Name: quantitative pcr of t7 bacteriophage from biopanning
Uploaded: 2018-09-27T14:00:00.000+00:00
Duration: 5 min 42 s
Description: Watch this Scientific Journal Video about Quantitative PCR of T7 Bacteriophage from Biopanning at JoVE.com

This work was supported by PhRMA Foundation Research Starter Grant and the National Heart, Lung, and Blood Institute of the National Institutes of Health grant under award number R01HL138251.

1. Primer Design and Analysis for T7 Phage Genomic DNA
<ol>
	<li>Design primers for amplification of T7 phage genomic DNA. 
	NOTE: F (forward) and R (reverse) primers (see Table of Materials) amplify the T7 DNA sequence located upstream of the library variable region (Figure 1).</li>
	<li>Choose an appropriate primer analyzer to evaluate parameters of the primers, including melting temperature (Tm), percent GC content (GC%), primer dimers, hairpin formation and PCR suitability (Figure 1).</li>
	<li>Order the primer oligonucleotides (oligos), and upon arrival, resuspend the lyophilized oligos in DNase and RNase free ultra-pure water to make 100 &#181;M stock concentrations in a 1.5 mL centrifuge tube, and store at -20 &#176;C for several months.</li>
	<li>Make several aliquots (around 50 &#181;L in each 1.5 mL tube) of the 100 &#181;M primer stock. 
	NOTE: This step is used to prevent frequent freeze-thaw cycles.</li>
</ol>
2. Prepare Standards for Quantification of T7 Phage Genomic DNA
<ol>
	<li>Serially dilute 0.1 &#181;g/&#181;L (1.0 x 108 fg/&#181;L) reference T7 phage DNA (purchased; at a known concentration of 0.1 &#181;g/&#181;L, see materials) 10-fold from 1.0 x 106 to 1.0 x 100 fg/&#181;L with ultra-pure H2O in 0.2 mL PCR tubes. Prepare each concentration in a total volume of 20 &#181;L (Figure 2).</li>
	<li>Vortex the PCR tubes to ensure thorough mixing at each step of dilution. Also, change tips when adding the DNA sample to the following dilution. 
	NOTE: It is recommended to prepare new solution of DNA standards for a standard curve for every batch of the qPCR experiment.</li>
	<li>Use the equation 1 (below) to convert for T7 phage reference DNA concentrations from fg/&#181;L to genome copies (gc) /&#181;L (Figure 2).</li>
	<li>T7 phage DNA concentration in gc/&#181;L= 
	<img alt="Equation 1" src="/files/ftp_upload/58165/58165eq1.jpg" /> (1) 
	NOTE: bp: base pair; reference T7 genomic DNA is 37314 bp.</li>
</ol>
3. Pre-treatment of Phage Samples Before qPCR Reaction Preparation
<ol>
	<li>(Option 1) Pipet 20 &#181;L of one T7 clone (phage) selected from biopanning against in vitro cystic fibrosis (CF)-like mucus model into 1.5 mL centrifuge tubes. Add 1.25 units of DNase I (0.5 &#181;L) to each 20 &#181;L sample. 
	NOTE: T7 phage cysteine constrained heptapeptide library (CX7C) was biopanned against CF-like mucus coated on 24-well membrane inserts (see Table of Materials) for 15 min. Further details are provided in the results section. One T7 clone was chosen for qPCR sample preparation from the eluate.
	<ol>
		<li>Option 2: Pipet 200 &#181;L of the T7 clone into a 1.5 mL tubes, and add 5 units of DNase I 
		(2 &#181;L) to each sample. 
		NOTE: The volume of phage sample selected at this step depends on the collected volume from biopanning. While the focus of the protocol is on the qPCR of biopanned phage, the steps for biopanning are detailed in the user protocol of the T7 phage kit (see Table of Materials)13.</li>
	</ol>
	</li>
	<li>Cap the T7 phage sample tubes (step 3.1) and incubate them at 37 &#176;C for 10 min in a heated dry bath (i.e., heat block).</li>
	<li>Incubate tubes (from step 3.2) at 100 &#176;C for 15 min in a heated dry bath (Figure 3A). 
	CAUTION: Since evaporation and condensation occur during the heating step, make sure that the 1.5 mL centrifuge tubes are capped completely.</li>
	<li>Spin the heat-treated phages from step 3.3 at 18,534 x g for 10 s. Mix the phages by placing the tube on a vortex mixer set at touch-activation mode for 10 s, and spin at 18,534 x g for 10 s again. 
	NOTE: The spin-mix-spin cycle is to make sure the heated phage samples are well mixed.</li>
