Name: quantitative pcr of t7 bacteriophage from biopanning
Uploaded: 2018-09-27T14:00:00
Description: Watch this Scientific Journal Video about Quantitative PCR of T7 Bacteriophage from Biopanning at JoVE.com

This work was supported by PhRMA Foundation Research Starter Grant and the National Heart, Lung, and Blood Institute of the National Institutes of Health grant under award number R01HL138251.

1. Primer Design and Analysis for T7 Phage Genomic DNA
<ol>
	<li>Design primers for amplification of T7 phage genomic DNA. 
	NOTE: F (forward) and R (reverse) primers (see Table of Materials) amplify the T7 DNA sequence located upstream of the library variable region (Figure 1).</li>
	<li>Choose an appropriate primer analyzer to evaluate parameters of the primers, including melting temperature (Tm), percent GC content (GC%), primer dimers, hairpin formation and PCR su...

<ol>
	<li>Smith, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Filamentous+fusion+phage:+novel+expression+vectors+that+display+cloned+antigens+on+the+virion+surface.">Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface.</a> Science. 228 (4705), 1315-1317 (1985).</li><li>Smith, G. P., Petrenko, V. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phage+Display.">Phage Display.</a> Chemical Reviews. 97 (96), 391-410 (1997).</li><li>Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Display+technologies:+Application+for+the+discovery+of+drug+and+gene+delivery+agents.">Display technologies: Application for the discovery of drug and gene delivery agents.</a> Advanced Drug Delivery Reviews. 58 (15), 1622-1654 (2006).</li><li>Dias-Neto, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+phage+display:+Integrating+and+comparing+available+molecular+tools+to+enable+costeffective+high-throughput+analysis.">Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis.</a> PLoS ONE. 4 (12), 1-11 (2009).</li><li>Peng, X., Nguyen, A., Ghosh, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+M13+and+T7+bacteriophages+by+TaqMan+and+SYBR+green+qPCR.">Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR.</a> Journal of Virological Methods. 252 (June 2017), 100-107 (2017).</li><li>Khan, M. S., Pande, T., Mvan de Ven, T. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Qualitative+and+quantitative+detection+of+T7+bacteriophages+using+paper+based+sandwich+ELISA.">Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA.</a> Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).</li><li>Brasino, M., Lee, J. H., Cha, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+highly+amplified+enzyme-linked+immunosorbent+assay+signals+from+genetically+engineered+bacteriophage.">Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage.</a> Analytical Biochemistry. 470, 7-13 (2014).</li><li>Yu, X., Burgoon, M., Shearer, A., Gilden, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+phage+peptide+interaction+with+antibody+using+phage+mediated+immuno-PCR.">Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR.</a> J immunol Methods. 326 (1-2), 33-40 (2007).</li><li>Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminm&#228;ki, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homogenous+M13+bacteriophage+quantification+assay+using+switchable+lanthanide+fluorescence+probes.">Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes.</a> BioTechniques. 53 (5), 301-303 (2012).</li><li>Schlaman, H. R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+of+signaling+proteins+with+phage-displayed+ligands+by+fluorescence+correlation+spectroscopy.">Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy.</a> Journal of Biomolecular Screening. 13 (8), 766-776 (2008).</li><li>Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+enumeration+of+phage+in+monodisperse+emulsions.">Rapid enumeration of phage in monodisperse emulsions.</a> Analytical Chemistry. 86 (12), 5642-5648 (2014).</li><li>Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+and+quantitation+of+bacteriophage+M13+using+desalting+spin+columns+and+digital+PCR.">Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR.</a> Journal of Virological Methods. 185 (1), 171-174 (2012).</li><li>. T7Select&#174; Biopanning Kit Available from: <a target="_blank" href="https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit">https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit</a> (2018)</li><li>Schneider, A., Hommel, G., Blettner, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Linear+Regression+Analysis.">Linear Regression Analysis.</a> Deutsches &#196;rzteblatt international. 107 (44), 776-782 (2010).</li><li>Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+MIQE+Guidelines:+Minimun+information+for+publication+of+quantitative+real-time+PCR+experiments.">The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments.</a> Clinical Chemitry. 55 (4), 611-622 (2009).</li><li>Lock, M., Alvira, M. R., Chen, S. -. J., Wilson, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+Determination+of+Single-Stranded+and+Self-Complementary+Adeno-Associated+Viral+Vector+Genome+Titers+by+Droplet+Digital+PCR.">Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR.</a> Human Gene Therapy Methods. 25 (2), 115-125 (2014).</li><li>Fittipaldi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+of+infectious+bacteriophage+T4+virus+by+propidium+monoazide+real-time+PCR.">Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR.</a> Journal of Virological Methods. 168 (1-2), 228-232 (2010).</li><li>Lodder, W. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduction+of+bacteriophage+MS2+by+filtration+and+irradiation+determined+by+culture+and+quantitative+real-time+RT-PCR.">Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR.</a> Journal of Water and Health. 11 (2), 256-266 (2013).</li><li>Brown-Jaque, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic+resistance+genes+in+phage+particles+isolated+from+human+feces+and+induced+from+clinical+bacterial+isolates.">Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates.</a> International Journal of Antimicrobial Agents. , (2017).</li><li>Naveca, F. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+reverse+transcription+real-time+polymerase+chain+reaction+for+simultaneous+detection+of+Mayaro,+Oropouche,+and+oropouche-like+viruses.">Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses.</a> Memorias do Instituto Oswaldo Cruz. 112 (7), 510-513 (2017).</li><li>Jia, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+detection+and+differentiation+of+human+parvovirus+B19+and+human+parvovirus+4+by+an+internally+controlled+multiplex+quantitative+real-time+PCR.">Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR.</a> Molecular and Cellular Probes. 36, 50-57 (2017).</li><li>Bliem, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+triplex+quantitative+pcr+strategy+for+quantification+of+toxigenic+and+nontoxigenic+Vibrio+cholerae+in+aquatic+environments.">A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments.</a> Applied and Environmental Microbiology. 81 (9), 3077-3085 (2015).</li><li>Wan, Z., Goddard, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competition+Between+Conjugation+and+M13+Phage+Infection+in+Escherichia+coli+in+the+Absence+of+Selection+Pressure:+A+Kinetic+Study.">Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study.</a> G3 Genes|Genomes|Genetics. 2 (10), 1137-1144 (2012).</li></ol>

