We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.

NOT: Etik Açıklama: hayvan denekleri Prosedürleri Hamburg Üniversitesi ve Saarland Üniversitesi hayvan koruma kurulu tarafından onaylanmıştır. 1. Hazırlık ve Embriyonik Doku Fixation <ol><li> Embriyoların teşrih ve hayvanlar kurban edilmeden önce doku sonraki tespiti için çözümler hazırlamak için gerekli tüm ekipman düzenleyin. NOT: Her zaman (7.4 pH değerinin, 0.1 M fosfat tamponlu salin (PBS) içinde% 4 PFA), taze% 4 paraformaldehit (PFA) solüsyon hazırlanır. </li><li> Bir etik onaylı prosedüre zamanlı hamile kadın fare Euthanize. </li><li> Bir platform üzerine fare aktarın. % 70 etanol ile karın ventral tarafı ıslatın ve karın boşluğuna maruz keskin bir makas kullanarak dikey bir kesi yapmak. </li><li> Embriyonik zinciri tanımlamak ve dikkatle kullanarak künt forseps çekin ve buz gibi soğuk PBS içine yerleştirin. </li><li> Bireysel embriyolar çıkarınince makas ve forseps kullanarak embriyonik zinciri. Embriyoların etrafında ekstra doku çıkarın ve buz gibi soğuk PBS yıkayın. </li><li> (PFA içine embriyo transferinden önce) küçük bir kuyruk biyopsisi alın ve cinsiyet tanımlama ve izleyici alel genotiplemesi PCR için kuyruk lizis tamponu içinde kuluçkaya yatmaktadır. </li><li> En dıştaki tarafında embriyodan başlayın ve bir çalkalayıcı üzerinde buz üzerinde buz soğukluğunda% 4 PFA içeren bir tüp içine ayrı ayrı embriyo transferi. </li><li> Sabit sallayarak E13.5 yaş veya buz üzerinde 1.5 saat genç embriyolar bekletin. Sabit sallayarak buz üzerinde 2.5 saat yaş E14.5 ve E15.5 embriyolar bekletin. </li><li> Embriyolar yaş E16.5 veya yaşlı için, başını kesmek ve PFA çözeltisi içinde kafa iliklerine önce dış deri kaldırmak. E16.5 embriyo Başlıkları sürekli çalkalanarak buz üzerinde 4.5 saat süreyle batırılmış olabilir. </li><li> Uygun tespit edildikten sonra, buz gibi soğuk PBS ile embriyolar üç kez yıkayın. Batarlarsa kadar 4 ° C de PBS çözeltisi içinde% 30 sakroz içine embriyo transferinealt. </li></ol> 2. Donma <ol><li> Dondurma işlemine başlamadan önce gerekli tüm malzemeleri düzenleyin: cryo-kalıp, cryo-eldivenler, tüy entomolojisi forseps, işaretleyici kalem ve optimal kesim sıcaklığının bileşik (Ekim) </li><li> Kalıcı alkole dirençli işaretleyici ile cryo-kalıp Etiket (doku, tarih ve genotip yönünü söz). Bir buz kovası ezilmiş kuru buz ve% 100 etanol içinde bir çamuru hazırlanır. Izopentanın içeren iç cam beher yerleştirin. İzopentan soğuması için 10 dakika bekleyin. </li><li> Bu arada, sukroz çözeltisi doku kaldırmak laboratuvar mendil kullanarak doku çevresinde aşırı sukroz silin. Doku karşılamak için yeterli Ekim ile önceden etiketlenmiş cryo-kalıba doku aktarın. Ekim herhangi bir hava kabarcıkları kaçının; Özellikle doku etrafında. </li><li> Doku hasarı önlemek için tüy entomoloji forseps kullanarak Ekim doku yönlendirin. Cryo-mol aktararak dondurma başlayınönceden soğutulmuş izopentan banyosuna ö. Düzgün donma olmaz gibi OCT içine izopentanın sıçrama yok. -80 ° C de, alüminyum folyo ve mağaza örnekleri sarın. </li></ol> 3. Cryosectioning <ol><li> Bir sirostat kullanılarak beş serisi &#39;14 mikron ince seri bölümleri kesin ve immünofloresan (IF) analizi için Superfrost® Plus cam slaytlar üzerinde toplamak. Kullanılan kadar -80 ° C &#39;de slaytlar saklayın. </li></ol> Tyramide Sinyal Amplifikasyon (TSA) Protokolü kullanma 4. Tracer görselleştirme <ol><li> Boyama için gerekli olan tamponlar ve reaktifler hazırlayın. Her zaman taze kullanım gününde Tris-NaCI-Tween (TNT) tamponu hazırlayın. <ol><li> 1 L&#39;lik bir son hacme kadar 1 ml pipet kullanarak Tween 20 500 ul ekle, 1 M Tris-HCl, pH 7.5, 5 mM NaCl, 30 ml ve GKD 2 O 100 ml ile TNT tamponu hazırlayın. Yavaş yavaş Tween 20 ekleyin ve tüm Tween 20 olmasını sağlamak için yukarı ve aşağı birkaç kez pipet floşÇözelti. </li><li> Tris-NaCI-Blokaj kadar 1 L&#39;lik bir son hacme pH 7.5, 5 mM NaCl, 30 ml ve GKD 2 O, 1 M Tris-HCl, 100 ml kullanılarak (TNB), tampon Engelleme Reaktif 5 g ekleyin hazırlanması ile (Resim yavaş yavaş tampon küçük artışlarla kiti) karıştırılırken. (Bu, 30-60 dakika daha uzun zaman almak gerekir) tamamen bloke edici tepkin madde çözünmesi için sürekli karıştırılarak 55 ° C&#39;ye yavaş yavaş solüsyon ısıtın. Homojen ısıtma 55 ° C&#39;de su banyosu kullanın ulaşmak için. çözüm sütlü görünecektir. Kullanmadan önce oda sıcaklığına getirin çözüm. Uzun süreli depolama için -20 ° C&#39;de kısım saklayın. </li><li> Moleküler Biyolojisi / HPLC-grade DMSO (takımla birlikte verilmektedir), biyotin tiramid reaktifi sulandırın. Bunun üzerine bağlı olarak kit, DMSO uygun miktarı değişebilir kullanılır. 