Production and Optimization of LTE, a Leishmania tarentolae Derived Cell-Free Protein Expression System for Recombinant Protein Production

Summary

Leishmania Translational Extract (LTE) is a eukaryotic cell-free protein expression system derived from the single-celled parasite, Leishmania tarentolae. This optimized protocol makes LTE simple and cost-effective to manufacture. It is suitable for various applications focused on the multiparallel expression and study of complex eukaryotic proteins and their interactions.

Abstract

This protocol outlines the production and optimization of a eukaryotic Cell-Free Protein Expression System (CFPS) derived from the unicellular flagellate Leishmania tarentolae, referred to as Leishmania Translational Extract or LTE. Although this organism originally evolved as a parasite of geckos, it can be cultivated easily and inexpensively in flasks or bioreactors. Unlike Leishmania major, it is non-pathogenic to humans and does not require special laboratory precautions. Another advantage of using Leishmania for CFPS is that the addition of a single antisense oligonucleotide to the CFPS, targeting a conserved splice leader sequence on the 5'-end of all protein-coding RNAs, can suppress endogenous protein expression. We provide procedures for cell disruption and lysate processing, which have been simplified and improved compared to previous versions. These procedures start with simple flask cultures. Additionally, we explain how to introduce genetic information using vectors containing species-independent translation initiation sites (SITS) and how to perform straightforward batch optimization and quality control to ensure consistent protein expression quality.

Introduction

In the 1960s, cell-free protein expression systems played a pivotal role in uncovering the genetic code¹. However, prokaryotic cell-free protein expression systems, mainly based on E. coli, currently dominate both laboratory and commercial applications. While E. coli-based systems offer advantages such as cost-effectiveness, scalability, and high expression yields, they face challenges when producing multi-domain proteins in their active forms and facilitating the assembly of protein complexes^2,3. In the present day, commonly used forms of eukaryotic Cell-Free Protein ....

Protocol

This protocol includes detailed media recipes and steps that involve culturing, centrifuging, measuring GFP fluorescence using a multimode platereader, measuring culture OD_600nm, and assessing lysate Abs_280nm. It also covers the setup and imaging of SDS-PAGE protein gels. The materials required or suggested for this protocol are listed in the Materials spreadsheet. It's important to note that typical laboratory resources such as media components, centrifuges, tubes, spectrophotometers, and gel e.......

Discussion

Protocols for creating LTE have been published over the past decade⁷ and have undergone periodic updates^25,34. However, newcomers to the technique often encounter a steep learning curve, resulting in delays in achieving high-quality and high-yield protein expression. Similar challenges have been reported by other research groups working with LTE³⁵, particularly concerning significant batch-to-batch variations. The v.......

Materials

Name	Company	Catalog Number	Comments
PD-10 SuperDex 25 Columns	Cytiva	17085101	Gel filtration columns
Nitrogen Cavitation cell disrupter	Parr Industries	4635 or 4639	Cell Disrupter
Bovine derived Hemin	Sigma-Aldrich	H5533	Culture additive
Penicillin/Streptomycin 10000U/ml	Thermo-Fisher	15140122	Antibiotic mix
Optiplate 384	Perkin-Elmer	6007290	Multiwell plate for 10ul expressions
Oligonucleotide	IDT synthesis		Oligo with sequence CAATAAAGTACAGAAACTGATAC TTATATAGCGTT
Creatine Phosphokinase	Sigma-Aldrich	9001-15-4	Enzyme
Tecan Spark	Tecan		or similar Multimode Platereader
Chemidoc MP Imager	Biorad		or similar SDS-PAGE gel Imager
4-12% Bis-Tris Gels	Invitrogen	NW04125	SDS-PAGE gels
Biophotometer	Eppendorf		or similar Cuvette Specrophotometer
Nanodrop One	Thermofisher		Nanodrop spectrophotometer
Avanti JXN-26 centrifuge	Beckman Coulter		or similar centrifuge, with rotors/tubes rated 10K and 50K g
5424R microcentrifuge	Eppendorf		or similar microcentrifuge, with 1.5ml microcentrifuge tubes
Flask Incubator Inova S44i	Eppendorf		or similar flask incubator shaker suitable for 5L Flasks
5L glass culture flasks			Baffled glass flasks for culture growth
Bactotryptone	BD	211705	Growth medium
Yeast Extract	Merck	VM930053	Growth medium
Glycerol			Any analytical grade
Glucose			Any analytical grade
KH2PO4			Any analytical grade
K2HPO4			Any analytical grade
UltraPure water	Invitrogen	10977-015	Or output from any MilliQ-type water dispenser