We developed qPCR methods to quantify phage genomic DNA5, and here we described and adapted a qPCR method to enumerate T7 phages selected against a CF-like mucus barrier. Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines were adapted to develop and validate the qPCR method for enumeration of T7 phages15. The protocol we developed to quantify phages from biopanning experiments is a time-efficient, reliable, and economical approac...

Bacteriophage (phage) display technology, developed by George Smith in 1985, is a powerful, high-throughput approach to identify peptide or protein ligands against targets or receptors from the cell membrane, disease antigens, cellular organelles or specific organs and tissues in the past two decades1,2. Here, random libraries of polypeptides or single chain antibodies are displayed on the coat proteins of phages (typically M13 or T7), and specific ligands can be identified from panning against immobilized proteins in vitro or in vivo biological systems through an iterative selection process. Then, ligands can be coupled with imaging or therapeutic agents for diagnosis and treatment of diseases3,4. It is critical to accurately enumerate phages during multiple steps of biopanning: (1) to quantify phages that bind to the substrate and (2) to quantify phages to determine if there is enrichment with each round of selection (phage enrichment indicates biopanned phage affinity for the target). The current gold standard for quantification, double-layer plaque assay, presents multiple challenges; it is tedious, cumbersome, and potentially inaccurate for a large number of samples. Therefore, our group has developed a sensitive, reproducible, accurate and time-efficient quantitative polymerase chain reaction (qPCR) method to enumerate M13 and T7 phage particles from biopanning5.
qPCR is an attractive and feasible method to accurately quantify T7 and M13 phages. Since each individual phage particle can only contain one copy of genomic DNA (dsDNA or ssDNA), one phage genome is equivalent to one phage particle; by quantifying the number of phage genomes, it is feasible to quantify the number of phages. During qPCR, fluorescent reporter dyes bind phage genomic DNA non-specifically or specifically through sequence-specific primers during PCR amplification, and the fluorescence signal increases with each round of amplification. When the fluorescence signal reaches the threshold, that round/cycle of amplification is noted as the threshold cycle (Ct). The known concentrations of reference phage DNA are plotted against their Ct values to establish a standard curve. Using the standard curve with the Ct values of DNA samples, the concentrations of phages can be interpolated.
While numerous strategies have been previously developed and extensively used to quantify phages from biopanning, each of them has specific challenges. The most popular and conventional method is double-layer plaque assay. Here, host bacteria are infected with phages prepared at serial dilutions, are plated on a solid agar substrate, and are overlaid with agar; phages are enumerated with the number of plaques formed (i.e., plaque forming units or pfu) on the agar plate. Plaque assay is sensitive but tedious, time-consuming and inaccurate, especially for numerous samples and with high concentrations5. Additionally, enzyme-linked immunosorbent assays (ELISA) have been adapted to enumerate M13 and T7 phage particles6,7,8. Here, phages at different dilutions are bound and captured on a solid substrate (i.e., a microplate), probed with phage-specific antibodies, and detected by using reporters (e.g., enzyme sensitive chromogenic substrates, fluorophores) to determine the number of phage particles present. The readouts (e.g., fluorescence, absorbance) of samples can be used to quantify unknown concentrations against phage standards at known concentrations. Different phage-based ELISAs have been developed but they have potential limitations. One group developed a paper-based sandwich ELISA with a quantification range that spanned seven orders of magnitude (102-109 pfu/mL); however, this method required multiple steps of antibody coating and took up to an entire day for the assay8. Our group also developed an ELISA method to quantify M13 phage particles but had a less sensitive detection range of 106 to&#160;1011 pfu/mL5. Switchable lanthanide