4 ° C &#39;de stok solüsyonu saklayın. NOT: İlgili Cre ve R26 allelleri için heterozigot hayvanlardan Bölümler devre analizi için kullanılabilir. Kullanım sveriliş negatif kontrol olarak sırasıyla bir Cre veya bir R26 alel, taşıma littermates. Tam çift heterozigot hayvanlardan slaytlar gibi negatif kontrol slaytlar davranın. Buna ek olarak, bir çift heterozigot hayvandan bir kontrol slayt bunlarla TSA ayıracı (Yükseltilmemiş kontrol) dışarıda bırakın. </li></ol></li><li> Keskin bir neşter taze doku bölümleri çevreleyen aşırı Ekim kaldırmak ve bir PAP kalemle bölümler etrafında sınır işareti kullanma. </li><li> Oda sıcaklığında 2-3 dakika boyunca (RT) slaytlar kurutun. 5 dakika her TNT RT 3x slaytlar yıkayın. Endojen peroksidaz aktivitesi söndürmek için% 0.3 30 dakika boyunca buz soğukluğunda metanol içinde H2O 2 solüsyonu oda sıcaklığında slaytlar inkübe edin. </li><li> 5 dakika boyunca PBS ile yıkayın 3x oda sıcaklığında her biri. Doku geçirgenliği için PBS içinde% 0.5 Triton-X 100, 10 dakika boyunca inkübe edin. 5 dakika her TNT RT 3x slaytlar yıkayın. </li><li> TNB ile Blok 30 için (slayt başına 200-300 ul engelleme çözümü)nemli bir oda içinde oda sıcaklığında Min. Tüm bölümleri tamamen TNB tarafından karşılanmaktadır emin olun. Slaytlar adımlar arasında kurumasına izin vermeyin. </li><li> Fazla engelleme tamponu süzün ve izleyici kabul primer antiserumun uygulamak oda sıcaklığında ya da gece boyunca 4 ° C &#39;de 2 saat TNB içinde seyreltildi (1: GTT 15.000 tavşan anti-GFP: BL 1000 keçi anti-WGA, 1). Tamamen doku bölümü (slayt başına 200-300 ul) karşılamak için yeterli hacim kullandığınızdan emin olun. NOT: Burada önerilen primer antiserumlar dilüsyonları ayarlanması gerekebilir. </li><li> 5 dakika ajitasyon ile her TNT RT 3x slaytlar yıkayın. </li><li> (: Anti-WGA 500 at anti-keçi IgG&#39;si, 1: oda sıcaklığında 1 saat TNB içinde, anti-GFP için 5000 keçi anti-tavşan IgG 1), ilk antiserum ana tanıyan biyotinlenmiş sekonder antiserumu ile bölümleri inkübe edin. </li><li> 5 dakika çalkalanarak her biri için oda sıcaklığında, TNT ile yıkayın 3x. 100 streptavidin (SA) ile birleştirilmiş bayır yaban turpu peroksidaz (SA-HRP, Resim wi: 1 inkübenemli bir oda içinde oda sıcaklığında 30 dakika için TNB içinde kiti) th. 5 dakika her TNT RT 3x slaytlar yıkayın. Bu arada TSA eritin. </li><li> (Kit ile sağlanan, BL görselleştirme ve GTT için TSA + kiti için TSA kiti kullanın) TSA amplifikasyon seyreltici içinde TSA 01:50 seyreltin. Oda sıcaklığında tam olarak 10 dakika için seyreltilmiş TSA doku bölümleri inkübe edin. Gelecek deneyler için kalan seyreltilmiş TSA reaktifi kullanmayın, ideal bir önceki yıkama aşamasında, kullanımdan hemen önce TSA Seyreltik; her zaman taze hazırlayın. </li><li> 5 dakika ajitasyon ile her TNT RT 3x slaytlar yıkayın. Oda sıcaklığında 30 dakika için TNB içinde 500 Alexa Fluor® 546 streptavidin: 1 ile inkübe edin. 5 dakika ajitasyon ile her TNT RT 3x slaytlar yıkayın. </li><li> Nükleer boyama için oda sıcaklığında PBS içinde% 5 bisbenzimid çözelti içinde 10 dakika süreyle inkübe edin. 5 dakika ajitasyon ile her TNT RT 3x slaytlar yıkayın. Fluromount G ile monte ve Epifloresans veya konfokal mikroskopi gerçekleştirin. <em&gt; Sorun giderme: Tracer transferi etkinliği (kullanılan Cre sürücü hattı ile belirlenir) üreten hücrelerde ROSA26 mahalinin ifade düzeyine bağlıdır ve nöral devre üzerinde (izleyici, yakınsama vb üreten nöronların sayısı örneğin) analiz edecektir. Bu nedenle burada önerilen primer antiserumlar dilüsyonları düşük ya da aşırı sinyal önlemek için ayarlanması