Name: use of bisection to reduce mitochondrial dna in the bovine oocyte
Uploaded: 2022-07-06T13:40:00
Description: Watch this Scientific Journal Video about Use of Bisection to Reduce Mitochondrial DNA in the Bovine Oocyte at JoVE.com

The authors wish to thank their colleagues at Utah State University, the Reproductive Science researchers at the San Diego Zoo, and Dr. Rebecca Krisher at Genus PLC.

The following protocol follows the animal care and ethics guidelines provided by Utah State University.
1. Media preparation
<ol>
	<li>Prior to oocyte handling, prepare the following solutions, as described in Table 1: 400 &#181;L of Hyaluronidase Solution, 500 &#181;L of T2 media, 1,020 &#181;L of T20 media, and 800 &#181;L of T10 media.</li>
	<li>Divide the T10 media into two wells of a four-well plate, 400 &#181;L per well. Label one well with &#34;M&#34;...

<ol>
	<li>Loi, P., Modlinski, J. A., Ptak, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecies+somatic+cell+nuclear+transfer:+A+salvage+tool+seeking+first+aid.">Interspecies somatic cell nuclear transfer: A salvage tool seeking first aid.</a> Theriogenology. 76 (2), 217-228 (2011).</li><li>Wani, N. A., Vettical, B. S., Hong, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+cloned+Bactrian+camel+(camelus+bactrianus)+calf+produced+by+interspecies+somatic+cell+nuclear+transfer:+A+step+towards+preserving+the+critically+endangered+wild+Bactrian+camels.">First cloned Bactrian camel (camelus bactrianus) calf produced by interspecies somatic cell nuclear transfer: A step towards preserving the critically endangered wild Bactrian camels.</a> PLOS ONE. 12 (5), 0177800 (2017).</li><li>Oh, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+endangered+gray+wolves+(canis+lupus)+from+somatic+cells+collected+postmortem.">Cloning endangered gray wolves (canis lupus) from somatic cells collected postmortem.</a> Theriogenology. 70 (4), 638-647 (2008).</li><li>Srirattana, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Full-term+development+of+gaur-bovine+interspecies+somatic+cell+nuclear+transfer+embryos:+Effect+of+trichostatin+a+treatment.">Full-term development of gaur-bovine interspecies somatic cell nuclear transfer embryos: Effect of trichostatin a treatment.</a> Cellular Reprogramming. 14 (3), 248-257 (2012).</li><li>Kwon, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blastocysts+derived+from+adult+fibroblasts+of+a+rhesus+monkey+(macaca+mulatta)+using+interspecies+somatic+cell+nuclear+transfer.">Blastocysts derived from adult fibroblasts of a rhesus monkey (macaca mulatta) using interspecies somatic cell nuclear transfer.</a> Zygote. 19 (3), 199-204 (2011).</li><li>Lee, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+cloned+sei+whale+(Balaenoptera+borealis)+embryos+by+interspecies+somatic+cell+nuclear+transfer+using+enucleated+pig+oocytes.">Production of cloned sei whale (Balaenoptera borealis) embryos by interspecies somatic cell nuclear transfer using enucleated pig oocytes.</a> Journal of Veterinary Science. 10 (4), 285 (2009).</li><li>Lorthongpanich, C., Laowtammathron, C., Chan, A. W., Kedutat-Cairns, M., Parnpai, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+interspecies+cloned+monkey+embryos+reconstructed+with+bovine+enucleated+oocytes.">Development of interspecies cloned monkey embryos reconstructed with bovine enucleated oocytes.</a> Journal of Reproduction and Development. 54 (5), 306-313 (2008).</li><li>Hong, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+transgenic+canine+embryos+using+interspecies+somatic+cell+nuclear+transfer.">Production of transgenic canine embryos using interspecies somatic cell nuclear transfer.</a> Zygote. 20 (1), 67-72 (2011).</li><li>Stewart, J. B., Chinnery, P. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+dynamics+of+mitochondrial+DNA+heteroplasmy:+Implications+for+human+health+and+disease.">The dynamics of mitochondrial DNA heteroplasmy: Implications for human health and disease.</a> Nature Reviews Genetics. 16 (9), 530-542 (2015).</li><li>Takeda, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+transmission+and+confounding+mitochondrial+influences+in+cloned+cattle+and+pigs.">Mitochondrial DNA transmission and confounding mitochondrial influences in cloned cattle and pigs.</a> Reproductive Medicine and Biology. 12 (2), 47-55 (2013).</li><li>Lanza, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+of+an+endangered+species+(Bos+Gaurus)+using+interspecies+nuclear+transfer.">Cloning of an endangered species (Bos Gaurus) using interspecies nuclear transfer.</a> Cloning. 2 (2), 79-90 (2000).</li><li>Evans, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+genotypes+in+nuclear+transfer-derived+cloned+sheep.">Mitochondrial DNA genotypes in nuclear transfer-derived cloned sheep.</a> Nature Genetics. 23 (1), 90-93 (1999).</li><li>Meirelles, F. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+replacement+of+the+mitochondrial+genotype+in+a+Bos+indicus+calf+reconstructed+by+nuclear+transfer+to+a+Bos+taurus+oocyte.">Complete replacement of the mitochondrial genotype in a Bos indicus calf reconstructed by nuclear transfer to a Bos taurus oocyte.</a> Genetics. 158 (1), 351-356 (2001).</li><li>Beyhan, Z., Iager, A. E., Cibelli, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecies+nuclear+transfer:+Implications+for+embryonic+stem+cell+biology.">Interspecies nuclear transfer: Implications for embryonic stem cell biology.</a> Cell Stem Cell. 1 (5), 502-512 (2007).</li><li>Lagutina, I., Fulka, H., Lazzari, G., Galli, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecies+somatic+cell+nuclear+transfer:+advancements+and+problems.">Interspecies somatic cell nuclear transfer: advancements and problems.