fluorescence probes have been developed to enumerate M13 and quantification data could be obtained within 20 min; however, this assay has a narrow dynamic range of 109&#160;to 1012 pfu/mL9. One group used atomic force microscopy to enumerate M13 phage particles in solution, but this requires advanced electron microscopy and only worked within a narrow range of concentrations10. Another study used monodisperse emulsions to trap fluorescent M13 and T4 reporter phages and count phages by the number of fluorescent droplets; however, this approach also exhibited a narrow quantification range from 102&#160;to 106 pfu/mL11. While droplet digital PCR has been used to quantify M13 phages, this approach is unable to differentiate between the number of infectious and non-infectious phage particles12.
Our group has recently developed qPCR methods to enumerate T7 and M13 phages identified from biopanning against a blood-brain barrier cell model using two different fluorescent reporter dyes5. Compared to aforementioned quantification methods, the qPCR methods we developed were high-throughput and time-efficient to quantify numerous samples and able to differentiate between infectious and non-infectious phages with DNase I pre-treatment of the phage samples. Importantly, this approach can reproducibly and accurately quantify M13 and T7 bacteriophages from biopanning samples. To guide novice researchers in the area of phage qPCR, here we describe a detailed qPCR method to enumerate T7 phage particles from a cysteine-constrained library (CX7C) panned against an in vitro cystic fibrosis (CF) mucus barrier. From this work, qPCR method can be extended to quantify phage particles from other types of biopanning and from other sources, including water, soil, and body fluids.

<table>
	<tbody>
		<tr>
			<td>Materials and reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primers for T7 genomic DNA</td>
			<td>IDT</td>
			<td></td>
			<td>F: CCTCTTGGGAGGAAGAGATTTG 
			R: TACGGGTCTCGTAGGACTTAAT</td>
		</tr>
		<tr>
			<td>T7Select packaging control DNA</td>
			<td>EMD Millipore</td>
			<td>69679-1UG</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp optical 96-well reaction plate</td>
			<td>ThermoFisher Scientific</td>
			<td>N8010560</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR master mix--Power up SYBR Green master mix</td>
			<td>Applied biosystems</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp optical adhesive film kit</td>
			<td>ThermoFisher Scientific</td>
			<td>4313663</td>
			<td></td>
		</tr>
		<tr>
			<td>T7Select 415-1 Cloning Kit</td>
			<td>EMD Millipore</td>
			<td>70015</td>
			<td>User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP</td>
		</tr>
		<tr>
			<td>DNase I solution</td>
			<td>ThermoFisher Scientific</td>
			<td>90083</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well transwell plate</td>
			<td>Corning</td>
			<td>3472</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure DNase/RNase-Free Distilled H2O</td>
			<td>Invitrogen</td>
			<td>10977015</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline (1X)</td>
			<td>Corning</td>
			<td>21040CV</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Equipments</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ViiA7 Real-Time PCR System with Fast 96-Well Block</td>
			<td>ThermoFisher Scientific</td>
			<td>4453535</td>
			<td></td>
		</tr>
		<tr>
			<td>Heraeus Pico 21 Microcentrifuge</td>
			<td>ThermoFisher Scientific</td>
			<td>75002415</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisherbrand Digital Vortex Mixer</td>
			<td>Fisher Scientific</td>
			<td>02-215-370</td>
			<td></td>
		</tr>
		<tr>
			<td>HERMO SCIENTIFIC Multi-Blok Heater</td>
			<td>ThermoFisher Scientific</td>
			<td>Model:2001</td>
			<td></td>
		</tr>
		<tr>
			<td>Sorvall Legend X1 Centrifuge</td>
			<td>ThermoFisher Scientific</td>
			<td>75004220</td>
			<td></td>
		</tr>
		<tr>
			<td>M-20 Microplate Swinging Bucket Rotor</td>
			<td>ThermoFisher Scientific</td>
			<td>75003624</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QuantStudio Real-time PCR software</td>
			<td>ThermoFisher Scientific</td>
			<td></td>
			<td>v1.2</td>
		</tr>
		<tr>
			<td>Real-time qPCR primer design</td>
			<td>IDT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OligoAnalyzer 3.1</td>
			<td>IDT</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