gerekebilir. Arka plan her zaman uygun kontrol slaytlar (yukarıya bakınız) kullanılarak analiz edilmelidir. </li></ol> Embriyonik Bölüm 5. τlacZ Boyama <ol><li> Boyama için gerekli olan tamponlar ve reaktifler hazırlayın. Her zaman taze Kullanmadan önce LacZ tampon C hazırlamak. <ol><li> 1 mi% 70 dimetilformamit (DMF), X-gal 40 gramı ekleyerek, 5-bromo-4-kloro-3-indolil-β-D-galaktopiranosid (X-gal) stok çözeltisi (40 mg / ml) hazırlayın. Uzun süreli depolama için -20 ° C&#39;de alüminyum folyo ve mağaza ile kaplayın. </li><li> Hazırlayın nitro mavi tetrazolyum (NBT) st1 mi% 70 DMF NBT 50 gramı ekleyerek ock çözeltisi (50 mg / ml). Uzun süreli depolama için -20 ° C&#39;de alüminyum folyo ve mağaza ile kaplayın. </li><li> LacZ% 25 glutaraldehid 80 ul,% 4 5 ml PFA, 1 M 20 ul kullanılarak MgCI2, 500 mM EGTA, 100 ul bir son 1, 1 M fosfat tampon maddesi pH 7.4 içinde çözdürülür ve GKD 2 O kadar tespit maddesi hazırlanması 10 ml hacmi. </li><li> LacZ 500 mM EGTA, 5 ml, 500 ml&#39;lik bir nihai hacme kadar 50 mi ile kombine edilmiştir fosfat tamponu, pH 7.4 ve 1 M, 2, O, MgCl2 1 M A izlenerek ve 1 ml tampon hazırlayın. </li><li> 1 mi 1 M MgCI2, 500 mM EGTA, 5 ml, 5 mi% 1 sodyum deoksikolat,% 10 NP-40, 100 mi, 50 1 M fosfat tampon maddesi pH 7.4 içinde çözdürülür ve GKD 2 O kullanılarak LacZ tampon B hazırlanması 500 ml&#39;lik bir nihai hacme kadar. </li><li> NBT stok çözeltisi 10 ul ve LacZ tampon B, 1 ml X-gal stok çözeltisi 12.5 ul kullanımdan hemen önce taze sağlayın ve alüminyum folyo ile kapak ekleyerek LacZ tampon C hazırlayın. </li></ol&gt; </li><li> (Bu arada, bir PAB kalem ile preparatların hazırlanması), en az 10-15 dakika boyunca oda sıcaklığında slaytlar kurutun. </li><li> LacZ ile bölüm kimyasal buhar-başlığın içinde, nemlendirilmiş bir odacıkta, oda sıcaklığında 2 dakika boyunca tespit maddesi düzeltildi. 3 kez PBS ile yıkayın, 2 mM MgCl2 ile desteklenmesiydi. </li><li> LacZ slaytlar oda sıcaklığında 10 dakika her biri için bir 3 kez yıkama tamponu LacZ tampon A ile slaytlar durulayın. 5 dakika her LacZ tampon B ile 2 kez yıkayın. Nemli bir oda içinde 6 saat veya gece boyunca 30-37 ° C&#39;de LacZ tampon C slaytlar inkübe edin. NOT: LacZ tampon C yeterli hacmi ekleyin; slaytlar inkübasyon sırasında kurumasına olmamalıdır. </li><li> Uygun bir inkübasyon süresinden sonra, PBS ile kayar, 2 mM MgCl2 ile desteklenmesiydi yıkayın. Kısaca GKD 2 O. ile bölümleri durulayın Mayer&#39;in glisin jelatin ile lamel. Bir diferansiyel girişim kontrast (DIC) görüntüleme set-up ile donatılmış bir ışık mikroskobu için uygundur. </li></ol> 6. Gender ve Tracer Genotipleme <ol><li> 1 M Tris-HCl, pH 8.5, 500 mM EGTA, 100 ul 1 ml&#39;si kullanılarak kuyruk liziz tamponu,% 10 SDS, 200 ul 5 M NaCl ve GKD 2 O 400 ul, 10 ml lik bir son hacim yapmak için. </li><li> Bir kuyruk biyopsi içeren her Eppendorf tüpüne kuyruk lizis tamponu 500 ul ekleyin. 100 mg / ml &#39;lik bir nihai konsantrasyona kadar proteinaz K ilave. 55 ° C&#39;de bir çalkalayıcı üzerinde gece boyunca inkübe edin. </li><li> Oda sıcaklığında 10 dakika için 17,000 x g&#39;de santrifüjleyin örnekleri. Yeni bir santrifüj tüpüne süpernatant aktarın. Yüzer izopropanol 500 ul ekle. Yukarı ve aşağı tüpler ters çevrilerek en az 5 dakika boyunca karıştırın. </li><li> Oda sıcaklığında 5 dakika boyunca 17,000 x g&#39;de santrifüj dönerler. Süpernatantı dökün. % 70 etanol içinde 200 ul ekle. En az 5 dakika boyunca çalkalanır. </li><li> 5 dakika için 17,000 x g&#39;de santrifüjleyin. Bir Pipetman (kapalı dökmek değil) ile süpernatantı. 15-30 dakika boyunca bir sıcak oda (37 ° C) pelet kurutun. </li><li> 100 ul süspanse peletgeniş çaplı süzülmüş ipuçlarını kullanarak düşük TE pH 8.0 ya da su. Uygun erimesi için gece boyunca ° C&#39;de 1 saat boyunca ve 37 ° C&#39;de 55 ° C olarak koyun. 4 ° C&#39;de saklayın. </li><li> PCR reaksiyonu (kuyruk DNA&#39;sının 1 ul, her bir primerden 2.5 ul DMSO, 10:00, 25 her dNTP uM ve 1 M betain ihtiva eden 50 ul reaksiyon karışımı) için DNA 1 ul kullanın. Genotipleme ve cinsiyet tespiti için PCR primerleri malzemeleri tabloda listelenmiştir. </li></ol>