	<li>Cool down the sample tubes at room temperature (RT) by leaving them on the experiment bench or store at 4 &#176;C in a refrigerator overnight. 
	NOTE: Experiment can be paused at this step.</li>
</ol>
4. Prepare qPCR Reactions
NOTE: One PCR reaction is for one sample. Each PCR reaction contains 5 &#181;L of qPCR master mix (see materials), 1 &#181;L of 5 &#181;M primer pair mix, 2 &#181;L of H2O and 2 &#181;L of heat-treated T7 phage sample. For multiple PCR reactions, all the reagents except phage sample are premixed in one 1.5 mL tube. The volume of each reagent in the premix depends on the number of phage samples for qPCR.
<ol>
	<li>Prepare the qPCR premix for 10 biopanned phage samples of unknown concentration and 7 samples of standard concentrations in triplicate. As a result, there are 51 total samples and therefore, 51 qPCR reactions (i.e., one reaction per sample). For 51 reactions, prepare a premix of 255 &#181;L of qPCR master mix (51x 5 &#181;L), 51 &#181;L of primers (51x 1 &#181;L), and 102 &#181;L of H2O (51x 2 &#181;L). 
	NOTE: It is recommended to prepare a few extra PCR reactions to compensate for the volume loss during aliquoting the PCR mix into each well of the 96-well qPCR plate.</li>
	<li>Aliquot 8 &#181;L of PCR premix into each well of 96-well qPCR plate for a total of 51 wells (i.e., 51 qPCR reactions). There is no need to change tips during aliquoting.</li>
	<li>Add 2 &#181;L of heat-treated T7 phage samples (step 3.4) or T7 phage reference DNA (Step 2.1) to each well (Figure 3B); change tips when adding different DNA samples to the well to prevent cross-contamination. Also, dispense the 2 &#181;L DNA samples underneath the surface of the qPCR premix (i.e., into the 8 &#181;L PCR premix).</li>
	<li>Seal the qPCR plate with adhesive film. 
	NOTE: This step is critical, regardless of the type of qPCR plate. Use the recommended kit to seal the plate completely; otherwise, any non-sealed region in the plate will cause volume loss during PCR cycling.</li>
	<li>Wrap the qPCR plate with aluminum foil to minimize fluorescence photobleaching and proceed to run it on the qPCR equipment.</li>
</ol>
5. qPCR Cycling Conditions
NOTE: qPCR cycling conditions were set up on the specific qPCR equipment (see Table of Materials).
<ol>
	<li>Run the 96-well qPCR plate on the qPCR equipment. On the equipment, select settings from the menu to set up the following experimental conditions (Figure 3C).</li>
	<li>Set up cycling conditions as follows for a sample volume of 10 &#181;L: one cycle at 50 &#176;C for 2 min, one cycle at 95 &#176;C for 2 min, followed by 40 cycles of (95 &#176;C for 15 s, 60 &#176;C for 1 min). After, run the melt curve settings: one cycle of 95 &#176;C for 15 s, 60 &#176;C for 1 min, and 95 &#176;C 15 s.</li>
	<li>Proceed to analyze the data as described in step 6.</li>
</ol>
6. Analyze the qPCR Raw Data and Convert from qPCR Ct Value to gc/&#181;L for T7 Bacteriophages
<ol>
	<li>Analyze the raw qPCR data and evaluate data quality by analyzing the characteristic plots of the raw data (Figure 4). 
	NOTE: Amplification plot, multicomponent plot and melt curve plot are the key characteristic plots to validate the data quality of qPCR.</li>
	<li>Calculate the mean threshold cycle (Ct) values from the triplicate samples at each concentration of the standard curve (step 2.1).
	<ol>
		<li>Plot mean Ct (Y) against log (gc/&#181;L) (X) to get the linear curve Y = kX + b (k is the slope of the linear curve, b is the intercept).</li>
		<li>Calculate the linear coefficient14 R2 (R2 must be &#62;0.99).</li>
	</ol>
	</li>
	<li>Use the standard curve Y = kX + b to calculate the number of T7 phages in the biopanning samples (i.e., phages selected against CF-like mucus) in gc/&#181;L (Figure 5). 
	NOTE: k is the slope of the standard curve.</li>
	<li>Calculate the amplification efficiency by the following equation 
	<img alt="Equation 2" src="/files/ftp_upload/58165/58165eq2.jpg" />&#160;(2) 
	NOTE: k is the slope of the standard curve generated from reference DNA qPCR. The ideal range of amplification efficiency is 90&#8211;110% .</li>
</ol>