</a> Cellular Reprogramming. 15 (5), 374-384 (2013).</li><li>Jiang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecies+somatic+cell+nuclear+transfer+is+dependent+on+compatible+mitochondrial+DNA+and+reprogramming+factors.">Interspecies somatic cell nuclear transfer is dependent on compatible mitochondrial DNA and reprogramming factors.</a> PLoS ONE. 6 (4), 14805 (2011).</li><li>Chiaratti, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryo+mitochondrial+DNA+depletion+is+reversed+during+early+embryogenesis+in+cattle.">Embryo mitochondrial DNA depletion is reversed during early embryogenesis in cattle.</a> Biology of Reproduction. 82 (1), 76-85 (2010).</li><li>Spikings, E. C., Alderson, J., John, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+mitochondrial+DNA+replication+during+oocyte+maturation+is+essential+for+successful+porcine+embryonic+development.">Regulated mitochondrial DNA replication during oocyte maturation is essential for successful porcine embryonic development.</a> Biology of Reproduction. 76 (2), 327-335 (2007).</li><li>Cagnone, G. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoration+of+normal+embryogenesis+by+mitochondrial+supplementation+in+pig+oocytes+exhibiting+mitochondrial+DNA+deficiency.">Restoration of normal embryogenesis by mitochondrial supplementation in pig oocytes exhibiting mitochondrial DNA deficiency.</a> Scientific Reports. 6 (1), 1-15 (2016).</li><li>Spikings, E. C., Alderson, J., John, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+mitochondrial+DNA+replication+during+oocyte+maturation+is+essential+for+successful+porcine+embryonic+development.">Regulated mitochondrial DNA replication during oocyte maturation is essential for successful porcine embryonic development.</a> Biology of Reproduction. 76 (2), 327-335 (2007).</li><li>Ferreira, A. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Does+supplementation+with+mitochondria+improve+oocyte+competence?+A+systematic+review.">Does supplementation with mitochondria improve oocyte competence? A systematic review.</a> Reproduction. 161 (3), 269-287 (2021).</li><li>Bhat, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+birth+of+a+pashmina+goat+kid+after+transfer+of+handmade+cloned+embryos.">Live birth of a pashmina goat kid after transfer of handmade cloned embryos.</a> Journal of Reproduction and Development. , (2019).</li><li>Tecirlioglu, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Birth+of+a+cloned+calf+derived+from+a+vitrified+hand-made+cloned+embryo.">Birth of a cloned calf derived from a vitrified hand-made cloned embryo.</a> Reproduction, Fertility and Development. 15 (7), 361 (2003).</li><li>Zhang, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Handmade+cloned+transgenic+piglets+expressing+the+nematode+fat-1+gene.">Handmade cloned transgenic piglets expressing the nematode fat-1 gene.</a> Cellular Reprogramming. 14 (3), 258-266 (2012).</li><li>Zhang, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Handmade+cloned+transgenic+sheep+rich+in+omega-3+fatty+acids.">Handmade cloned transgenic sheep rich in omega-3 fatty acids.</a> PLOS ONE. 8 (2), 55941 (2013).</li><li>Lagutina, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+cell+nuclear+transfer+in+horses:+Effect+of+oocyte+morphology,+embryo+reconstruction+method+and+donor+cell+type.">Somatic cell nuclear transfer in horses: Effect of oocyte morphology, embryo reconstruction method and donor cell type.</a> Reproduction. 130 (4), 559-567 (2005).</li><li>Chiaratti, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryo+mitochondrial+DNA+depletion+is+reversed+during+early+embryogenesis+in+cattle.">Embryo mitochondrial DNA depletion is reversed during early embryogenesis in cattle.</a> Biology of Reproduction. 82 (1), 76-85 (2010).</li><li>Hosseini, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=and+efficient+method+of+manual+oocyte+enucleation+using+a+pulled+pasteur+pipette.">and efficient method of manual oocyte enucleation using a pulled pasteur pipette.</a> In Vitro Cellular and Developmental Biology - Animal. 49 (8), 569-575 (2013).</li><li>Zampolla, T., Spikings, E., Rawson, D., Zhang, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoskeleton+proteins+F-actin+and+tubulin+distribution+and+interaction+with+mitochondria+in+the+granulosa+cells+surrounding+stage+III+zebrafish+(danio+rerio)+oocytes.">Cytoskeleton proteins F-actin and tubulin distribution and interaction with mitochondria in the granulosa cells surrounding stage III zebrafish (danio rerio) oocytes.</a> Theriogenology. 76 (6), 1110-1119 (2011).</li><li>International Union for Conservation of Nature. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+IUCN+Red+List+of+Threatened+Species.">The IUCN Red List of Threatened Species.</a> International Union for Conservation of Nature. , (2021).</li><li>Berg, D. K., Li, C., Asher, G., Wells, D. N., Oback, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Red+deer+cloned+from+antler+stem+cells+and+their+differentiated+progeny.">Red deer cloned from antler stem cells and their differentiated progeny.</a> Biology of Reproduction. 77 (3), 384-394 (2007).</li><li>G&#243;mez, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Birth+of+African+wildcat+cloned+kittens+born+from+domestic+cats.">Birth of African wildcat cloned kittens born from domestic cats.</a> Cloning and Stem Cells. 6 (3), 247-258 (2004).</li><li>Lanza, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+of+an+endangered+species+(Bos+gaurus)+using+interspecies+nuclear+transfer.">Cloning of an endangered species (Bos gaurus) using interspecies nuclear transfer.</a> Cloning. 2 (2), 79-90 (2000).</li></ol>