<ol>
	<li>Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+techniques+for+tracing+pathways+in+the+central+nervous+system+of+developing+and+adult+mammals.">Recent techniques for tracing pathways in the central nervous system of developing and adult mammals.</a> Brain. Res. Bull. 51, 11-28 (2000).</li><li>Huang, Z. J., Zeng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+approaches+to+neural+circuits+in+the+mouse.">Genetic approaches to neural circuits in the mouse.</a> Annu. Rev. Neurosci. 36, 183-215 (2013).</li><li>Lanciego, J. L., Wouterlood, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+half+century+of+experimental+neuroanatomical+tracing.">A half century of experimental neuroanatomical tracing.</a> J. Chem. Neuroanat. 42, 157-183 (2011).</li><li>DeFalco, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-assisted+mapping+of+neural+inputs+to+a+feeding+center+in+the+hypothalamus.">Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus.</a> Science. 291, 2608-2613 (2001).</li><li>Kumar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+arcuate+nucleus+kisspeptin+neurons+communicate+with+GnRH+neurons+in+utero.">Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero.</a> J. Neurosci. 34, 3756-3766 (2014).</li><li>Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+approach+to+trace+neural+circuits.">A genetic approach to trace neural circuits.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).</li><li>Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrograde+trans-synaptic+transfer+of+green+fluorescent+protein+allows+the+genetic+mapping+of+neuronal+circuits+in+transgenic+mice.">Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice.</a> Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).</li><li>De Roux, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypogonadotropic+hypogonadism+due+to+loss+of+function+of+the+KiSS1-derived+peptide+receptor+GPR54.">Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).</li><li>Seminara, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GPR54+gene+as+a+regulator+of+puberty.">The GPR54 gene as a regulator of puberty.</a> N. Engl. J. Med. 349, 1614-1627 (2003).</li><li>Mayer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+and+completion+of+puberty+in+female+mice+depend+on+estrogen+receptor+alpha-signaling+in+kisspeptin+neurons.">Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).</li><li>Soriano, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generalized+lacZ+expression+with+the+ROSA26+Cre+reporter+strain.">Generalized lacZ expression with the ROSA26 Cre reporter strain.</a> Nat. Genet. 21, 70-71 (1999).</li><li>Seibler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+copy+shRNA+configuration+for+ubiquitous+gene+knockdown+in+mice.">Single copy shRNA configuration for ubiquitous gene knockdown in mice.</a> Nucleic Acids Res. 33, e67 (2005).</li><li>Semaan, S. J., Kauffman, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+on+the+epigenetic+and+transcriptional+regulation+of+the+Kiss1+gene.">Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene.</a> Int. J. Dev. Neurosci. 31, 452-462 (2013).</li><li>Feil, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-activated+site-specific+recombination+in+mice.">Ligand-activated site-specific recombination in mice.</a> Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).</li></ol>

