Os autores gostariam de agradecer a assessoria técnica e apoio de Ren Sun (University of California, Los Angeles) e Hwang Seungmin (Washington University). Este trabalho foi financiado pela Fundação Baxter, National Institutes of Health subvenções (R01 e R21 CA140964 AI083841 para C. Liang).

O protocolo a seguir irão descrever o estudo dos títulos de vírus e de cargas genoma viral no ciclo de infecção lítica e latente de γHV68 em camundongos, o que teoricamente pode ser usado para avaliar a infecção por outros vírus partilha estilo de vida semelhante ao de γHV68. 1. Amplificação de γHV68 <ol><li> Descongelar um frasco frozen da γHV68 em 37 ° C banho-maria. </li><li> Adicionar inóculo viral para NIH3T12 ou cultura de células 3T3 (~ 50% confluência) em 10 pratos cm e cultura as células infectadas a 37 ° C em 5% CO 2. </li><li> Examine a cultura por microscopia de efeito citopático (CPE) e recolher a mídia no momento em que mais de 80% das células mostram CPE 4 ~ 5 dias após a infecção. Para maximizar o rendimento de vírus, a cultura de células infectadas pode ser congelado e descongelado duas vezes para liberar todos os associados a células γHV68. </li><li> Centrífuga a mídia coletados em 1000 rpm por 5 min à temperatura ambiente (RT) para remover restos celulares. </li><li> Transferir cuidadosamente o sobrenadante para novos tubos (alta velocidade tubo de centrifugação), sem tocar os restos celulares na parte inferior. </li><li> Alta velocidade de centrifugação a 12.000 rpm (para Sorvall SA-600) a 4 ° C durante pelo menos 1,5 horas de concentração de partículas virais. </li><li> Descartar o sobrenadante em solução de água sanitária 10γ e cuidadosamente re-suspender o pellet (vírus e restos celulares residual) com 1 ml de soro livre de DMEM. Transferir o pellet ressuspendido em um tubo de 1,5 ml micro centrífuga e misturar bem em vórtice. </li><li> Centrifugar por 2 minutos na velocidade máxima para remover restos celulares residual e transferir o sobrenadante (stock de vírus) para um novo tubo. Este é o estoque final para a infecção viral. O título do estoque de vírus é determinado pelo ensaio de placa (veja abaixo). </li></ol> 2. A infecção intranasal de camundongos com γHV68 <ol><li> Infectar camundongos em ~ 6 semanas de idade com 1.000 ~ 5.000 unidades formadoras de placa (UFP) de camundongos por γHV68. </li><li> Anestesiarcamundongos pela injeção de cetamina / xilazina (60 mL / mouse de uma mistura de 80 mg / ml de ketamina e 12 mg / ml de xilazina) na cavidade peritoneal. Monitorar anestesia apertando o dedo do pé camundongos. Geralmente, leva ~ 5-10 min. Se os ratos não são totalmente anestesiados, eles vão espirrar o vírus. </li><li> Quando o mouse está totalmente anestesiado, use uma pipeta para inocular ~ mL de PBS contendo 30 γHV68 (15 mL em cada narina) a camundongos gota-a-gota lenta mas firmemente. Certifique-se o mouse é realmente inalar as gotas sem tentar formar bolhas. </li><li> Permitir que o mouse para se recuperar por 10-15 min e monitorar o bem-estar dos ratos (por exemplo, a consciência de respiração, etc) antes de devolvê-los para a jaula. Os animais são verificadas diariamente para a doença e adequação de alimentos, água, e as condições de cama. Se os sinais clínicos de dor, doença ou angústia desenvolver, de diagnóstico de rotina para determinar a etiologia será conduzida. Animais que perdem mais de 20% do seu peso corporal será gravado para a perda de peso máximoe sacrificados. A decisão final de realizar a eutanásia é a critério do veterinário clínico e é tomada após consulta com o investigador principal. </li></ol> 3. Ensaio de placa para determinar o título de vírus em Pulmões com infecção aguda <ol><li> Títulos de infectividade do vírus