quantitative pcr of t7 bacteriophage from biopanning

This protocol describes the use of quantitative PCR (qPCR) to enumerate T7 phages from phage selection experiments (i.e., &#34;biopanning&#34;). qPCR is a fluorescence-based approach to quantify DNA, and here, it is adapted to quantify phage genomes as a proxy for phage particles. In this protocol, a facile phage DNA preparation method is described using high-temperature heating without additional DNA purification. The method only needs small volumes of heat-treated phages and small volumes of the qPCR reaction. qPCR is high-throughput and fast, able to process and obtain data from a 96-well plate of reactions in 2&#8211;4 h. Compared to other phage enumeration approaches, qPCR is more time-efficient. Here, qPCR is used to enumerate T7 phages identified from biopanning against in vitro cystic fibrosis-like mucus model. The qPCR method can be extended to quantify T7 phages from other experiments, including other types of biopanning (e.g.,&#160;immobilized protein binding, in vivo phage screening) and other sources (e.g., water systems or body fluids). In summary, this protocol can be modified to quantify any DNA-encapsulated viruses.

Different primer design tools can be used to design qPCR primers. Typically, primer design programs have their own built-in algorithms to calculate and validate the key parameters of the primers, e.g., GC%, Tm, primer dimer or hairpin formation, etc. Generally, the key criteria are similar in different primer design tools, and primers can be designed following their instructions. Primer BLAST can be used to confirm the specificity of the primers. One primer pair that tar...

Watch this Scientific Journal Video about Quantitative PCR of T7 Bacteriophage from Biopanning at JoVE.com

Quantitative PCR of T7 Bacteriophage from Biopanning

A reproducible, accurate, and time efficient quantitative PCR (qPCR) method to enumerate T7 bacteriophage is described here. The protocol clearly describes phage genomic DNA preparation, PCR reaction preparation, qPCR cycling conditions, and qPCR data analysis.

This protocol describes the use of quantitative PCR (qPCR) to enumerate T7 phages from phage selection experiments (i.e., &#34;biopanning&#34;). qPCR is a ...