<ol>
	<li>Smith, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Filamentous+fusion+phage:+novel+expression+vectors+that+display+cloned+antigens+on+the+virion+surface.">Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface.</a> Science. 228 (4705), 1315-1317 (1985).</li><li>Smith, G. P., Petrenko, V. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phage+Display.">Phage Display.</a> Chemical Reviews. 97 (96), 391-410 (1997).</li><li>Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Display+technologies:+Application+for+the+discovery+of+drug+and+gene+delivery+agents.">Display technologies: Application for the discovery of drug and gene delivery agents.</a> Advanced Drug Delivery Reviews. 58 (15), 1622-1654 (2006).</li><li>Dias-Neto, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+phage+display:+Integrating+and+comparing+available+molecular+tools+to+enable+costeffective+high-throughput+analysis.">Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis.</a> PLoS ONE. 4 (12), 1-11 (2009).</li><li>Peng, X., Nguyen, A., Ghosh, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+M13+and+T7+bacteriophages+by+TaqMan+and+SYBR+green+qPCR.">Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR.</a> Journal of Virological Methods. 252 (June 2017), 100-107 (2017).</li><li>Khan, M. S., Pande, T., Mvan de Ven, T. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Qualitative+and+quantitative+detection+of+T7+bacteriophages+using+paper+based+sandwich+ELISA.">Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA.</a> Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).</li><li>Brasino, M., Lee, J. H., Cha, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+highly+amplified+enzyme-linked+immunosorbent+assay+signals+from+genetically+engineered+bacteriophage.">Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage.</a> Analytical Biochemistry. 470, 7-13 (2014).</li><li>Yu, X., Burgoon, M., Shearer, A., Gilden, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+phage+peptide+interaction+with+antibody+using+phage+mediated+immuno-PCR.">Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR.</a> J immunol Methods. 326 (1-2), 33-40 (2007).</li><li>Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminm&#228;ki, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homogenous+M13+bacteriophage+quantification+assay+using+switchable+lanthanide+fluorescence+probes.">Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes.</a> BioTechniques. 53 (5), 301-303 (2012).</li><li>Schlaman, H. R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+of+signaling+proteins+with+phage-displayed+ligands+by+fluorescence+correlation+spectroscopy.">Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy.</a> Journal of Biomolecular Screening. 13 (8), 766-776 (2008).</li><li>Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+enumeration+of+phage+in+monodisperse+emulsions.">Rapid enumeration of phage in monodisperse emulsions.</a> Analytical Chemistry. 86 (12), 5642-5648 (2014).</li><li>Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+and+quantitation+of+bacteriophage+M13+using+desalting+spin+columns+and+digital+PCR.">Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR.</a> Journal of Virological Methods. 185 (1), 171-174 (2012).</li><li>. T7Select&#174; Biopanning Kit Available from: <a target="_blank" href="https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit">https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit</a> (2018)</li><li>Schneider, A., Hommel, G., Blettner, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Linear+Regression+Analysis.">Linear Regression Analysis.</a> Deutsches &#196;rzteblatt international. 107 (44), 776-782 (2010).</li><li>Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+MIQE+Guidelines:+Minimun+information+for+publication+of+quantitative+real-time+PCR+experiments.">The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments.</a> Clinical Chemitry. 55 (4), 611-622 (2009).</li><li>Lock, M., Alvira, M. R., Chen, S. -. J., Wilson, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+Determination+of+Single-Stranded+and+Self-Complementary+Adeno-Associated+Viral+Vector+Genome+Titers+by+Droplet+Digital+PCR.">Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR.</a> Human Gene Therapy Methods. 25 (2), 115-125 (2014).</li><li>Fittipaldi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+of+infectious+bacteriophage+T4+virus+by+propidium+monoazide+real-time+PCR.">Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR.</a> Journal of Virological Methods. 168 (1-2), 228-232 (2010).</li><li>Lodder, W. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduction+of+bacteriophage+MS2+by+filtration+and+irradiation+determined+by+culture+and+quantitative+real-time+RT-PCR.">Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR.</a> Journal of Water and Health. 11 (2), 256-266 (2013).</li><li>Brown-Jaque, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic+resistance+genes+in+phage+particles+isolated+from+human+feces+and+induced+from+clinical+bacterial+isolates.">Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates.</a> International Journal of Antimicrobial Agents. , (2017).</li><li>Naveca, F. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+reverse+transcription+real-time+polymerase+chain+reaction+for+simultaneous+detection+of+Mayaro,+Oropouche,+and+oropouche-like+viruses.">Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses.</a> Memorias do Instituto Oswaldo Cruz. 112 (7), 510-513 (2017).</li><li>Jia, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+detection+and+differentiation+of+human+parvovirus+B19+and+human+parvovirus+4+by+an+internally+controlled+multiplex+quantitative+real-time+PCR.">Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR.</a> Molecular and Cellular Probes. 36, 50-57 (2017).</li><li>Bliem, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+triplex+quantitative+pcr+strategy+for+quantification+of+toxigenic+and+nontoxigenic+Vibrio+cholerae+in+aquatic+environments.">A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments.</a> Applied and Environmental Microbiology. 81 (9), 3077-3085 (2015).</li><li>Wan, Z., Goddard, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competition+Between+Conjugation+and+M13+Phage+Infection+in+Escherichia+coli+in+the+Absence+of+Selection+Pressure:+A+Kinetic+Study.">Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study.</a> G3 Genes|Genomes|Genetics. 2 (10), 1137-1144 (2012).</li></ol>

