeling accuracy.

Lazer güdümlü Nöronal İzleme Beyin Eksplantlarındaki

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake ...

Time-lapse Confocal Imaging of Migrating Neurons in Organotypic Slice Culture of Embryonic Mouse Brain Using In Utero Electroporation

In utero electroporation is a rapid and powerful approach to study the process of radial migration in the cerebral cortex of developing mouse embryos. It has helped to describe the different steps of radial migration and characterize the molecular mechanisms controlling this process. To directly and dynamically analyze migrating neurons they have to be traced over time. This protocol describes a workflow that combines in utero electroporation with organotypic slice culture and time-lapse confocal imaging, which allows for a direct examination and dynamic analysis of radially migrating cortical neurons. Furthermore, detailed characterization of migrating neurons, such as migration speed, speed profiles, as well as radial orientation changes, is possible. The method can easily be adapted to perform functional analyses of genes of interest in radially migrating cortical neurons by loss and gain of function as well as rescue experiments. Time-lapse imaging of migrating neurons is a state-of-the-art technique that once established is a potent tool to study the development of the cerebral cortex in mouse models of neuronal migration disorders.

Time-lapse Confocal Imaging of Migrating Neurons in Organotypic Slice Culture of Embryonic Mouse Brain Using In Utero Electroporation

This protocol provides instructions for direct observation of radially migrating cortical neurons. In utero electroporation, organotypic slice culture, and time-lapse confocal imaging are combined to directly and dynamically study the effects of overexpression or downregulation of genes of interest in migrating neurons and to analyze their differentiation during development.

Embriyonik Fare Beyni Organotipik Dilim Kültüründe Nöronların Geçiş Sürekli Konfokal Görüntüleme Kullanımı<em&gt; Utero&#39;da</em&gt; Elektroporasyon

In utero electroporation is a rapid and powerful approach to study the process of radial migration in the cerebral cortex of developing mouse embryos. It ...

Stereotaxic Surgical Approach to Microinject the Caudal Brainstem and Upper Cervical Spinal Cord via the Cisterna Magna in Mice

Stereotaxic surgery to target brain sites in mice is commonly guided by skull landmarks. Access is then obtained via burr holes drilled through the skull. This standard approach can be challenging for targets in the caudal brainstem and upper cervical cord due to specific anatomical challenges as these sites are remote from skull landmarks, leading to imprecision. Here we outline an alternative stereotaxic approach via the cisterna magna that has been used to target discrete regions of interest in the caudal brainstem and upper cervical cord. The cisterna magna extends from the occipital bone to the atlas (i.e., the second vertebral bone), is filled with cerebrospinal fluid, and is covered by dura mater. This approach provides a reproducible route of access to select central nervous system (CNS) structures that are otherwise hard to reach due to anatomical barriers. Furthermore, it allows for direct visualization of brainstem landmarks in close proximity to the target sites, increasing accuracy when delivering small injection volumes to restricted regions of interest in the caudal brainstem and upper cervical cord. Finally, this approach provides an opportunity to avoid the cerebellum, which can be important for motor and sensorimotor studies.

Stereotaxic Surgical Approach to Microinject the Caudal Brainstem and Upper Cervical Spinal Cord via the Cisterna Magna in Mice

Stereotaxic surgery to target brain sites in mice commonly involves access through the skull bones and is guided by skull landmarks. Here we outline an alternative stereotaxic approach to target the caudal brainstem and upper cervical spinal cord via the cisterna magna that relies on direct visualization of brainstem landmarks.

Farelerde Cisterna Magna ile Kaudal Beyin Sapı ve Üst Servikal Omuriliğin Mikroenjekte Edilmesine Stereotaksik Cerrahi Yaklaşım

Stereotaxic surgery to target brain sites in mice is commonly guided by skull landmarks. Access is then obtained via burr holes drilled through the skull. ...

Embriyonik Fare beyninde İzleme Koşullu Genetik transsinaptik

Özet

Daha Fazla Video Keşfet

Fare Utero Elektroporasyon: Kontrollü Spatiotemporal Gen Transfeksiyon

Kullanarak Fare Serebral Korteks ve Hippocampus Görselleştirme ve Dendritler ve Spine Genetik Manipülasyon

Genetiği Tanımlı Nöral Devre arasında Tracing Viral

Civciv Embriyo aksonal Yörüngeler ve Synaptic Hedefler Trace için Beyin elektroporasyon

Fare Genetik Manipülasyon yoluyla Hipotalamus geliştirilmesi

Gelişmekte Fare Embriyonik Cortex mitoz Canlı Görüntüleme

İki-Foton

Lazer güdümlü Nöronal İzleme Beyin Eksplantlarındaki

Embriyonik Fare Beyni Organotipik Dilim Kültüründe Nöronların Geçiş Sürekli Konfokal Görüntüleme Kullanımı

Farelerde Cisterna Magna ile Kaudal Beyin Sapı ve Üst Servikal Omuriliğin Mikroenjekte Edilmesine Stereotaksik Cerrahi Yaklaşım