This method could help answer key problems in the virology and microbiology fields related to enumeration of bacteriophages from complex samples and bacteriophage based diagnostics and therapeutics. The main advantage of this technique is that it enables time efficient and accurate quantification of a large number of samples from phage display biopanning experiments not feasible with traditional assays. Demonstrating the procedure will be Rashmi Mohanty and Jasmim Leal, graduate students from my laboratory.After designing the primers and creating a stock concentration, obtain reference T7 phage DNA at a concentration of 0.1 micrograms per microliter. Using ultrapure water, serially dilute this DNA tenfold, from one million femtograms per microliter to one femtograms per microliter in 0.2 milliliter PCR tubes. Prepare 20 microliters of each concentration, making sure to change pipette tips and vortex the tubes between each stage of the dilution.Then convert the T7 phage reference DNA concentration from femtograms per microliter to genome copies per microliter. First, pipette 200 microliters of the sample T7 phage clone into a 1.5 milliliter micro centrifuge tube for each of the 10 desired samples. Add two microliters of DNase one to each tube.Cap the tubes and incubate at 37 degrees Celsius for 10 minutes in a heated dry bath. Then incubate at 100 degrees celsius for 15 minutes in a heated dry bath. Centrifuge the tubes containing the heat treated phages at 18, 534 times g for 10 seconds.Place the centrifuged tubes on a vortex mixer set at touch activation mode for 10 seconds to mix the phages. Spin again at 18, 534 times g for 10 seconds. After this, leave the samples on the laboratory bench about one hour to cool them to room temperature.Prepare the qPCR premix for 10 biopanned phage samples of unknown concentration and seven samples of standard concentrations in triplicate. Resulting in a premix for 51 samples containing 255 microliters of qPCR master mix, 51 microliters of primers and 102 microliters of water. Aliquot eight microliters of the prepared PCR mix into 51 wells of a 96-well qPCR plate.Next add two microliters of heat treated T7 phage samples to each of these wells, dispensing it below the surface of the qPCR premix. Using adhesive film, seal the plate. Wrap the plate in aluminum foil to minimize fluorescence photo bleaching and then proceed to run the plate on the qPCR equipment.Set up the cycling conditions and melt curve settings as outlined in the text protocol. After the qPCR is run, the amplification plot, melt curve plot, and multicomponent plot are analyzed from the raw data. The amplification plot indicates whether the PCR amplification of each sample is successful or not.The multicomponent plot represents the amplification and decay of the fluorescent signal throughout the amplification cycles. While the melt curve plot is used to validate the specificity of the primers, since each PCR product has one unique melting temperature. The standard curve is then generated from the reference DNA.Here the amplification efficiency is calculated to be 92.4%Representative data from a qPCR study is then compared to the same phage that were quantified by a double layer plaque assay at the tested range of 10 to 10 million genome copies per microliter. As seen here, the number of phages in the qPCR quantitation is higher than in the plaque assay. The repeatability of the qPCR method as represented by the coefficient of variance is seen to have values ranging from 2.85 to 27.2%While attempting this procedure, it's important to remember that there are numerous considerations in the development and use of qPCR to accurately quantify phages, including careful treatment and preparation of samples and calibration of relevant equipment.Following this method, other techniques can be performed in order to enumerate phage particles in a variety of applications included in vivo biopanning, phage library DNA preparation and next generation sequencing and phage detection in complex environmental samples. Don't forget that phages are considered biological hazards in the laboratory and precautions such as personal protective equipment, including gloves and lab coats, should always be worn while performing the procedure.

quantitative-pcr-of-t7-bacteriophage-from-biopanning

Research

JoVE Journal

Immunology and Infection

Quantitative Imaging of Lineage-specific Toll-like Receptor-mediated Signaling in Monocytes and Dendritic Cells from Small Samples of Human Blood

Individual variations in immune status determine responses to infection and contribute to disease severity and outcome. Aging is associated with an increased susceptibility to viral and bacterial infections and decreased responsiveness to vaccines with a well-documented decline in humoral as well as cell-mediated immune responses1,2. We have recently assessed the effects of aging on Toll-like receptors (TLRs), key components of the innate immune system that detect microbial infection and trigger antimicrobial host defense responses3. In a large cohort of healthy human donors, we showed that peripheral blood monocytes from the elderly have decreased expression and function of certain TLRs4 and similar reduced TLR levels and signaling responses in dendritic cells (DCs), antigen-presenting cells that are pivotal in the linkage between innate and adaptive immunity5. We have shown dysregulation of TLR3 in macrophages and lower production of IFN by DCs from elderly donors in response to infection with West Nile virus6,7. 
Paramount to our understanding of immunosenescence and to therapeutic intervention is a detailed understanding of specific cell types responding and the mechanism(s) of signal transduction. Traditional studies of immune responses through imaging of primary cells and surveying cell markers by FACS or immunoblot have advanced our understanding significantly, however, these studies are generally limited technically by the small sample volume available from patients and the inability to conduct complex laboratory techniques on multiple human samples. ImageStream combines quantitative flow cytometry with simultaneous high-resolution digital imaging and thus facilitates investigation in multiple cell populations contemporaneously for an efficient capture of patient susceptibility. Here we demonstrate the use of ImageStream in DCs to assess TLR7/8 activation-mediated increases in phosphorylation and nuclear translocation of a key transcription factor, NF-&kappa;B, which initiates transcription of numerous genes that are critical for immune responses8. Using this technology, we have also recently demonstrated a previously unrecognized alteration of TLR5 signaling and the NF-&kappa;B pathway in monocytes from older donors that may contribute to altered immune responsiveness in aging9.

We describe use of ImageStream technology (<a href="http://www.amnis.com/" target="_blank">www.amnis.com</a>), which combines quantitative flow cytometry with simultaneous high-resolution digital imaging, to quantify cellular mechanisms of primary immune cells from well-defined patient cohorts. Our studies provide a blueprint for translational investigations to quantify lineage specific cellular responses in small samples from subject cohorts.