Methods previously used to decrease mtDNA copy numbers in oocytes have their respective disadvantages. Micromanipulation-based removal of mitochondria from oocytes decrease mtDNA copy numbers by an average of 64%27. A unique method, previously used for enucleation, involves the use of small diameter Pasteur pipettes and the splitting of a zona pellucida-free oocyte at the border between a microdrop of media and the surrounding mineral oil. Along with the utilization of oocyte centrifugation, this ...

Somatic cell nuclear transfer (SCNT) includes the fusion of an enucleated oocyte from one animal and a somatic cell from an animal of the same species. In most cases, the oocyte and somatic cell originate from the same species, and live birth rates are below 6%1. Some research involves the use of interspecies SCNT (iSCNT), which includes the fusion of a somatic cell and oocyte that originate from two different species. In these studies, live birth rates are even lower than in SCNT-typically less than 1%1. However, iSCNT has the capacity to be used as a method of rescuing endangered species, since somatic cells from these animals are more accessible than their germ cells1. Recipient oocytes used in iSCNT are often domestic or common laboratory species, such as cows, pigs, and mice. Some attempts made thus far have successfully produced live young, though the offspring produced have been intrageneric animals (the recipient oocyte species and donor cell species were members of the same genus)2,3,4. Intergeneric models (which utilize an oocyte and somatic cell from animals in different genera) have not yet produced live animals, and the majority of reconstructed embryos arrest at the 8-16 cell stage of in vitro development5,6,7,8. One possible explanation of this embryonic developmental arrest is the occurrence of mitochondrial heteroplasmy in the embryos-the presence of more than one mitochondria DNA (mtDNA) type in a single cell. Heteroplasmy can lead to issues such as developmental inefficiency or failure in the embryo or in the live animal1. Pathogenesis can also occur later in the animal&#39;s lifetime9. Though this issue is also present in SCNT offspring, the interspecific component within iSCNT embryos exacerbates the issue.
When the embryonic mtDNA comes from two different species, the recipient oocyte mitochondria, which represent the majority, do not work efficiently or effectively with the donor cell&#39;s nucleus1,10. Larger taxonomic gaps between the two species used in iSCNT likely intensifies this problem; intrageneric live offspring produced (Bos gaurus and Bos indicus offspring using Bos taurus oocytes), as well as offspring produced via traditional SCNT (e.g. Ovis aries offspring using Ovis aries oocytes) were shown to be chimeras (mtDNA from two individuals was present in these animals11,12,13). Yet, they developed much further than the intergeneric SCNT embryos14,15. The exchange of information between the oocyte mitochondria and the donor cell&#39;s nucleus could be more successful in the intrageneric embryo than in the intergeneric embryo16.
The amount of mtDNA in a mature bovine oocyte is approximately 100 times greater than the amount found in one somatic cell12. Reducing this ratio could encourage the somatic cell mitochondria to proliferate within the reconstructed embryo, allowing for a greater population of productive mitochondria to be present16. This could in turn provide more energy to meet the requirements of the developing embryo15. Previous attempts made to reduce the mtDNA copy number of the oocyte or embryo include chemical application, micromanipulation, and supplementing the oocyte or embryo with additional mitochondria from the donor cell species16,17,18,19,20. However, chemical application (such as 2&#39;,3&#39;-dideoxycytidine) is not ideal for embryonic development, and has reduced oocyte mtDNA copy numbers by approximately half18. Prior oocyte mtDNA reduction by micromanipulation have only removed an average of 64% of the oocyte&#39;s mtDNA17. Though the supplementation of donor cell mitochondria could be a viable option, its use has not yet produced a live intergeneric animal within iSCNT studies21.
The use of bisection to reduce oocyte mtDNA copy number has not yet been used in published studies. Bisecting oocytes with the intention of fusing the ooplasts with a somatic cell is the premise of handmade cloning (HMC), which typically utilizes bisection as method of removing the polar body and metaphase plate from the metaphase II (MII) oocyte. HMC has successfully produced offspring in several species, including goats, cattle, pigs, sheep, and horses22,23,24,25,26, but does not typically include a centrifugation step prior to bisection. Integrating high-speed centrifugation of the oocyte allows for the isolation of mitochondria (and therefore mtDNA) at one pole of the oocyte, which can then be bisected using a microblade to remove those mitochondria-dense fractions. Two mitochondria-depleted ooplasts can then be fused with a somatic cell, as is the case in HMC, to form a reconstructed embryo which contains considerably less mtDNA from the oocyte species.
The question we attempt to answer with this protocol is how to reduce mtDNA in the bovine oocyte in order to produce a viable reconstructed embryo that contains less heteroplasmic mtDNA. In this protocol, oocytes were centrifuged and bisected. Ooplast and intact oocyte mtDNA copy numbers were calculated to determine the effectiveness of this technique in reducing the bovine oocyte&#39;s mtDNA copy number.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1.5 mL centrifuge tubes</td>
			<td>Fisher Scientific</td>
			<td>5408129</td>
			<td></td>
		</tr>
		<tr>
			<td>60 mm dish</td>
			<td>Sigma-Aldrich</td>
			<td>D8054</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5424</td>
			<td></td>
		</tr>
		<tr>
			<td>Cytochalasin B</td>
			<td>Sigma-Aldrich</td>
			<td>C6762</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Sigma-Aldrich</td>
			<td>F2442</td>
			<td></td>
		</tr>
		<tr>
			<td>M199 Media</td>
			<td>Sigma-Aldrich</td>
			<td>M4530</td>
			<td></td>
		</tr>
		<tr>
			<td>Mineral Oil</td>
			<td>Sigma-Aldrich</td>
			<td>M8410</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini Centrifuge</td>
			<td>SCILOGEX</td>
			<td>D1008</td>
			<td></td>
		</tr>
		<tr>
			<td>mtDNA Primer: Forward (12S)</td>
			<td></td>
			<td></td>
			<td>GGGCTACATTCTCTACACCAAG</td>
		</tr>
		<tr>
			<td>mtDNA Primer: Reverse (12S)</td>
			<td></td>
			<td></td>
			<td>GTGCTTCATGGCCTAATTCAAC</td>
		</tr>
		<tr>
			<td>NanoDrop Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>ND2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Opthalmic Scalpel with Aluminum Handle</td>
			<td>PFM Medical</td>
			<td>207300633</td>
			<td>Microblade for bisection</td>
		</tr>
		<tr>
			<td>Protease/pronase</td>
			<td>Sigma-Aldrich</td>
			<td>P5147</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAamp DNA Micro Kit</td>
			<td>Qiagen</td>
			<td>56304</td>
			<td></td>
		</tr>
		<tr>
			<td>QuantStudio&#8482; 3 - 96-Well 0.2-mL</td>
			<td>ThermoFisher</td>
			<td>A28567</td>
			<td></td>
		</tr>
		<tr>
			<td>Search plate</td>
			<td>Fisher Scientific</td>
			<td>FB0875711A</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green qPCR Master Mix</td>
			<td>ThermoFisher</td>
			<td>K0221</td>
			<td>qPCR master mix</td>
		</tr>
		<tr>
			<td>Synthetic Oviductal Fluid with HEPES (HSOF)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ThermoPlate</td>
			<td>Tokai Hit</td>
			<td>TPi-SMZSSX</td>
			<td>Heating stage</td>
		</tr>
	</tbody>
</table>