The authors have nothing to disclose.

We developed qPCR methods to quantify phage genomic DNA5, and here we described and adapted a qPCR method to enumerate T7 phages selected against a CF-like mucus barrier. Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines were adapted to develop and validate the qPCR method for enumeration of T7 phages15. The protocol we developed to quantify phages from biopanning experiments is a time-efficient, reliable, and economical approac...

Bacteriophage (phage) display technology, developed by George Smith in 1985, is a powerful, high-throughput approach to identify peptide or protein ligands against targets or receptors from the cell membrane, disease antigens, cellular organelles or specific organs and tissues in the past two decades1,2. Here, random libraries of polypeptides or single chain antibodies are displayed on the coat proteins of phages (typically M13 or T7), and specific ligands can be identified from panning against immobilized proteins in vitro or in vivo biological systems through an iterative selection process. Then, ligands can be coupled with imaging or therapeutic agents for diagnosis and treatment of diseases3,4. It is critical to accurately enumerate phages during multiple steps of biopanning: (1) to quantify phages that bind to the substrate and (2) to quantify phages to determine if there is enrichment with each round of selection (phage enrichment indicates biopanned phage affinity for the target). The current gold standard for quantification, double-layer plaque assay, presents multiple challenges; it is tedious, cumbersome, and potentially inaccurate for a large number of samples. Therefore, our group has developed a sensitive, reproducible, accurate and time-efficient quantitative polymerase chain reaction (qPCR) method to enumerate M13 and T7 phage particles from biopanning5.
qPCR is an attractive and feasible method to accurately quantify T7 and M13 phages. Since each individual phage particle can only contain one copy of genomic DNA (dsDNA or ssDNA), one phage genome is equivalent to one phage particle; by quantifying the number of phage genomes, it is feasible to quantify the number of phages. During qPCR, fluorescent reporter dyes bind phage genomic DNA non-specifically or specifically through sequence-specific primers during PCR amplification, and the fluorescence signal increases with each round of amplification. When the fluorescence signal reaches the threshold, that round/cycle of amplification is noted as the threshold cycle (Ct). The known concentrations of reference phage DNA are plotted against their Ct values to establish a standard curve. Using the standard curve with the Ct values of DNA samples, the concentrations of phages can be interpolated.
While numerous strategies have been previously developed and extensively used to quantify phages from biopanning, each of them has specific challenges. The most popular and conventional method is double-layer plaque assay. Here, host bacteria are infected with phages prepared at serial dilutions, are plated on a solid agar substrate, and are overlaid with agar; phages are enumerated with the number of plaques formed (i.e., plaque forming units or pfu) on the agar plate. Plaque assay is sensitive but tedious, time-consuming and inaccurate, especially for numerous samples and with high concentrations5. Additionally, enzyme-linked immunosorbent assays (ELISA) have been adapted to enumerate M13 and T7 phage particles6,7,8. Here, phages at different dilutions are bound and captured on a solid substrate (i.e., a microplate), probed with phage-specific antibodies, and detected by using reporters (e.g., enzyme sensitive chromogenic substrates, fluorophores) to determine the number of phage particles present. The readouts (e.g., fluorescence, absorbance) of samples can be used to quantify unknown concentrations against phage standards at known concentrations. Different phage-based ELISAs have been developed but they have potential limitations. One group developed a paper-based sandwich ELISA with a quantification range that spanned seven orders of magnitude (102-109 pfu/mL); however, this method required multiple steps of antibody coating and took up to an entire day for the assay8. Our group also developed an ELISA method to quantify M13 phage particles but had a less sensitive detection range of 106 to&#160;1011 pfu/mL5. Switchable lanthanide fluorescence probes have been developed to enumerate M13 and quantification data could be obtained within 20 min; however, this assay has a narrow dynamic range of 109&#160;to 1012 pfu/mL9. One group used atomic force microscopy to enumerate M13 phage particles in solution, but this requires advanced electron microscopy and only worked within a narrow range of concentrations10. Another study used monodisperse emulsions to trap fluorescent M13 and T4 reporter phages and count phages by the number of fluorescent droplets; however, this approach also exhibited a narrow quantification range from 102&#160;to 106 pfu/mL11. While droplet digital PCR has been used to quantify M13 phages, this approach is unable to differentiate between the number of infectious and non-infectious phage particles12.
Our group has recently developed qPCR methods to enumerate T7 and M13 phages identified from biopanning against a blood-brain barrier cell model using two different fluorescent reporter dyes5. Compared to aforementioned quantification methods, the qPCR methods we developed were high-throughput and time-efficient to quantify numerous samples and able to differentiate between infectious and non-infectious phages with DNase I pre-treatment of the phage samples. Importantly, this approach can reproducibly and accurately quantify M13 and T7 bacteriophages from biopanning samples. To guide novice researchers in the area of phage qPCR, here we describe a detailed qPCR method to enumerate T7 phage particles from a cysteine-constrained library (CX7C) panned against an in vitro cystic fibrosis (CF) mucus barrier. From this work, qPCR method can be extended to quantify phage particles from other types of biopanning and from other sources, including water, soil, and body fluids.

<table><tbody><tr><td>&lt;strong&gt;Materials and Reagents&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Primers for T7 genomic DNA</td><td>IDT</td><td></td><td>F: CCTCTTGGGAGGAAGAGATTTG&lt;br/&gt; R: TACGGGTCTCGTAGGACTTAAT</td></tr><tr><td>T7 Select packaging control DNA</td><td>EMD Millipore</td><td>69679-1UG</td><td></td></tr><tr><td>MicroAmp optical 96-well reaction plate</td><td>ThermoFisher Scientific</td><td>N8010560</td><td></td></tr><tr><td>qPCR master mix--Power up SYBR Green master mix</td><td>Applied biosystems</td><td>A25742</td><td></td></tr><tr><td>MicroAmp optical adhesive film kit</td><td>ThermoFisher Scientific</td><td>4313663</td><td></td></tr><tr><td>T7Select 415-1 Cloning Kit</td><td>EMD Millipore</td><td>70015</td><td>User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP</td></tr><tr><td>DNase I solution</td><td>ThermoFisher Scientific</td><td>90083</td><td></td></tr><tr><td>24-well transwell plate</td><td>Corning</td><td>3472</td><td></td></tr><tr><td>UltraPure DNase/RNase-Free Distilled H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Invitrogen</td><td>10977015</td><td></td></tr><tr><td>Phosphate Buffered Saline (1x)</td><td>Corning</td><td>21040CV</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Equipments&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>ViiA7 Real-Time PCR System with Fast 96-Well Block</td><td>ThermoFisher Scientific</td><td>4453535</td><td></td></tr><tr><td>Heraeus Pico 21 Microcentrifuge</td><td>ThermoFisher Scientific</td><td>75002415</td><td></td></tr><tr><td>Fisherbrand Digital Vortex Mixer</td><td>Fisher Scientific</td><td>02-215-370</td><td></td></tr><tr><td>HERMO SCIENTIFIC Multi-Blok Heater</td><td>ThermoFisher Scientific</td><td>Model:2001</td><td></td></tr><tr><td>Sorvall Legend X1 Centrifuge</td><td>ThermoFisher Scientific</td><td>75004220</td><td></td></tr><tr><td>M-20 Microplate Swinging Bucket Rotor</td><td>ThermoFisher Scientific</td><td>75003624</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Software&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>QuantStudio Real-time PCR software</td><td>ThermoFisher Scientific</td><td></td><td>v1.2</td></tr><tr><td>Real-time qPCR primer design</td><td>IDT</td><td></td><td></td></tr><tr><td>OligoAnalyzer 3.1</td><td>IDT</td><td></td><td></td></tr></tbody></table>