Individual variations in immune status determine responses to infection and contribute to disease severity and outcome.  Aging is associated with an ...

High-throughput Quantitative Real-time RT-PCR Assay for Determining Expression Profiles of Types I and III Interferon Subtypes

Described in this report is a qRT-PCR assay for the analysis of seventeen human IFN subtypes in a 384-well plate format that incorporates highly specific locked nucleic acid (LNA) and molecular beacon (MB) probes, transcript standards, automated multichannel pipetting, and plate drying. Determining expression among the type I interferons (IFN), especially the twelve IFN-&#945; subtypes, is limited by their shared sequence identity; likewise, the sequences of the type III IFN, especially IFN-&#955;2 and -&#955;3, are highly similar. This assay provides a reliable, reproducible, and relatively inexpensive means to analyze the expression of the seventeen interferon subtype transcripts.

This protocol describes a high-throughput qRT-PCR assay for the analysis of type I and III IFN expression signatures. The assay discriminates single base pair differences between the highly similar transcripts of these genes. Through batch assembly and robotic pipetting, the assays are consistent and reproducible.

Described in this report is a qRT-PCR assay for the analysis of seventeen human IFN subtypes in a 384-well plate format that incorporates highly specific ...

Development and Validation of a Quantitative PCR Method for Equid Herpesvirus-2 Diagnostics in Respiratory Fluids

The protocol describes a quantitative RT-PCR method for the detection and quantification of EHV-2 in equine respiratory fluids according to the NF U47-600 norm. After the development and first validation step, two distinct characterization steps were performed according to the AFNOR norm: (a) characterization of the qRT-PCR assay alone and (b) characterization of the whole analytical method. The validation of the whole analytical method included the portrayal of all steps between the extraction of nucleic acids and the final PCR analysis. 
Validation of the whole method is very important for virus detection by qRT-PCR in order to get an accurate determination of the viral genome load. Since the extraction step is the primary source of loss of biological material, it may be considered the main source of error of quantification between one protocol and another. For this reason, the AFNOR norm NF-U-47-600 recommends including the range of plasmid dilution before the extraction step. In addition, the limits of quantification depend on the source from which the virus is extracted. Viral genome load results, which are expressed in international units (IU), are easier to use in order to compare results between different laboratories. 
This new method of characterization of qRT-PCR should facilitate the harmonization of data presentation and interpretation between laboratories.

Here, we present a protocol for the development and validation of a quantitative PCR method used for the detection and quantification of EHV-2 DNA in equine respiratory fluids. The EHV-2 qRT-PCR validation protocol involves a three-part procedure: development, characterization of qRT-PCR assay alone, and characterization of the whole analytical method.

The protocol describes a quantitative RT-PCR method for the detection and quantification of EHV-2 in equine respiratory fluids according to the NF U47-600 ...

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, therefore, suitable to be used for routine purposes. For best resolution, data evaluation and data management, a miniaturized electrophoresis system is required. Together with such an electrophoresis system and the in-house developed software (freely available here) assignment of the pattern of bands to a genotype is standardized and straight forward. DNA extraction is simple (boiling prep), setting-up of the reactions is easy and they can be run on any standard PCR machine. PCR cycling is common except prolonged ramping and elongation times. Compared to spa typing and Multi Locus Sequence Typing (MLST), RS-PCR does not require DNA sequencing what simplifies the analysis considerably and allows a high throughput. Furthermore, the resolution for bovine strains of S. aureus is at least as good as spa typing and better than MLST or pulsed-field gel electrophoresis (PFGE). The RS-PCR data base includes presently a total of 141 genotypes and variants. The method is highly associated with the virulence gene pattern, contagiosity and pathogenicity of S. aureus strains involved in bovine mastitis. S. aureus genotype B (GTB) is contagious and causes herds problems causing large costs in the Switzerland and other European countries. All the other genotypes observed in Switzerland infect individual cows and quarters. Genotyping by RS-PCR allows the reliable prediction of the epidemiological and the pathogenic potential of S. aureus involved in bovine intramammary infection (IMI), two key factors for clinical veterinary medicine. Because of these beneficial properties together with moderate costs and a high sample throughput the goal of this publication is to give a detailed, step-by-step protocol for easily establishing and running RS-PCR for genotyping S. aureus in other laboratories.

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR RS-PCR

Here, ribosomal spacer PCR (RS-PCR) is used together with a miniaturized electrophoresis system as a fast and high resolution method for genotyping S. aureus at moderate costs allowing a high throughput.