use of bisection to reduce mitochondrial dna in the bovine oocyte

Interspecies somatic cell nuclear transfer (iSCNT) may be used to rescue endangered species, but two distinct populations of mitochondrial DNA (mtDNA) exist within the reconstructed embryo: one within the recipient ooplasm and one within the donor somatic cell. This mitochondrial heteroplasmy can lead to developmental issues in the embryo and the fetus. Handmade cloning protocols include oocyte bisection, which can be used to decrease the mtDNA copy number, reducing the degree of mitochondrial heteroplasmy in a reconstructed embryo. Centrifugation of denuded, mature bovine oocytes produced a visible mitochondria-dense fraction at one pole of the oocyte. Oocytes&#39; zonae pellucidae were removed by exposure to a pronase solution. Bisection was performed using a microblade to remove the visible mitochondria fraction. qPCR was used to quantify the mtDNA present in DNA samples extracted from whole oocytes and bisected ooplasts, providing a comparison of mtDNA copy numbers before and after bisection. Copy numbers were calculated using cycle threshold values, a standard curve&#39;s regression line formula, and a ratio that included the respective sizes of mtDNA PCR products and genomic PCR products. One bovine oocyte had an average mtDNA copy number (&#177; standard deviation) of 137,904 &#177; 94,768 (n = 38). One mitochondria-depleted ooplast had an average mtDNA copy number of 8,442 &#177; 13,806 (n = 33). Average mtDNA copies present in a mitochondria-rich ooplast were 79,390 &#177; 58,526 mtDNA copies (n = 28). The differences between these calculated averages indicate that the centrifugation and subsequent bisection can significantly decrease the mtDNA copy numbers present in the mitochondria-depleted ooplast when compared to the original oocyte (P &#60; 0.0001, determined by one-way ANOVA). The reduction in mtDNA should decrease the degree of mitochondrial heteroplasmy in a reconstructed embryo, possibly fostering standard embryonic and fetal development. Supplementation with mitochondrial extract from the somatic donor cell may also be essential to achieve successful embryonic development.