quantitative pcr of t7 bacteriophage from biopanning

This protocol describes the use of quantitative PCR (qPCR) to enumerate T7 phages from phage selection experiments (i.e., &#34;biopanning&#34;). qPCR is a fluorescence-based approach to quantify DNA, and here, it is adapted to quantify phage genomes as a proxy for phage particles. In this protocol, a facile phage DNA preparation method is described using high-temperature heating without additional DNA purification. The method only needs small volumes of heat-treated phages and small volumes of the qPCR reaction. qPCR is high-throughput and fast, able to process and obtain data from a 96-well plate of reactions in 2&#8211;4 h. Compared to other phage enumeration approaches, qPCR is more time-efficient. Here, qPCR is used to enumerate T7 phages identified from biopanning against in vitro cystic fibrosis-like mucus model. The qPCR method can be extended to quantify T7 phages from other experiments, including other types of biopanning (e.g.,&#160;immobilized protein binding, in vivo phage screening) and other sources (e.g., water systems or body fluids). In summary, this protocol can be modified to quantify any DNA-encapsulated viruses.

Different primer design tools can be used to design qPCR primers. Typically, primer design programs have their own built-in algorithms to calculate and validate the key parameters of the primers, e.g., GC%, Tm, primer dimer or hairpin formation, etc. Generally, the key criteria are similar in different primer design tools, and primers can be designed following their instructions. Primer BLAST can be used to confirm the specificity of the primers. One primer pair that tar...

Watch this Scientific Journal Video about Quantitative PCR of T7 Bacteriophage from Biopanning at JoVE.com

Quantitative PCR of T7 Bacteriophage from Biopanning

A reproducible, accurate, and time efficient quantitative PCR (qPCR) method to enumerate T7 bacteriophage is described here. The protocol clearly describes phage genomic DNA preparation, PCR reaction preparation, qPCR cycling conditions, and qPCR data analysis.

This protocol describes the use of quantitative PCR (qPCR) to enumerate T7 phages from phage selection experiments (i.e., &#34;biopanning&#34;). qPCR is a ...

quantitative-pcr-of-t7-bacteriophage-from-biopanning

Research

JoVE Journal

Immunology and Infection

10.7K Views.  University of Texas at Austin. A reproducible, accurate, and time efficient quantitative PCR (qPCR) method to enumerate T7 bacteriophage is described here. The protocol clearly describes phage genomic DNA preparation, PCR reaction preparation, qPCR cycling conditions, and qPCR data analysis. 

Video: Quantitative PCR of T7 Bacteriophage from Biopanning

Kinetics of Lagging-strand DNA Synthesis In Vitro by the Bacteriophage T7 Replication Proteins

Here we provide protocols for the kinetic examination of lagging-strand DNA synthesis in vitro by the replication proteins of bacteriophage T7. The T7 replisome is one of the simplest replication systems known, composed of only four proteins, which is an attractive feature for biochemical experiments. Special emphasis is placed on the synthesis of ribonucleotide primers by the T7 primase-helicase, which are used by DNA polymerase to initiate DNA synthesis. Because the mechanisms of DNA replication are conserved across evolution, these protocols should be applicable, or useful as a conceptual springboard, to investigators using other model systems. The protocols described here are highly sensitive and an experienced investigator can perform these experiments and obtain data for analysis in about a day. The only specialized piece of equipment required is a rapid-quench flow instrument, but this piece of equipment is relatively common and available from various commercial sources. The major drawbacks of these assays, however, include the use of radioactivity and the relative low throughput.

Kinetics of Lagging-strand DNA Synthesis In Vitro by the Bacteriophage T7 Replication Proteins

We describe sensitive, gel-based discontinuous assays to examine the kinetics of lagging-strand initiation using the replication proteins of bacteriophage T7.

Here we provide protocols for the kinetic examination of lagging-strand DNA synthesis in vitro by the replication proteins of bacteriophage T7. The T7 ...

Genetics

Synthesis of Infectious Bacteriophages in an E. coli-based Cell-free Expression System

A new generation of cell-free transcription-translation (TXTL) systems, engineered to have a greater versatility and modularity, provide novel capabilities to perform basic and applied sciences in test tube reactions. Over the past decade, cell-free TXTL has become a powerful technique for a broad range of novel multidisciplinary research areas related to quantitative and synthetic biology. The new TXTL platforms are particularly useful to construct and interrogate biochemical systems through the execution of synthetic or natural gene circuits. In vitro TXTL has proven convenient to rapidly prototype regulatory elements and biological networks as well as to recapitulate molecular self-assembly mechanisms found in living systems. In this article, we describe how infectious bacteriophages, such as MS2 (RNA), &#934;&#935;174 (ssDNA), and T7 (dsDNA), are entirely synthesized from their genome in one-pot reactions using an all Escherichia coli, cell-free TXTL system. Synthesis of the three coliphages is quantified using the plaque assay. We show how the yield of synthesized phage depends on the biochemical settings of the reactions. Molecular crowding, emulated through a controlled concentration of PEG 8000, affects the amount of synthesized phages by orders of magnitudes. We also describe how to amplify the phages and how to purify their genomes. The set of protocols and results presented in this work should be of interest to multidisciplinary researchers involved in cell-free synthetic biology and bioengineering.

Synthesis of Infectious Bacteriophages in an E. coli-based Cell-free Expression System

A new generation of cell-free transcription-translation platforms has been engineered to construct biochemical systems in vitro through the execution of gene circuits. In this article, we describe how bacteriophages, such as MS2, &#934;&#935;174, and T7, are synthesized from their genome using an all E. coli cell-free TXTL system.