são determinadas pela formação de placas em monocamadas de células Vero. </li><li> As células Vero são semeados em 2.5x10 4 células / poço em placas de 12 poços na véspera do ensaio de placa. As células devem ser distribuídas uniformemente ea densidade celular deve chegar a 30-40% no dia do ensaio de placa. </li><li> Prepare 0,5% (w / v) metilcelulose (MC) meio de cobertura (Tabela 1). </li><li> Sacrifício γHV68 camundongos infectados 5-7 dias após a infecção intranasal para determinar os títulos de fase aguda do vírus nos pulmões. Para eutanásia Ketamine HCl (80-100 mg / kg SC, IM, IP) será administrado IM seguido por overdose intravenosa de pentobarbital Na (30-50 IP mg / kg). Este método é aprovado pelo tele American Veterinary Medical Association. </li><li> Colheita dos pulmões e enxaguar duas vezes com 1 x PBS para remover células do sangue. Coletar um lado do pulmão em 1 ml de meio DMEM gelada completa e manter em gelo. Rapidamente congelar o outro lado dos pulmões e armazenar a -80 ° C para o exame de DNA viral cargas nos pulmões por qPCR (veja abaixo). </li><li> Use um homogeneizador de tecido para homogeneizar tecidos pulmonares em velocidade máxima por 1 segundo, congelar e descongelar-três vezes. Lave o homogeneizador com etanol 70% a cada passo quando se muda a amostra. </li><li> Centrifugar os tecidos homogeneizados a 3.000 rpm por 10 min a 4 ° C. Coletar o sobrenadante e transferir para novos tubos de ensaio de placa. </li><li> Prepare diluições em série (geralmente de 10 ° a 10 -8) das amostras de pulmão homogeneizado em 1,5 ml micro-centrífuga tubos com DMEM puro por vortex. Prefill o número apropriado de sondas com 540 mL DMEM e diluir 60 mL homogeneizado para o primeiro tubo. Transferir 60 mL do primeiro tubo inão um outro, e assim por diante. </li><li> Aspirar a mídia da monocamadas preparado Vero nas placas de 12 poços e carga de 200 mL / homogeneizado bem serialmente diluída contendo vírus infeccioso em ordem inversa (de 10 ° -8 a 10). Use dois poços para cada titulação (em duplicado). </li><li> Incubar as células Vero com o vírus inóculo 1 hora a 37 ° C. Agite suavemente as placas a cada 15 minutos para distribuir uniformemente o vírus sobre a monocamada. </li><li> Remover o inóculo e substituí-lo com 2 ml / poço do meio de cobertura (Tabela 1). Incubar as placas por uma semana a 37 ° C. </li><li> Remova o meio de overlay (não precisa ser completo) e substituir com a correção / médio mancha de ensaio de placa (Tabela 1) e incubar por pelo menos 1 hora em temperatura ambiente. </li><li> Quando as placas são secas, contar o número de bem-isolado placas em cada diluição. Para minimizar o erro, apenas os poços contendo entre 10 e 100 placas são contados. </li><li> Calcule o título de vírus usando o seguinasa fórmula: título (UFP / ml) = [(número de placas / poço) / (volume de inóculo / poço)] x fator de diluição. </li></ol> 4. Ensaio Centro infecciosas para determinar a carga de vírus em esplenócitos latentes infectadas <ol><li> Carga viral latente é determinada pela infecciosas centro de ensaio (IC) sobre a monocamada de células Vero. Um dia antes do ensaio IC células, sementes Vero em 6-lamelas (1 -. 