Quantitative PCR (qPCR) results are used to determine the relative quantities of mtDNA present in each ooplast. The described reaction is designed to amplify the 12S region of bovine mtDNA.
If the bisection was successful, the samples from whole oocytes and mitochondria-dense ooplasts will have similar Ct values. The samples from mitochondria-reduced ooplasts will have higher Ct values when compared to the samples from the other two groups. A Ct graph showing s...

Watch this Scientific Journal Video about Use of Bisection to Reduce Mitochondrial DNA in the Bovine Oocyte at JoVE.com

Use of Bisection to Reduce Mitochondrial DNA in the Bovine Oocyte

Here, we present a protocol to significantly reduce the mitochondrial DNA copy numbers in a bovine oocyte (P &lt; 0.0001). This method utilizes centrifugation and bisection to substantially reduce oocyte mitochondria and may allow for an increased chance of development in the reconstructed interspecies somatic cell nuclear transfer embryos.

Interspecies somatic cell nuclear transfer (iSCNT) may be used to rescue endangered species, but two distinct populations of mitochondrial DNA (mtDNA) ...

The protocol significantly reduces the mitochondrial DNA copy number in the oocyte. That might be beneficial for intraspecies cloning. This method reduces mitochondrial DNA copy numbers in bovine oocytes by over 90%which could reduce the incidence of mitochondrial heteroplasmy in cloned embryos.Laura Adams, a PhD student from my lab, will demonstrate the procedure. To begin, using a pipette, collect the selected mature oocytes from the HSOF drop, and place them into the 1.5 milliliter tube containing 50 microliters of the HSOF CB solution. Centrifuge the oocytes at 15, 000 times G for 12 minutes.While the oocytes are being centrifuged, prepare the bisection plate. For this, start by making a pattern on the lid of a 60 millimeter Petri dish using 20 microliters per drop, and fully cover the drops with mineral oil. Using a thin tipped marker, mark the lines underneath the dish.Cover the dish with an opaque lid until centrifugation is complete to prevent osmolarity changes of microdrops. As soon as centrifugation is complete, use a 200 microliter pipette to collect the oocytes within the solution, and move them into an empty portion of a new search plate with four, 400 microliter HSOF drops, before washing the oocytes through HSOF drops. Turn the heating stage on to 38.5 degrees Celsius.Use a mouth pipette to move the centrifuged oocytes from the HSOF drop to the top left T2 drop of the bisection plate. Then wash the oocytes through the next three drops on the top row. Deposit the oocytes in one of the pronase drops, assuring there is little to no contact between them.Observe the oocytes until there is clear deformation of the zonae pellucidae. Once a single oocyte zona pellucida has become deformed, move that oocyte to the neighboring T2 drop. Repeat as additional oocytes become deformed, until all oocytes have been removed from the pronase and placed in the T2 drop.Observe the oocytes until only a thin layer of the zona pellucida remains. Wash the oocytes through the next three drops within the row, then deposit them in vertical lines within the CBT20 drops. Begin with fewer oocytes in the vertical lines, and increase the number of oocytes per drop as bisection skills progress.Focus on the first, leftmost CBT20 drop that contains oocytes, and use a mouth pipette to rotate the oocytes so that the mitochondria-dense portion of each oocyte is either facing toward, or away from the microscope's arm. Rest the tip of the microblade to the left of the topmost oocyte, in line with the space directly above the mitochondria-dense portion. Keeping the tip of the blade in the same place, carefully lower the blade to cut all the way through the oocyte.Ensure that the mitochondria-dense ooplast and mitochondria-reduced ooplast are of the approximately same size, and the blade is bisecting in the clearest segment of the centrifuged oocyte. When lifting the blade, ensure that the same line is maintained, and that the tip of the blade remains in the same place, then gently lift the tip from the plate. Repeat bisection steps for all oocytes within the first bisection drop.If oocytes are present in additional drops, orient and bisect the remaining oocytes. Using a mouth pipette, collect mitochondria-reduced ooplasts from the first bisection drop. Place them in the left hand T20 drop located in the bottom row of the plate.Repeat for all remaining bisection drops. Using a mouth pipette, collect mitochondria dense ooplasts from the first bisection drop. Place them in the right hand T20 drop located in the bottom row of the plate.Repeat for all remaining bisection drops. Retrieve the T10 four-well dish from the incubator. Using a mouth pipette, move all mitochondria-reduced ooplasts to the well labeled MR, and move the mitochondria-dense ooplasts to the well labeled M.Place the four-well plate back into the carbon dioxide-controlled incubator.Allow ooplasts to rest for at least 30 minutes prior to quantification of mtDNA. For a successful bisection, the samples from whole oocytes and mitochondria-dense ooplasts have similar CT values. The samples from mitochondria-reduced ooplasts have higher CT values when compared to the samples from the other two groups.For an unsuccessful bisection, the bisection does not reduce the mtDNA content effectively in the mitochondria-reduced ooplasts. Following the production of a standard curve and the use of the provided mtDNA copy number formulas, an average oocyte mtDNA reduction of 93.88%has been achieved using this protocol. Correctly orienting each oocyte in the bisection drop, precisely bisecting each oocyte, and accurately sorting the ooplasts, are all critical steps to take in order to obtain successful results.Two ooplasts can be fused with one somatic cell. The fused triplets can then be chemically activated and cultured as reconstructed embryos.