No conflict of interest declared.

Genetik olarak tanımlanmış sinirsel nöral devreleri iz transgenler olarak transsinaptik izleyiciler ifade ajanları veya neurotopic virüs stereotaksik enjeksiyonu ile karşılaştırıldığında bir çok avantaja sahiptir. İlk olarak, izleyici, bir endojen protein olarak üretilir ve bu nedenle herhangi bir bağışıklık karşılığını ortaya etmez ve seçici bir sinir yolu yüksek ölçüde tekrarlanabilirliği farklı hayvanlarda analiz edilebilir. Bu bir non-invaziv bir yöntemdir, çünkü İkincisi, bu ...

Anatomik yol izleme beyin ve davranış arasındaki ilişkiyi deşifre 1 en sık kullanılan araçlardan biridir. Nöral devre izleme teknolojileri İlerleme farelerde 2 genetik tanımlanan nöron nüfus nöral devreleri takip yeteneği ile sinirbilimcileri ihsan etmiştir. Bu teknik gelişmelerin rağmen özellikle embriyonik olgunlaşma sırasında nöral devrelerin oluşumunu çözülmeye zor kalır. Bugüne kadar geliştirilen izleme yöntemlerinin çoğu transsinaptik izleyiciler stereotaksik enjeksiyonu ya da genetik olarak tadil edilmiş nörotropik virüsleri (Şekil 1) 2,3 dayalı olmasıdır. Bu teknikler bağlantı mekansal ve zamansal çözünürlük gibi gelişmekte olan beynin, enjeksiyon yerinde ve en impor enjeksiyon yerinde tekrarlanabilirliği, potansiyel inflamasyon içine teknik açıdan zor izleyici enjeksiyonlar gibi çeşitli içsel sınırlamalar elde ederkennörotrop virüslerin neden rı değerlendirilerek sitotoksisite bunların kullanımını sınırlamak 4. Alternatif bir yöntem, genetik olarak değiştirilmiş farelerde transgenler olarak transsinaptik izleyiciler bildirmektir. Son zamanlarda bu tekniği modifiye ve herhangi bir genetik tespit nöronal nüfusun 5 nöral devreleri eşleştirmek için bir ikili genetik transsinaptik izleme sistemi geliştirdik. Kre-aracılı sonra Bizim deneysel strateji çift yönlü izleyici arpa lektin (BL) da 6 ya da ROSA 26 lokusundan GFP (GTT) 7 kaynaşmış retrograd izleyici Tetanos Toksin parçası Cı sergileyen iki yeni knock-in fare suşlarının dayanmaktadır rekombinasyon. Burada seçici Kisspeptin üreten nöronlarda BL ve GTT, üreme eksen 8,9 olgunlaşmasını düzenleyen karıştığı bir neuropeptide ifade etmek, bu fare suşları kullanıldı. Biz bu teknik öpücük gelişimini ve olgunlaşmasını görselleştirmek için uygun olduğunu göstermekdişi fare beyninin 5 embriyonik gelişimi sırasında peptin sinir devresi. Yetiştirme stratejisi R26-BL-IRES-τlacZ (BIZ) ve R26-GFP-TTC (GTT) izleyici hatları knock-rekombinant ROSA26 alleller taşıyan suşlar 5 vardır. R26-dünyası ve R26-GTT aleller bağlı iki loxP sitelerinin 5 tarafından kuşatılır, güçlü transkripsiyon durdurma sinyali, varlığına bağlı olarak, transkripsiyonel olarak sessizdir. Dünyası ve GTT transgenin sentezlenmesi transkripsiyon durdurma sinyali kre-aracılı çıkarılması ile aktive edilir. R26-R26-BIZ ve GTT alleller sadece Cre sürücü hattı ile geçerek bağımsız olarak kullanılabilir. Ilgili Cre ve R26 aleller için analiz hayvanlar heterozigoz için kullanılabilir. Bir Cre ya da bir R26, aleli taşıyan yavrular, sırasıyla, kontrol olarak kullanılır. Seçenek olarak ise, bu t oluşturmak da mümkündürknock-Riple Kre, R26-R26-BIZ ve GTT alleller taşıyan hayvanlar, ancak bu bir ek haçı gerektirir.

<table border="0" cellpadding="0" cellspacing="0" width="721">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:219px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Bisbenzimide (Hoechst 33258 dye)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">14530-100MG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ethanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">32205-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryo mold (Peel-a-way)</td>
			<td style="width:219px;">Polyscience Inc.</td>
			<td style="width:119px;">18646A-1</td>
			<td>22mm x 22mm x 20mm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DMSO</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D8418-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Dimethyl Formamide (DMF)</td>
			<td style="width:219px;">VWR Chemicals</td>
			<td style="width:119px;">23470,293</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">EGTA</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3054.3</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fluoromount G</td>
			<td style="width:219px;">Southern Biotech</td>
			<td style="width:119px;">0100-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glutaraldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">G5882-50ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hydrogen peroxide</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">34988-7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Isopentane (Methyl 2-butane)</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">M32631-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kaiser&#39;s Glycine gelatin</td>
			<td style="width:219px;">Merck</td>
			<td style="width:119px;">1092420100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Methanol</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">494437-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">MgCl2</td>
			<td style="width:219px;">Sigma</td>
			<td>M2670-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NaCl</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">HN00.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NBT</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">298-83-9</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Nonidet P40 substitute</td>
			<td style="width:219px;">Fluka</td>
			<td style="width:119px;">743.85</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">OCT</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">14020108926</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PAP pen</td>
			<td style="width:219px;">Dako</td>
			<td style="width:119px;">S2002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Parafarmaldehyde</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">P6148-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium deoxycholate</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">D6750-25G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sucrose</td>
			<td style="width:219px;">Sigma</td>
			<td style="width:119px;">S7903-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Superfrost slides</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">FT4981GLPLUS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL700</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TSA plus kit</td>
			<td style="width:219px;">PerkinElmer&#160;</td>
			<td style="width:119px;">NEL749A001KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">AE15.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Triton-X 100</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">3051.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tween 20</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">9127.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">X-gal</td>
			<td style="width:219px;">ROTH</td>
			<td style="width:119px;">2315.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cryostat</td>
			<td style="width:219px;">Leica</td>
			<td style="width:119px;">na</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Light microscope equipped with DIC imaging&#160;</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Fluroscence microscope</td>
			<td style="width:219px;">Zeiss</td>
			<td style="width:119px;">Axioskop2 equipped with Axio Vision software</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Photoshop</td>
			<td style="width:219px;">Adobe</td>
			<td style="width:119px;">PS6</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Goat anti-WGA (recognizes BL)</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">AS-2024</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylayted horse anti-goat IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-9500&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated goat anti-rabbit IgG</td>
			<td style="width:219px;">Vector Laboatories</td>
			<td style="width:119px;">BA-1000&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Rabbit anti-GFP (recognizes GTT)</td>
			<td style="width:219px;">Invitrogen</td>
			<td style="width:119px;">A11122</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rabbit anti-GnRH</td>
			<td style="width:219px;">Affinity Bio Reagent</td>
			<td style="width:119px;">PA1-121</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dylight488-donkey anti-rabbit IgG</td>
			<td style="width:219px;">Thermo Scientific</td>
			<td style="width:119px;">SA5-10038</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SA-Alexa Fluor 546</td>
			<td style="width:219px;">Life Technologies</td>
			<td>S-11225</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Primers</td>
			<td style="width:219px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Fwd (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;ATGAAGATGATGAGCACCAG 
			GGC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BL Rev&#160; (for BIZ genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">&#160;AGCCCTCGCCGCAGAACTC&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Fwd&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCGATGCAACGAGTGATGAG 
			GTTCG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cre Rev&#160; (for Cre genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCAGGCTAAGTGCCTTCTCTAC 
			ACCTGC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Fwd&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">AGCAAGGGCGAGGAGCTGTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TTC Rev&#160; (for GTT genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">GTCTTGTAGTTGCCGTCGTCCT 
			TGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Fwd (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">TGAAGCTTTTGGCTTTGA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">XY Rev&#160; (for gender genotyping)</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CCGCTGCCAAATTCTTTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ROSA26 Fwd</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">ROSA26 Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">GCAGATGGAGCGGGAGAAAT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">SA Rev</td>
			<td>Eurofins MWG Operon</td>
			<td colspan="2" style="width:285px;">CGAAGTCGCTCTGAGTTGTTATC</td>
		</tr>
	</tbody>
</table>