2,5 X 10 5 células / poço Normalmente, usamos 11 poços por amostra baço, 10 poços serão utilizados para a suspensão esplenócitos serialmente diluída e um poço para testes reativação espontânea do vírus após ciclos de congelamento e descongelamento. </li><li> Sacrifício dos camundongos infectados após a latência é estabelecida (12-14 dias após a infecção). Colheita do baço de rato e piscina-los em 1 ml DMEM refrigerados. </li><li> Dissociação mecânica do baço mouse. Transferir o baço de rato recém-isoladas em uma placa de 10 cm e adicionar 10 ml de meio DMEM desejado, como com 2% de SFB. Wet dois fosco-end de vidro Microscslides com ope gelada médio. Coloque o baço no lado fosco de um slide e nick da cápsula com a borda do fim do slide fosco outros. Mecanicamente dissociar o baço entre dois slides até que todos os aglomerados vermelho são esmagados (também remover partículas de gordura se houver). </li><li> Lavar as lâminas com DMEM para recuperar as células restantes em ambos os slides. </li><li> Transferir a suspensão de tecido toda suavemente através de um filtro celular (40 mesh nylon mm) em um tubo de 50 ml com tampa de rosca cônica. Lave o prato de 10 cm que contém o baço homogeneizados com 10 ml de PBS e transferir ao mesmo tempo de filtragem. </li><li> Centrifugar a única célula suspensões 10 min a 375 xg e descartar o sobrenadante. Flick o pellets de células para quebrar aglomerados de células existentes. Adicionar 5 ml de tampão ACK (Tabela 1) para lisar as células vermelhas do sangue. Incubar 5 min e centrifugar novamente a 375 x g. </li><li> Desprezar o sobrenadante e re-suspender as pelotas, completamente, mas delicadamente, em PBS com 2% de SFB. Manter as células a 4 ° C. Use uma pipeta pararemover os resíduos, se houver. Contagem de células viáveis ​​utilizando um contador automático de células (Bio-Rad). </li><li> Girar o esplenócitos PBS-ressuspenso em 375 xg durante 4 min. Elimine o sobrenadante e ressuspender as células em 4 ml DMEM completo (2 x 1 ml será usado para o ensaio IC da suspensão original; 0,6 ml utilizado para a diluição cinco vezes de série em ensaio de IC; 0,4 ml para a preparação de DNA viral e qPCR, e 1 ml de suspensão será usada para avaliar a reativação espontânea do vírus latente após três ciclos de congelamento e descongelamento) </li><li> Prepare série de cinco diluições (ou seja, 05/01, 25/01, 1 / 125, 1 / 250) de esplenócitos suspensão em duplicatas. Prefill a 15 ml tubos cônicos com 2,4 ml DMEM e diluir 600 mL de suspensão esplenócitos para o primeiro tubo e misture bem. Transferência de 600 mL do tubo anterior no tubo seguinte, etc Não vortex! </li><li> Aspirar o meio da monocamada 6-bem preparado de células Vero. Ml sementes 1 da série esplenócitos diluída em células Vero com cada diluição duplocupadas com (10 poços serão utilizados para 0, 05/01, 25/01, 1 / 125, 1 / 250 diluições). </li><li> Incubar as placas em 12/08 horas a 37 ° C e 5% CO 2. Não excedam 24 horas. Aspirar o semeado suspensão esplenócitos e carga 4 ml de sobreposição de mídia (Tabela 1) a cada poço. Incubar por mais 6 dias. </li><li> Determinar os níveis dos centros de baço infecciosas através da coloração das placas com 0,2% (w / v) violeta cristal como mostrado no ensaio de placa. </li></ol> 5. Quantificação do genoma viral <ol><li> Extrair DNA genômico total dos tecidos γHV68 infectados, como pulmão e baço amostras neste experimento. Use o Sangue Dneasy Kit &amp; Tissue (Qiagen), seguindo protocolo do fabricante. </li><li> Determinar a concentração de DNA de cada amostra para garantir a mesma quantidade de DNA a ser utilizado para o ensaio qPCR. Projetar o vírus primers específicos (~ 200 pb amplicon é o preferido para um ensaio de qPCR). Usamos o γHV68 ORF56 primers específicos (primer para a frente: 5 e prime; - GTAACTCGAGACTGAAACCTCGCAGAGGTCC - 3 &#39;; reverse primer: 5&#39;-CCGAAGCTTGCACGGTGCAATGTGTCACAG-3&#39;) para este ensaio e β-actina primers (forward primer: 5&#39;-cacccacactgtggcccatcat-3 &#39;reverse primer: 5&#39;-gtgaggatcttcatgaggtagtc-3&#39;), como um controle para a reação qPCR. </li><li> Misturar a amostra de DNA (100 - 500 ng é bom) e primers apropriados com 2 x SYBR mestre mix (Bio-Rad iQ SYBR Green Supermix). Use a Bio-Rad Real-Time PCR System para quantificar a carga viral