A new generation of cell-free transcription-translation (TXTL) systems, engineered to have a greater versatility and modularity, provide novel ...

Bioengineering

Construction of Synthetic Phage Displayed Fab Library with Tailored Diversity

Demand for monoclonal antibodies (mAbs) in basic research and medicine is increasing yearly. Hybridoma technology has been the dominant method for mAb development since its first report in 1975. As an alternative technology, phage display methods for mAb development are increasingly attractive since Humira, the first phage-derived antibody and one of the best-selling mAbs, was approved for clinical treatment of rheumatoid arthritis in 2002. As a non-animal based mAb development technology, phage display bypasses antigen immunogenicity, humanization, and animal maintenance that are required from traditional hybridoma technology based antibody development. In this protocol, we describe a method for construction of synthetic phage-displayed Fab libraries with diversities of 109-1010 obtainable with a single electroporation. This protocol consists of: 1) high-efficiency electro-competent cell preparation; 2) extraction of uracil-containing single-stranded DNA (dU-ssDNA); 3) Kunkel&#39;s method based oligonucleotide-directed mutagenesis; 4) electroporation and calculation of library size; 5) protein A/L-based enzyme-linked immunosorbent assay (ELISA) for folding and functional diversity evaluation; and 6) DNA sequence analysis of diversity.

This protocol describes a detailed procedure for the construction of a phage-displayed synthetic antibody library with tailored diversity. Synthetic antibodies have broad applications from basic research to disease diagnostics and therapeutics.

Demand for monoclonal antibodies (mAbs) in basic research and medicine is increasing yearly. Hybridoma technology has been the dominant method for mAb ...

Biosensor-based High Throughput Biopanning and Bioinformatics Analysis Strategy for the Global Validation of Drug-protein Interactions

Receptors and enzyme proteins are important biomolecules that act as binding targets for bioactive small molecules. Thus, the rapid and global validation of the drug-protein interactions is highly desirable for not only understanding the molecular mechanisms underlying therapeutic efficacy but also for assessing drug characteristics, such as adsorption, distribution, metabolism, excretion, and toxicity (ADMET) for clinical use. Here, we present a biosensor-based high throughput strategy for the biopanning of T7 phage-displayed short peptides that can be easily displayed on the phage capsid. Subsequent analysis of the amino acid sequences of peptides containing short segments, as &#34;broken relics&#34;, of the drug-binding sites using bioinformatics programs in receptor ligand contact (RELIC) suite, is also shown. By applying this method to two clinically approved drugs, an anti-tumor irinotecan, and an anti-flu oseltamivir, the detailed process for collecting the drug-recognizing peptide sequences and highlighting the drug-binding sites of the target proteins are explained in this paper. The strategy described herein can be applied for any small molecules of interest.

This study aimed to present a strategy for identifying drug-peptide interactions. The strategy involves the biopanning of drug-recognizing short peptides based on a quartz-crystal microbalance (QCM) biosensor, followed by bioinformatics analysis for quantitatively assessing the information obtained for the drug recognition and annotation of the drug-binding sites on proteins.

Receptors and enzyme proteins are important biomolecules that act as binding targets for bioactive small molecules. Thus, the rapid and global validation ...

A Protocol for Phage Display and Affinity Selection Using Recombinant Protein Baits

Using recombinant phage as a scaffold to present various protein portions encoded by a directionally cloned cDNA library to immobilized bait molecules is an efficient means to discover interactions. The technique has largely been used to discover protein-protein interactions but the bait molecule to be challenged need not be restricted to proteins. The protocol presented here has been optimized to allow a modest number of baits to be screened in replicates to maximize the identification of independent clones presenting the same protein. This permits greater confidence that interacting proteins identified are legitimate interactors of the bait molecule. Monitoring the phage titer after each affinity selection round provides information on how the affinity selection is progressing as well as on the efficacy of negative controls. One means of titering the phage, and how and what to prepare in advance to allow this process to progress as efficiently as possible, is presented. Attributes of amplicons retrieved following isolation of independent plaque are highlighted that can be used to ascertain how well the affinity selection has progressed. Trouble shooting techniques to minimize false positives or to bypass persistently recovered phage are explained. Means of reducing viral contamination flare up are discussed.

Phage display is a powerful technique to capture proteins or protein moieties that interact with an immobilized molecule of interest. Once a decision of the type of phage cDNA library to create and screen has been made, the protocol described here permits efficient affinity selection leading to identification of interactors.

Using  recombinant phage as a scaffold to present various protein portions encoded by  a directionally cloned cDNA library to immobilized bait molecules ...

Biology

Exploring Gut Phage-Bacteria Dynamics in Murine Models Using T4 Phage

T4 Bacteriophage and E. coli Interaction in the Murine Intestine: A Prototypical Model for Studying Host-Bacteriophage Dynamics In Vivo

Bacteriophages (phages) are viruses that infect bacteria with species- and strain-level specificity and are the most abundant biological entities across all known ecosystems. Within bacterial communities, such as those found in the gut microbiota, phages are implicated in regulating microbiota population dynamics and driving bacterial evolution. There has been renewed interest in phage research in the last decade, in part due to the host-specific killing capabilities of lytic phages, which offer a promising tool to counter the increasing threat of antimicrobial resistant bacteria. Furthermore, recent studies demonstrating that phages adhere to intestinal mucus suggest they may have a protective role in preventing bacterial invasion into the underlying epithelium. Importantly, like bacterial microbiomes, disrupted phageomes have been associated with worsened outcomes in diseases such as inflammatory bowel disease. Previous studies have demonstrated that phages can modulate the microbiome of animals and humans through fecal filtrate transplants, benefiting the host&#39;s health. With this recent wave of research comes the necessity to establish and standardize protocols for studying phages in the context of the gut microbiome. This protocol provides a set of procedures to study isolated T4 phages and their bacterial host, Escherichia coli,&#160;in the context of the murine gastrointestinal tract. The methods described here outline&#160;how to start from a phage lysate, administer it to mice and assess effects on bacterial host and phage levels.&#160;This protocol can be modified and applied to other phage-bacterial pairs and provides a starting point for studying host-phage dynamics in vivo.