conditional genetic transsynaptic tracing in the embryonic mouse brain

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.

Bu bölümde R26-BIZ (B L I RES-τlac Z) ve R26-GTT (G FP- TT C) allelleri ile çalışma elde edilebilir temsilcisi sonuçları gösterir. Burada üreme ekseni düzenleyen nöral devrelerin olgunlaşmasını analiz R26-R26-BIZ ve GTT allellerini kullanın. Omurgalılarda üreme merkezi gonadotropin salgılatıcı hormon (GnRH), hipotalamus salgılayan nöronların, küçük bir alt grubu ile kontrol edilir. Kisspeptin GnRH nöron için güçlü bir aktivat...

Watch this Scientific Journal Video about Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain at JoVE.com

Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.

Embriyonik Fare beyninde İzleme Koşullu Genetik transsinaptik

Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits ...

conditional-genetic-transsynaptic-tracing-in-the-embryonic-mouse-brain

Research

JoVE Journal

Neuroscience

18.6K Görüntüleme.  University of Saarland School of Medicine. Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution. 

Video: Conditional Genetic Transsynaptic Tracing in the Embryonic Mouse Brain

Manual Drainage of the Zebrafish Embryonic Brain Ventricles

Cerebrospinal fluid (CSF) is a protein rich fluid contained within the brain ventricles. It is present during early vertebrate embryonic development and persists throughout life. Adult CSF is thought to cushion the brain, remove waste, and carry secreted molecules1,2. In the adult and older embryo, the majority of CSF is made by the choroid plexus, a series of highly vascularized secretory regions located adjacent to the brain ventricles3-5. In zebrafish, the choroid plexus is fully formed at 144 hours post fertilization (hpf)6. Prior to this, in both zebrafish and other vertebrate embryos including mouse, a significant amount of embryonic CSF (eCSF) is present . These data and studies in chick suggest that the neuroepithelium is secretory early in development and may be the major source of eCSF prior to choroid plexus development7.
eCSF contains about three times more protein than adult CSF, suggesting that it may have an important role during development8,9. Studies in chick and mouse demonstrate that secreted factors in the eCSF, fluid pressure, or a combination of these, are important for neurogenesis, gene expression, cell proliferation, and cell survival in the neuroepithelium10-20. Proteomic analyses of human, rat, mouse, and chick eCSF have identified many proteins that may be necessary for CSF function. These include extracellular matrix components, apolipoproteins, osmotic pressure regulating proteins, and proteins involved in cell death and proliferation21-24. However, the complex functions of the eCSF are largely unknown.
We have developed a method for removing eCSF from zebrafish brain ventricles, thus allowing for identification of eCSF components and for analysis of the eCSF requirement during development. Although more eCSF can be collected from other vertebrate systems with larger embryos, eCSF can be collected from the earliest stages of zebrafish development, and under genetic or environmental conditions that lead to abnormal brain ventricle volume or morphology. Removal and collection of eCSF allows for mass spectrometric analysis, investigation of eCSF function, and reintroduction of select factors into the ventricles to assay their function. Thus the accessibility of the early zebrafish embryo allows for detailed analysis of eCSF function during development.

We present a method to collect cerebrospinal fluid (CSF) and to create a system which lacks CSF within the embryonic zebrafish brain ventricular system. This allows for further examination of CSF composition and its requirement during embryonic brain development.

Zebra balığı Embriyonik Beyin Ventrikül Manuel Drenaj

Cerebrospinal fluid  (CSF) is a protein rich fluid contained within the brain ventricles. It is  present during early vertebrate embryonic development and ...