use-of-bisection-to-reduce-mitochondrial-dna-in-the-bovine-oocyte

Research

JoVE Journal

Developmental Biology

Production and Use of Lentivirus to Selectively Transduce Primary Oligodendrocyte Precursor Cells for In Vitro Myelination Assays

Myelination is a complex process that involves both neurons and the myelin forming glial cells, oligodendrocytes in the central nervous system (CNS) and Schwann cells in the peripheral nervous system (PNS). We use an in vitro myelination assay, an established model for studying CNS myelination in vitro. To do this, oligodendrocyte precursor cells (OPCs) are added to the purified primary rodent dorsal root ganglion (DRG) neurons to form myelinating co-cultures. In order to specifically interrogate the roles that particular proteins expressed by oligodendrocytes exert upon myelination we have developed protocols that selectively transduce OPCs using the lentivirus overexpressing wild type, constitutively active or dominant negative proteins before being seeded onto the DRG neurons. This allows us to specifically interrogate the roles of these oligodendroglial proteins in regulating myelination. The protocols can also be applied in the study of other cell types, thus providing an approach that allows selective manipulation of proteins expressed by a desired cell type, such as oligodendrocytes for the targeted study of signaling and compensation mechanisms. In conclusion, combining the in vitro myelination assay with lentiviral infected OPCs provides a strategic tool for the analysis of molecular mechanisms involved in myelination.

Production and Use of Lentivirus to Selectively Transduce Primary Oligodendrocyte Precursor Cells for In Vitro Myelination Assays

Here we present protocols that offer a flexible and strategic foundation for virally manipulating oligodendrocyte precursor cells to overexpress proteins of interest in order to specifically interrogate their role in oligodendrocytes via the in vitro model of central nervous system myelination.

Myelination is a complex process that involves both neurons and the myelin forming glial cells, oligodendrocytes in the central nervous system (CNS) and ...

Use of the TetON System to Study Molecular Mechanisms of Zebrafish Regeneration

The zebrafish has become a very important model organism for studying vertebrate development, physiology, disease, and tissue regeneration. A thorough understanding of the molecular and cellular mechanisms involved requires experimental tools that allow for inducible, tissue-specific manipulation of gene expression or signaling pathways. Therefore, we and others have recently adapted the TetON system for use in zebrafish. The TetON system facilitates temporally and spatially-controlled gene expression and we have recently used this tool to probe for tissue-specific functions of Wnt/beta&#8211;catenin signaling during zebrafish tail fin regeneration. Here we describe the workflow for using the TetON system to achieve inducible, tissue-specific gene expression in the adult regenerating zebrafish tail fin. This includes the generation of stable transgenic TetActivator and TetResponder lines, transgene induction and techniques for verification of tissue-specific gene expression in the fin regenerate. Thus, this protocol serves as blueprint for setting up a functional TetON system in zebrafish and its subsequent use, in particular for studying fin regeneration.

Here we outline the workflow for using the TetON system to achieve tissue-specific gene expression in the adult regenerating zebrafish tail fin.

The zebrafish has become a very important model organism for studying vertebrate development, physiology, disease, and tissue regeneration. A thorough ...

Functional Cloning Using a Xenopus Oocyte Expression System

Identification of genes responsible for embryonic induction poses a number of challenges; to name a few, secreted molecules of interest may be low in abundance, may not be secreted but tethered to the signaling cell(s), or may require the presence of binding partners or upstream regulatory molecules. Thus in a search for gene products capable of eliciting an early lens-inductive response in competent ectoderm, we utilized an expression cloning system that would allow identification of paracrine or juxtacrine factors as well as transcriptional or other regulatory proteins. Pools of mRNA were injected into Xenopus oocytes, and responding tissue placed directly on the oocytes and co-cultured. Following functional cloning of ldb1 from a neural plate stage cDNA library based on its ability to elicit the expression of the early lens placode marker foxe3 in lens-competent animal cap ectoderm, we characterized the mRNA expression pattern, and assayed developmental progression following overexpression or knockdown of ldb1. This system is suitable in a very wide variety of contexts where identification of an inducer or its upstream regulatory molecules is sought using a functional response in competent tissue.

Functional Cloning Using a Xenopus Oocyte Expression System

We describe a Xenopus oocyte and animal cap system for the expression cloning of genes capable of inducing a response in competent ectoderm, and discuss techniques for the subsequent analysis of such genes. This system is useful in the functional identification of a wide range of gene products.

Identification of genes responsible for embryonic induction poses a number of challenges; to name a few, secreted molecules of interest may be low in ...