Author Spotlight: Investigating Bacteriophage-Induced Immune Responses in Gnotobiotic Mice

Bacteriophages (phages), viruses that infect bacteria, are an integral component of the gut microbiome. Though these symbiotic inhabitants drive bacterial fitness and population dynamics, little is understood about how they impact gut homeostasis and disease. This protocol studies isolated T4 phages within a mouse model, adaptable to other phage-bacterial pairs.

Bacteriophages (phages) are viruses that infect bacteria with species- and strain-level specificity and are the most abundant biological entities across ...

Understanding the Impact of Temperate Bacteriophages on Their Lysogens Through Transcriptomics

Temperate phages are found integrated as prophages in the majority of bacterial genomes. Some prophages are cryptic and fixed in the bacterial chromosome, but others are active and can be triggered into a replicative form either spontaneously or by exposure to inducing factors. Prophages are commonly associated with the ability to confer toxin production or other virulence-associated traits on their host cell. More recent studies have shown they can play a much bigger role in altering the physiology of their hosts. The technique described here has enabled us to investigate how prophages affect gene expression in the opportunistic bacterium Pseudomonas aeruginosa.
In this work, the growth of the wild-type P. aeruginosa strain PAO1 was compared with that of isogenic lysogens carrying different combinations of prophages from the Liverpool Epidemic Strain (LES) LESB58. In a lysogen culture, a proportion of bacterial cells will be supporting lytic bacteriophage replication (spontaneous induction) with a high level of expression per cell of&#160;late phage genes, such as those associated with the assembly of phage particles,&#160;thus masking the low-level gene expression associated with lysogen-restricted gene&#160;expression. The impact of spontaneous induction can thus obscure prophage gene expression across a lysogen population.
Growth profiling experiments were used to identify spontaneous induction, which was minimal during the early exponential growth phase. This study reports how to prepare sample cultures during the early exponential growth phase and how to set up adequate controls despite low cell numbers. These protocols ensure the reliable and reproducible comparison of wild-type and lysogenic bacteria under various conditions, thus improving the transcriptomic profiling of prophage genomes and aiding in the identification of previously unrecognized prophage functions.

This protocol enables the impact of prophages on their hosts to be revealed. Bacterial cultures are synchronized using conditions that best support the lysogenic state, limiting spontaneous induction. RT-qPCR unequivocally distinguishes prophage-restricted genes and those uncoupled from phage control from those that are expressed during the lytic replication cycle.

Temperate phages are found integrated as prophages in the majority of bacterial genomes. Some prophages are cryptic and fixed in the bacterial chromosome, ...

Plaque Assay: A Method to Determine Viral Titer as Plaque Forming Units (PFU)

Source: Tilde Andersson1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund, Sweden
Viruses that infect prokaryotic organisms, called bacteriophages or simply phages, were identified in the early 20th century by Twort (1) and d&#39;H&#233;relle (2) independently. Phages have since been widely recognized for their therapeutic value (3) and their influence on human (4), as well as global, ecosystems (5). Current concerns have fueled a renewed interest in the use of phages as an alternative to modern antibiotics in treatment of infectious disease (6). Essentially all phage research relies on the ability to purify and quantify viruses, also known as a viral titer. Initially described in 1952, this was the purpose of the plaque assay (7). Decades and multiple technological advancements later, the plaque assay remains one of the most reliable methods for determination of viral titer (8).
Bacteriophages subsist by injecting their genetic material into host cells, hijacking the machineries for production of new phage particles, and eventually causing the host to release numerous progeny virions through cell lysis. Because of their minute size, bacteriophages cannot be observed using solely light microscopy; therefore, scanning electron microscopy is required (Figure 1). Additionally, phages cannot be cultivated on nutritional agar plates like bacteria, as they need host cells to prey on.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10514/10514fig1.jpg" /> 
Figure 1: The morphology of a bacteriophage, here exemplified by an E. coli phage, can be studied using scanning electron microscopy. Most bacteriophages belong to Caudovirales (tailed bacteriophages). This particular phage has a very short tail structure and an icosahedral head, placing it in the family of Podoviruses.
The plaque assay (Figure 2) is based on incorporation of host cells, preferentially in log-phase growth, into the medium. This creates a dense, turbid layer of bacteria able to sustain viral growth. An isolated phage can subsequently infect, replicate within, and lyse one cell. With each lysed cell, multiple adjacent ones become immediately infected. Several cycles in, a clear zone (a plaque) can be observed in the otherwise turbid plate (Figure 2B/Figure 3A), indicating the presence of what was initially a single bacteriophage particle. The number of plaque forming units per volume (i.e. PFU/mL) of a sample, can thus be determined from the number of plaques generated.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10514/10514fig2.jpg" /> 
Figure 2: Testing for plaque forming units (PFU) is a common method for determining the number of bacteriophages in a sample. (A) The base of a sterile Petri dish is covered with an appropriate solid nutrient medium, followed by a mixture of soft media, susceptible host cells and a dilution of the original bacteriophage sample. Note that the phage-suspension could, in some cases, also be evenly spread-out across the surface of already solidified soft agar. (B) Growth of the host bacteria forms a lawn of cells in the top agar layer. Bacteriophage replication generates clear zones, or plaques, caused by host cell lysis.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/10514/10514fig3.jpg" /> 
Figure 3: Results from PFU-testing show multiple plaques generated by bacteriophages. Due to lysis of susceptible host cells, plaques can be seen as clearing zones in the bacterial lawn, either with (A) full clearance, or (B) partial re-growth caused by generation of resistant bacteria (or possibly by temperate phages in the lysogenic cycle).
Certain temperate phages can adopt what is referred to as a lysogenic lifecycle, in addition to the formerly described lytic growth. In lysogeny, the virus assumes a latent state through incorporation of its genetic material into the genome of the host cell (9), often conferring resistance to further phage infections. This is sometimes revealed through a slight clouding of the plaque (Figure 3B). It is worth noting however, that plaques can also appear blurred due to re-growth of bacteria that have evolved resistance to the phage independent of previous phage infections.
Viruses can attach, or adsorb, to only a limited range of host bacteria (10). Host ranges are further limited by intracellular anti-viral strategies such as the CRISPR-Cas system (11). The resistance/sensitivity towards specific phages displayed by bacterial subgroups has historically been used to categorize bacterial strains into different phage types (Figure 4). Although the effectiveness of this method has now been surpassed by novel sequencing techniques, phage typing can still provide valuable information about bacteria-phage interactions, for instance, facilitating the design of a phage cocktail for clinical usage.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/10514/10514fig4.jpg" /> 
Figure 4: Phage sensitivity of different bacterial strains. Soft agar plates with Cutibacterium acnes strain (A) AD27 and (B) AD35, were spotted with 21 different C. acnes bacteriophages. Only phage 11 were able to infect and kill AD27 while strain AD35 showed sensitivity towards all phages. This technique, termed phage typing, can be used to divide bacterial species and strains into different subgroups based on phage susceptibility.