Nörobilim

Selective Tracing of Auditory Fibers in the Avian Embryonic Vestibulocochlear Nerve

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling of auditory axons within the VIIIth cranial nerve would enhance the study of central auditory circuit development. This approach is challenging because multiple sensory organs of the inner ear contribute to the VIIIth nerve 1. Moreover, markers that reliably distinguish auditory versus vestibular groups of axons within the avian VIIIth nerve have yet to be identified. Auditory and vestibular pathways cannot be distinguished functionally in early embryos, as sensory-evoked responses are not present before the circuits are formed. Centrally projecting VIIIth nerve axons have been traced in some studies, but auditory axon labeling was accompanied by labeling from other VIIIth nerve components 2,3. Here, we describe a method for anterograde tracing from the acoustic ganglion to selectively label auditory axons within the developing VIIIth nerve. First, after partial dissection of the anterior cephalic region of an 8-day chick embryo immersed in oxygenated artificial cerebrospinal fluid, the cochlear duct is identified by anatomical landmarks. Next, a fine pulled glass micropipette is positioned to inject a small amount of rhodamine dextran amine into the duct and adjacent deep region where the acoustic ganglion cells are located. Within thirty minutes following the injection, auditory axons are traced centrally into the hindbrain and can later be visualized following histologic preparation. This method provides a useful tool for developmental studies of peripheral to central auditory circuit formation.

Here we describe a microdissection technique followed by fluorescent dye injection into the acoustic ganglion of early chick embryos for selective tracing of auditory axon fibers in the nerve and hindbrain.

Kuş Embriyonik vestibülokoklear sinir İşitsel Elyaf seçici Aydınger

The embryonic chick is a widely used model for the study of peripheral and central ganglion cell projections. In the auditory system, selective labeling ...

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Fare Omurilik Koşullu Gen Manipülasyon için bir Viral Vector Stereotaksik Enjeksiyon

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

Angiogenesis is the complex process of new blood vessel formation defined by the sprouting of new blood vessels from a pre-existing vessel network. Angiogenesis plays a key role not only in normal development of organs and tissues, but also in many diseases in which blood vessel formation is dysregulated, such as cancer, blindness and ischemic diseases. In adult life, blood vessels are generally quiescent so angiogenesis is an important target for novel drug development to try and regulate new vessel formation specifically in disease. In order to better understand angiogenesis and to develop appropriate strategies to regulate it, models are required that accurately reflect the different biological steps that are involved. The mouse neonatal retina provides an excellent model of angiogenesis because arteries, veins and capillaries develop to form a vascular plexus during the first week after birth. This model also has the advantage of having a two-dimensional (2D) structure making analysis straightforward compared with the complex 3D anatomy of other vascular networks. By analyzing the retinal vascular plexus at different times after birth, it is possible to observe the various stages of angiogenesis under the microscope. This article demonstrates a straightforward procedure for analyzing the vasculature of a mouse retina using fluorescent staining with isolectin and vascular specific antibodies.

Whole Mount Immunofluorescent Staining of the Neonatal Mouse Retina to Investigate Angiogenesis In vivo

The neonatal murine retina provides a well characterized physiological model of angiogenesis, which permits investigations of the roles of different genes or drugs that modulate angiogenesis in an in vivo context. Immunofluorescent staining to accurately visualize the vascular plexus is pivotal to the success of these types of studies.

Anjiyogenez Araştırma Yenidoğan Fare Retina Tüm Dağı Immunofluorescent Boyama<em&gt; In vivo</em

Angiogenesis  is the complex process of new blood vessel formation defined by the sprouting  of new blood vessels from a pre-existing vessel network. ...

Transsynaptic Tracing from Peripheral Targets with Pseudorabies Virus Followed by Cholera Toxin and Biotinylated Dextran Amines Double Labeling

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This approach has been most extensively used in the brain by utilizing the swine pathogen pseudorabies virus (PRV)1. PRV does not infect great apes, including humans, so it is most commonly used in studies on small mammals, especially rodents. The pseudorabies strain PRV152 expresses the enhanced green fluorescent protein (eGFP) reporter gene and only crosses functional synapses retrogradely through the hierarchical sequence of synaptic connections away from the infection site2,3. Other PRV strains have distinct microbiological properties and may be transported in both directions (PRV-Becker and PRV-Kaplan)4,5&#160;.&#160;This protocol will deal exclusively with PRV152. By delivering the virus at a peripheral site, such as muscle, it is possible to limit the entry of the virus into the brain through a specific set of neurons. The resulting pattern of eGFP signal throughout the brain then resolves the neurons that are connected to the initially infected cells. As the distributed nature of transsynaptic tracing with pseudorabies virus makes interpreting specific connections within an identified network difficult, we present a sensitive and reliable method employing biotinylated dextran amines (BDA) and cholera toxin subunit b (CTb) for confirming the connections between cells identified using PRV152. Immunochemical detection of BDA and CTb with peroxidase and DAB (3, 3&#39;-diaminobenzidine) was chosen because they are effective at revealing cellular processes including distal dendrites6-11.

Transsynaptic tracing has become a powerful tool for analyzing central efferents regulating peripheral targets through multi-synaptic circuits. Here we present a protocol that exploits the transsynaptic pseudorabies virus to identify and localize a functional brain circuit, followed by classical tract tracing techniques to validate specific connections in the circuit between identified groups of neurons.