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, ...

High-throughput Detection of Respiratory Pathogens in Animal Specimens by Nanoscale PCR

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of combining reactions together. We designed and evaluated a panel based on this principle to rapidly identify the presence of common disease agents in dogs and horses with acute respiratory illness. This manuscript describes a nanoscale diagnostic PCR workflow for sample preparation, amplification, and analysis of target pathogen sequences, focusing on procedures that are different from microliter scale reactions. In the respiratory panel presented, 18 assays were each set up in triplicate, accommodating up to 48 samples per plate. A universal extraction and pre-amplification workflow was optimized for high-throughput sample preparation to accommodate multiple matrices and DNA and RNA based pathogens. Representative data are presented for one RNA target (influenza A matrix) and one DNA target (equine herpesvirus 1). The ability to quickly and accurately test for a comprehensive, syndrome-based group of pathogens is a valuable tool for improving efficiency and ergonomics of diagnostic testing and for acute respiratory disease diagnosis and management.

High-throughput testing of DNA and RNA based pathogens by nanoscale PCR is described using a syndromic canine and equine respiratory PCR panel.

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of ...

Optimization of a Quantitative Micro-neutralization Assay

The micro-neutralization (MN) assay is a standard technique for measuring the infectivity of the influenza virus and the inhibition of virus replication. In this study, we present the protocol of an imaging-based MN assay to quantify the true antigenic relationships between viruses. Unlike typical plaque reduction assays that rely on visible plaques, this assay quantitates the entire infected cell population of each well. The protocol matches the virus type or subtype with the selection of cell lines to achieve maximum infectivity, which enhances sample contrast during imaging and image processing. The introduction of quantitative titration defines the amount of input viruses of neutralization and enables the results from different experiments to be comparable. The imaging setup with a flatbed scanner and free downloadable software makes the approach high throughput, cost effective, user friendly, and easy to deploy in most laboratories. Our study demonstrates that the improved MN assay works well with the current circulating influenza A(H1N1)pdm09, A(H3N2), and B viruses, without being significantly influenced by amino acid substitutions in the neuraminidase (NA) of A(H3N2) viruses. It is particularly useful for the characterization of viruses that either grow to low HA titer and/or undergo an abortive infection resulting in an inability to form plaques in cultured cells.

This study describes an imaging-based micro-neutralization assay to analyze the antigenic relationships between viruses. The protocol employs a flatbed scanner and has four steps, including titration, titration quantitation, neutralization, and neutralization quantitation. The assay works well with current circulating influenza A(H1N1)pdm09, A(H3N2), and B viruses.

The micro-neutralization (MN) assay is a standard technique for measuring the infectivity of the influenza virus and the inhibition of virus replication. ...

Isolation and Quantitative Evaluation of Brush Cells from Mouse Tracheas

Tracheal brush cells are cholinergic chemosensory epithelial cells poised to transmit signals from the airway lumen to the immune and nervous systems. They are part of a family of chemosensory epithelial cells which include tuft cells in the intestinal mucosa, brush cells in the trachea, and solitary chemosensory and microvillous cells in the nasal mucosa. Chemosensory cells in different epithelial compartments share key intracellular markers and a core transcriptional signature, but also display significant transcriptional heterogeneity, likely reflective of the local tissue environment. Isolation of tracheal brush cells from single cell suspensions is required to define the function of these rare epithelial cells in detail, but their isolation is challenging, potentially due to the close interaction between tracheal brush cells and nerve endings or due to airway-specific composition of tight and adherens junctions. Here, we describe a procedure for isolation of brush cells from mouse tracheal epithelium. The method is based on an initial separation of tracheal epithelium from the submucosa, allowing for a subsequent shorter incubation of the epithelial sheet with papain. This procedure offers a rapid and convenient solution for flow cytometric sorting and functional analysis of viable tracheal brush cells.

Brush cells are rare cholinergic chemosensory epithelial cells found in the na&#239;ve mouse trachea. Due to their limited numbers, ex vivo evaluation of their functional role in airway immunity and remodeling is challenging. We describe a method for isolation of tracheal brush cells by flow cytometry.

Tracheal brush cells are cholinergic chemosensory epithelial cells poised to transmit signals from the airway lumen to the immune and nervous systems. ...