Determining Viral Titer as Plaque Forming Units PFU

Source: Tilde Andersson1, Rolf Lood1
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 ...

Education

JoVE Science Education

Advanced Biology

Microbiology

Detection of Bacteriophages in Environmental Samples

Source: Laboratories of Dr. Ian Pepper and Dr. Charles Gerba - The University of Arizona 
Demonstrating Author: Alex Wassimi
Viruses are a unique group of biological entities that infect both eukaryotic and prokaryotic organisms. They are obligate parasites that have no metabolic capacity, and in order to replicate, rely on host metabolism to produce viral parts that self-assemble inside host cells.
Viruses are ultramicroscopic&#8212;too small to be viewed with the light microscope, visible only with the greater resolution of the electron microscope. A viral particle consists of a nucleic acid genome, either DNA or RNA, surrounded by a protein coat, known as a capsid, composed of protein subunits or capsomers. In some more complex viruses, the capsid is surrounded by an additional lipid envelope, and some have spike-like surface appendages or tails.
Viruses that infect the intestinal tract of humans and animals are known as enteric viruses. They are excreted in feces and can be isolated from domestic wastewater. Viruses which infect bacteria are known as bacteriophages, and those which infect coliform bacteria are called coliphages (Figure 1). The phages of coliform bacteria are found anywhere coliform bacteria are found.
<img alt="Figure 1" src="/files/ftp_upload/10190/10190fig1.jpg" /> 
Figure 1. Coliphage T2.

Plaque Assay: Phage Enumeration in Environmental Samples

Source: Laboratories of Dr. Ian Pepper and Dr. Charles Gerba - The University of Arizona
Demonstrating Author: Alex Wassimi
Viruses are a unique group of ...

Environmental Sciences

Environmental Microbiology

Quantitative Polymerase Chain Reaction to Enumerate Bacteriophages

Source: Peng, X., et al., <a href="https://app.jove.com/v/58165">Quantitative PCR of T7 Bacteriophage from Biopanning.</a> J. Vis. Exp. (2018)
In this video, we discuss the quantitative polymerase chain reaction, qPCR, to enumerate T7 bacteriophages through DNA quantification. The fluorescent dye in the PCR mixture binds with the newly synthesized DNA strands and emits fluorescence, which is measured.

Ilościowa reakcja łańcuchowa polimerazy w celu zliczenia bakteriofagów

Source: Peng, X., et al., Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (2018)
In this video, we discuss the quantitative polymerase ...

Quantitative PCR of T7 Bacteriophage from Biopanning

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Kinetics of Lagging-strand DNA Synthesis In Vitro by the Bacteriophage T7 Replication Proteins

Synthesis of Infectious Bacteriophages in an E. coli-based Cell-free Expression System

Construction of Synthetic Phage Displayed Fab Library with Tailored Diversity

Biosensor-based High Throughput Biopanning and Bioinformatics Analysis Strategy for the Global Validation of Drug-protein Interactions

A Protocol for Phage Display and Affinity Selection Using Recombinant Protein Baits

T4 Bacteriophage and E. coli Interaction in the Murine Intestine: A Prototypical Model for Studying Host-Bacteriophage Dynamics In Vivo

Understanding the Impact of Temperate Bacteriophages on Their Lysogens Through Transcriptomics

Plaque Assay: A Method to Determine Viral Titer as Plaque Forming Units (PFU)

Detection of Bacteriophages in Environmental Samples

Ilościowa reakcja łańcuchowa polimerazy w celu zliczenia bakteriofagów