Transsinaptik Kolera Toksin ve Biotinlenmiş Dekstran Aminler Çift Etiketleme Ardından Pseudorabies&#39;e Virüs ile Periferik Hedefler gelen İzleme

Transsynaptic tracing has become a powerful tool used to analyze central efferents that regulate peripheral targets through multi-synaptic circuits. This ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Embriyonik ön beyin gelen Endotel Hücreleri İzolasyon ve Kültürü

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow for an in-depth characterization to identify pathways involved in these events. Cerebellar granule neurons (CGNs) that are derived from the developing cerebellum are an ideal model system that allows for morphological analyses. Here, we describe a method of how to genetically manipulate CGNs and how to study axono- and dendritogenesis of individual neurons. With this method the effects of RNA interference, overexpression or small molecules can be compared to control neurons. In addition, the rodent cerebellar cortex is an easily accessible in vivo system owing to its predominant postnatal development. We also present an in vivo electroporation technique to genetically manipulate the developing cerebella and describe subsequent cerebellar analyses to assess neuronal morphology and migration.

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Neuronal morphogenesis and migration are crucial events underlying proper brain development. Here, we describe methods to genetically manipulate cultured cerebellar granule neurons and the developing cerebellum for the assessment of morphology and migratory characteristics of neurons.

Serebellar Granül Nöronlar Genetik Manipülasyon<em&gt; In Vitro</em&gt; Ve<em&gt; In Vivo</em&gt; Nöronal morfoloji ve Göç Eğitim için

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow ...

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this information to the brain. As such, determining how olfactory information is transferred to the brain, modifying both perception and behavior, merits investigation. Interestingly, there is emerging evidence that cellular transduction and transcriptional factors are involved in the diversification of olfactory receptor neuron. Here we provide a robust whole mount immunological labeling method to assay in vivo olfactory receptor neuron organization. Using this method, we identified all olfactory receptor neurons with anti-ELAV antibody, a known pan-neural marker and Or49a-mCD8::GFP, an olfactory receptor neuron specifically expressed in Nba neuron using anti-GFP antibody.

Whole Mount Immunolabeling of Olfactory Receptor Neurons in the Drosophila Antenna

Herein we describe the process of whole mount immunostaining of Drosophila antennae, which enables us to better understand the molecular mechanisms involved in the diversification of olfactory receptor neurons (ORN)s.

In Koku Reseptör Nöronlar Tüm Dağı ile immün<em&gt; Drosophila</em&gt; Anten

Odorant molecules bind to their target receptors in a precise and coordinated manner. Each receptor recognizes a specific signal and relays this ...

Live Imaging of Mitosis in the Developing Mouse Embryonic Cortex

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the developing cerebral cortex, abnormal mitosis of neural progenitors can cause defects in brain size and function. Hence, there is a critical need for tools to understand the mechanisms of neural progenitor mitosis. Cortical development in rodents is an outstanding model for studying this process. Neural progenitor mitosis is commonly examined in fixed brain sections. This protocol will describe in detail an approach for live imaging of mitosis in ex vivo embryonic brain slices. We will describe the critical steps for this procedure, which include: brain extraction, brain embedding, vibratome sectioning of brain slices, staining and culturing of slices, and time-lapse imaging. We will then demonstrate and describe in detail how to perform post-acquisition analysis of mitosis. We include representative results from this assay using the vital dye Syto11, transgenic mice (histone H2B-EGFP and centrin-EGFP), and in utero electroporation (mCherry-&#945;-tubulin). We will discuss how this procedure can be best optimized and how it can be modified for study of genetic regulation of mitosis. Live imaging of mitosis in brain slices is a flexible approach to assess the impact of age, anatomy, and genetic perturbation in a controlled environment, and to generate a large amount of data with high temporal and spatial resolution. Hence this protocol will complement existing tools for analysis of neural progenitor mitosis.

Neural progenitor mitosis is a critical parameter of neurogenesis. Much of our understanding of neural progenitor mitosis is based on analysis of fixed tissue. Live imaging in embryonic brain slices is a versatile technique to assess mitosis with high temporal and spatial resolution in a controlled environment.

Gelişmekte Fare Embriyonik Cortex mitoz Canlı Görüntüleme

Although of short duration, mitosis is a complex and dynamic multi-step process fundamental for development of organs including the brain. In the ...

Laser-guided Neuronal Tracing In Brain Explants

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake through electroporation in brain explants with targeted laser illumination and matching filter goggles during the procedure. The described technique of in vitro electroporation by itself yields relatively good visual control for targetting certain areas of the brain. By combining it with laser excitation of fluorescent genetic markers and their read-out through band-passing filter goggles, which can pick up the emissions of the genetically labeled cells/nuclei and the fluorescent tracing dye, a researcher can substantially increase the accuracy of injections by finding the area of interest and controlling for the dye-spread/uptake in the injection area much more efficiently. In addition, the laser illumination technique allows to study the functionality of a given neurocircuit by providing information about the type of neurons projecting to a certain area in cases where the GFP expression is linked to the type of transmitter expressed by a subpopulation of neurons.

We describe a technique to label neurons and their processes via anterograde or retrograde tracer injections into brain nuclei using an in vitro preparation. We modified an existing method of in vitro tracer electroporation by taking advantage of fluorescently labeled mouse mutants and basic optical equipment in order to increase labeling accuracy.

Lazer güdümlü Nöronal İzleme Beyin Eksplantlarındaki

We present a technique which combines an in vitro tracer injection protocol, which uses a series of electrical and pressure pulses to increase dye uptake ...