Technique to Target Microinjection to the Developing Xenopus Kidney

The embryonic kidney of Xenopus&#160;laevis (frog), the pronephros, consists of a single nephron, and can be used as a model for kidney disease. Xenopus embryos are large, develop externally, and can be easily manipulated by microinjection or surgical procedures. In addition, fate maps have been established for early Xenopus embryos. Targeted microinjection into the individual blastomere that will eventually give rise to an organ or tissue of interest can be used to selectively overexpress or knock down gene expression within this restricted region, decreasing secondary effects in the rest of the developing embryo. In this protocol, we describe how to utilize established Xenopus fate maps to target the developing Xenopus kidney (the pronephros), through microinjection into specific blastomere of 4- and 8-cell embryos. Injection of lineage tracers allows verification of the specific targeting of the injection. After embryos have developed to stage 38 - 40, whole-mount immunostaining is used to visualize pronephric development, and the contribution by targeted cells to the pronephros can be assessed. The same technique can be adapted to target other tissue types in addition to the pronephros.

Technique to Target Microinjection to the Developing Xenopus Kidney

Here, we present a protocol to use fate maps and lineage tracers to target injections into individual blastomeres that give rise to the kidney of Xenopus laevis embryos.

The embryonic kidney of Xenopus&#160;laevis (frog), the pronephros, consists of a single nephron, and can be used as a model for kidney disease. Xenopus ...

Functional Manipulation of Maternal Gene Products Using In Vitro Oocyte Maturation in Zebrafish

Cellular events that take place during the earliest stages of animal embryonic development are driven by maternally derived gene products deposited into the developing oocyte. Because these events rely on maternal products which typically act very soon after fertilization-that preexist inside the egg, standard approaches for expression and functional reduction involving the injection of reagents into the fertilized egg are typically ineffective. Instead, such manipulations must be performed during oogenesis, prior to or during the accumulation of maternal products. This article describes in detail a protocol for the in vitro maturation of immature zebrafish oocytes and their subsequent in vitro fertilization, yielding viable embryos that survive to adulthood. This method allows the functional manipulation of maternal products during oogenesis, such as the expression of products for phenotypic rescue and tagged construct visualization, as well as the reduction of gene function through reverse-genetics agents.

Functional Manipulation of Maternal Gene Products Using In Vitro Oocyte Maturation in Zebrafish

An optimized protocol for the in vitro maturation of zebrafish oocytes used for the manipulation of maternal gene products is presented here.

Cellular events that take place during the earliest stages of animal embryonic development are driven by maternally derived gene products deposited into ...

A 5-mC Dot Blot Assay Quantifying the DNA Methylation Level of Chondrocyte Dedifferentiation In Vitro

The dedifferentiation of hyaline chondrocytes into fibroblastic chondrocytes often accompanies monolayer expansion of chondrocytes in vitro. The global DNA methylation level of chondrocytes is considered to be a suitable biomarker for the loss of the chondrocyte phenotype. However, results based on different experimental methods can be inconsistent. Therefore, it is important to establish a precise, simple, and rapid method to quantify global DNA methylation levels during chondrocyte dedifferentiation.
Current genome-wide methylation analysis techniques largely rely on bisulfite genomic sequencing. Due to DNA degradation during bisulfite conversion, these methods typically require a large sample volume. Other methods used to quantify global DNA methylation levels include high-performance liquid chromatography (HPLC). However, HPLC requires complete digestion of genomic DNA. Additionally, the prohibitively high cost of HPLC instruments limits HPLC&#39;s wider application.
In this study, genomic DNA (gDNA) was extracted from human chondrocytes cultured with varying number of passages. The gDNA methylation level was detected using a methylation-specific dot blot assay. In this dot blot approach, a gDNA mixture containing the methylated DNA to be detected was spotted directly onto an N+ membrane as a dot inside a previously drawn circular template pattern. Compared with other gel electrophoresis-based blotting approaches and other complex blotting procedures, the dot blot method saves significant time. In addition, dot blots can detect overall DNA methylation level using a commercially available 5-mC antibody. We found that the DNA methylation level differed between the monolayer subcultures, and therefore could play a key role in chondrocyte dedifferentiation. The 5-mC dot blot is a reliable, simple, and rapid method to detect the general DNA methylation level to evaluate chondrocyte phenotype.

A 5-mC Dot Blot Assay Quantifying the DNA Methylation Level of Chondrocyte Dedifferentiation In Vitro

We present a method to quantify DNA methylation based on the 5-methylcytosine (5-mC) dot blot. We determined the 5-mC levels during chondrocyte dedifferentiation. This simple technique could be used to quickly determine the chondrocyte phenotype in ACI treatment.

The dedifferentiation of hyaline chondrocytes into fibroblastic chondrocytes often accompanies monolayer expansion of chondrocytes in vitro. The global ...

Use of Immunolabeling to Analyze Stable, Dynamic, and Nascent Microtubules in the Zebrafish Embryo

Microtubules (MTs) are dynamic and fragile structures that are challenging to image in vivo, particularly in vertebrate embryos. Immunolabeling methods are described here to analyze distinct populations of MTs in the developing neural tube of the zebrafish embryo. While the focus is on neural tissue, this methodology is broadly applicable to other tissues. The procedures are optimized for early to mid-somitogenesis-stage embryos (1 somite to 12 somites), however they can be adapted to a range of other stages with relatively minor adjustments. The first protocol provides a method to assess the spatial distribution of stable and dynamic MTs and perform a quantitative analysis of these populations with image-processing software. This approach complements existing tools to image microtubule dynamics and distribution in real-time, using transgenic lines or transient expression of tagged constructs. Indeed, such tools are very useful, however they do not readily distinguish between dynamic and stable MTs. The ability to image and analyze these distinct microtubule populations has important implications for understanding mechanisms underlying cell polarization and morphogenesis. The second protocol outlines a technique to analyze nascent MTs specifically. This is accomplished by capturing the de novo growth properties of MTs over time, following microtubule depolymerization with the drug nocodazole and a recovery period after drug washout. This technique has not yet been applied to the study of MTs in zebrafish embryos, but is a valuable assay for investigating the in vivo function of proteins implicated in microtubule assembly.