Pan-lyssavirus Real Time RT-PCR for Rabies Diagnosis

Molecular assays are rapid, sensitive and specific, and have become central to diagnosing rabies. PCR based assays have been utilized for decades to confirm rabies diagnosis but have only recently been accepted by the OIE (World Organisation for Animal Health) as a primary method to detect rabies infection. Real-time RT-PCR assays provide real-time data, and are closed-tube systems, minimizing the risk of contamination during setup. DNA intercalating fluorochrome real-time RT-PCR assays do not require expensive probes, minimizing the cost per sample, and when the primers are designed in conserved regions, assays that are specific across virus genera rather than specific to just one virus species are possible. Here we describe a pan-lyssavirus SYBR real-time RT-PCR assay that detects lyssaviruses across the Lyssavirus genus, including the most divergent viruses IKOV, WCBV and LLEBV. In conjunction with dissociation curve analysis, this assay is sensitive and specific, with the advantage of detecting all lyssavirus species. The assay has been adopted in many diagnostic laboratories with quality assured environments, enabling robust, rapid, sensitive diagnosis of animal and human rabies cases.

This real-time RT-PCR using dsDNA intercalating dye is suitable to diagnose lyssavirus infections. The method begins with RNA extracted from rabies suspected ante-mortem or post-mortem samples, detailing master mix preparation, RNA addition, setup of the real-time machine and correct interpretation of results.

Molecular assays are rapid, sensitive and specific, and have become central to diagnosing rabies. PCR based assays have been utilized for decades to ...

Determination of Immune Cell Identity and Purity Using Epigenetic-Based Quantitative PCR

Immune cell subtype population frequencies can have a large effect on the efficacy of T cell therapies. Current methods, like flow cytometry, have specific sample requirements, high sample input, are low throughput, and are difficult to standardize, all of which are detrimental to characterization of cell therapy products during their development and manufacturing.
The assays described herein accurately identify and quantify immune cell types in a heterogeneous mixture of cells using isolated genomic DNA (gDNA). DNA methylation patterns are revealed through bisulfite conversion, a process in which unmethylated cytosines are converted to uracils. Unmethylated DNA regions are detected through qPCR amplification using primers targeting converted areas. One unique locus per assay is measured and serves as an accurate identifier for a specific cell type. The assays are robust and identify CD8+, regulatory, and Th17 T cells in a high throughput manner. These optimized assays can potentially be used for in-process and product release testing for cell therapy process.

Here we describe a robust method of determining immune cell identity and purity through epigenetic signatures detected using quantitative PCR (qPCR). DNA demethylation at a specific locus serves as a unique identifier for a particular cell type and allows for identification of CD8+, regulatory, or Th17 T cells.

Immune cell subtype population frequencies can have a large effect on the efficacy of T cell therapies. Current methods, like flow cytometry, have ...

Localization and Quantification of Begomoviruses in Whitefly Tissues by Immunofluorescence and Quantitative PCR

Begomoviruses (genus Begomovirus, family Geminiviridae) are transmitted by whiteflies of the Bemisia tabaci complex in a persistent, circulative manner. Considering the extensive damage caused by begomoviruses to crop production worldwide, it is imperative to understand the interaction between begomoviruses and their whitefly vector. To do so, localization and quantification of the virus in the vector tissues is crucial. Here, using tomato yellow leaf curl virus (TYLCV) as an example, we describe a detailed protocol to localize begomoviruses in whitefly midguts, primary salivary glands, and ovaries by immunofluorescence. The method is based on the use of specific antibodies against a virus coat protein, dye-labeled secondary antibodies, and a confocal microscope. The protocol can also be used to colocalize begomoviral and whitefly proteins. We further describe a protocol for the quantification of TYLCV in whitefly midguts, primary salivary glands, hemolymph, and ovaries by quantitative PCR (qPCR). Using primers specifically designed for TYLCV, the protocols for quantification allow the comparison of the amount of TYLCV in different tissues of the whitefly. The described protocol is potentially useful for the quantification of begomoviruses in the body of a whitefly and a virus-infected plant. These protocols can be used to analyze the circulation pathway of begomoviruses in the whitefly or as a complement to other methods to study whitefly-begomovirus interactions.

We describe an immunofluorescence and quantitative PCR method for the localization and quantification of begomoviruses in insect tissues. The immunofluorescence protocol can be used to colocalize viral and vector proteins. The quantitative PCR protocol can be extended to quantify viruses in whole whitefly bodies and virus-infected plants.

Begomoviruses (genus Begomovirus, family Geminiviridae) are transmitted by whiteflies of the Bemisia tabaci complex in a persistent, circulative manner. ...