Immunolabeling methods to analyze distinct populations of microtubules in the developing zebrafish brain are described here, which are broadly applicable to other tissues. The first protocol outlines an optimized method for immunolabeling stable and dynamic microtubules. The second protocol provides a method to image and quantify nascent microtubules specifically.

Microtubules (MTs) are dynamic and fragile structures that are challenging to image in vivo, particularly in vertebrate embryos. Immunolabeling methods ...

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the proteins involved in these pathways are evolutionarily conserved between mammals and other eukaryotes, such as the fruit fly Drosophila melanogaster, suggesting that similar organizing principles exist during the development of these organisms. Importantly, Drosophila has been used extensively to identify cellular and molecular mechanisms regulating processes that are required in mammals including neurogenesis, differentiation, axonal guidance, and synaptogenesis. Flies have also been used successfully to model a variety of human neurodevelopmental diseases. Here we describe a protocol for the step-by-step microdissection, fixation, and immunofluorescent localization of proteins within the adult Drosophila brain. This protocol focuses on two example neuronal populations, mushroom body neurons and retinal photoreceptors, and includes optional steps to trace individual mushroom body neurons using Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. Example data from both wild-type and mutant brains are shown along with a brief description of a scoring criteria for axonal guidance defects. While this protocol highlights two well-established antibodies for investigating the morphology of mushroom body and photoreceptor neurons, other Drosophila brain regions and the localization of proteins within other brain regions can also be investigated using this protocol.

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

This protocol describes the dissection and immunostaining of adult Drosophila melanogaster brain tissues. Specifically, this protocol highlights the use of Drosophila mushroom body and photoreceptor neurons as example neuronal subsets that can be accurately used to uncover general principles underlying many aspects of neuronal development.

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the ...

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain and protect cellular identities. The conversion of germ cells into specific neurons in the nematode Caenorhabditis elegans (C. elegans) is a powerful tool for performing genetic screens in order to dissect regulatory pathways that safeguard established cell identities. Reprogramming of germ cells to a specific type of neurons termed ASE requires transgenic animals that allow broad over-expression of the Zn-finger transcription factor (TF) CHE-1. Endogenous CHE-1 is expressed exclusively in two head neurons and is required to specify the glutamatergic ASE neurons fate, which can easily be visualized by the gcy-5prom::gfp reporter. A trans gene containing the heat-shock promoter-driven che-1 gene expression construct allows broad mis-expression of CHE-1 in the entire animal upon heat-shock treatment. The combination of RNAi against the chromatin-regulating factor LIN-53 and heat-shock-induced che-1 over-expression leads to reprogramming of germ cell into ASE neuron-like cells. We describe here the specific RNAi procedure and appropriate conditions for heat-shock treatment of transgenic animals in order to successfully induce germ cell to neuron conversion.

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

This protocol describes how to study cellular processes during cell fate conversion in Caenorhabditis elegans in vivo. Using transgenic animals, allowing heat-shock promoter-driven overexpression of the neuron fate-inducing transcription factor CHE-1 and RNAi-mediated depletion of the chromatin-regulating factor LIN-53 germ cell to neuron reprogramming can be observed in vivo.

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain ...

Use of Hematopoietic Stem Cell Transplantation to Assess the Origin of Myelodysplastic Syndrome

Myelodysplastic syndromes (MDS) are a diverse group of hematopoietic stem cell disorders that are defined by ineffective hematopoiesis, peripheral blood cytopenias, dysplasia, and a propensity for transformation to acute leukemia. NUP98-HOXD13 (NHD13) transgenic mice recapitulate human MDS in terms of peripheral blood cytopenias, dysplasia, and transformation to acute leukemia. We previously demonstrated that MDS could be transferred from a genetically engineered mouse with MDS to wild-type recipients by transplanting MDS bone marrow nucleated cells (BMNC). To more clearly understand the MDS cell of origin, we have developed approaches to transplant specific, immunophenotypically defined hematopoietic subsets. In this article, we describe the process of isolating and transplanting specific populations of hematopoietic stem and progenitor cells. Following transplantation, we describe approaches to assess the efficiency of transplantation and persistence of the donor MDS cells.

We describe the use of hematopoietic stem cell transplantation (HSCT) to assess the malignant potential of genetically engineered hematopoietic cells. HSCT is useful for evaluating various malignant hematopoietic cells in vivo as well as generating a large cohort of mice with myelodysplastic syndromes (MDS) or leukemia to evaluate novel therapies.

Myelodysplastic syndromes (MDS) are a diverse group of hematopoietic stem cell disorders that are defined by ineffective hematopoiesis, peripheral blood ...