nos tecidos infectados. Executar PCR na seguinte condição: 95 ° C por 15 min e 45 ciclos de 95 ° C por 30 min, 60 ° C por 30 min e 72 ° C por 30 min, seguido pela fusão análises curva, para ambos os vírus e amplicons de actina. </li><li> Para fazer uma curva padrão para a quantificação de genomas virais, em série diluir quantidades conhecidas de um DNA γHV68 bacmid com o DNA genômico isolado a partir de células não infectadas. QPCR executar em paralelo com o DNAs obtidos a partir do infectecidos ted usando os mesmos conjuntos de vírus de primers específicos. </li><li> Presente a carga genoma viral nos tecidos como o número de DNA viral cópia por unidade (por exemplo 100 ou 500 ng ng) de DNA genômico após a normalização de actina. </li></ol> 6. Resultados representativos: A Figura 1 mostra o esquema geral dos experimentos para a medição de γHV68 infecção em camundongos in vivo. Resultados representativos dos títulos de vírus nos pulmões durante a infecção aguda de γHV68, conforme determinado pelo ensaio de placa, foram mostrados na Figura 2A. A cepa mutante de γHV68 contendo não-funcionais viral Bcl-2 (vBcl-2) replicadas em níveis comparáveis ​​aos do tipo selvagem γHV68 nos pulmões após 7 dias de infecção intranasal de camundongos BALB / c (6-7 ratos por grupo). Não houve diferenças estatisticamente significativas nos títulos de pulmão do vírus foram detectados entre os dois grupos. Estes dados indicam que vBcl-2 não é um fator crucial na infecção aguda da γHV68 emcamundongos. No entanto, até 28 de postinfection dias, o título de vBcl-2 vírus mutante na baços caiu 6 - a 10 - vezes em comparação com o WT, medida pelo ensaio de centro infecciosas (Figura 2B), sugerindo que a vBcl-2 mutante γHV68 vírus está com defeito na manutenção da latência do baço após a infecção. De acordo com a redução títulos centro infecciosas, a carga viral do genoma do vírus vBcl-2 mutante foi severamente reduzida comparada com a de vírus WT no dia 28 em experiências repetidas, como mostrado na Figura 2C. A estreita correlação entre as cargas genoma viral ea freqüência de latente-HV68vBcl-2 mutante vivo ex reativação do vírus na fase latente da infecção destaca um defeito de latência desta infecção pelo vírus mutante. <img alt="Figura 1" src="/files/ftp_upload/3472/3472fig1.jpg" /> Figura 1. Diagrama esquemático para a medição de γHV68 infecção em camundongos por meio da formação de placas, centro infecciosas e ensaio qPCRs. <img alt="Figura 2" src="/files/ftp_upload/3472/3472fig2.jpg" /> Figura 2. Líticas e infecção latente do WT e mutantes γHV68 vírus in vivo. Replicação aguda (A) do WT e vBcl-2 mutante γHV68 vírus nos pulmões dos ratos BALB / c em 7 dpi (infecção pós dia) foi determinada por ensaio de placa. (B e C) Esplênica centros infecciosas (B) e carga viral do genoma (C) no baço de camundongos infectados foram medidos em 28 dpi por ensaio centro infecciosas e qPCR, respectivamente. Linhas vermelhas, as médias dos valores indicados. ns, não significativo.

<ol>
	<li>Damania, B., Choi, J. K., Jung, J. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Signaling+activities+of+gammaherpesvirus+membrane+proteins.">Signaling activities of gammaherpesvirus membrane proteins.</a> J. Virol. 74, 1593-1601 (2000).</li><li>Stevenson, P. G., Efstathiou, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+mechanisms+in+murine+gammaherpesvirus-68+infection.">Immune mechanisms in murine gammaherpesvirus-68 infection.</a> Viral. Immunol. 18, 445-456 (2005).</li><li>Flano, E., Husain, S. M., Sample, J. T., Woodland, D. L., Blackman, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Latent+murine+gamma-herpesvirus+infection+is+established+in+activated+B+cells,+dendritic+cells,+and+macrophages.">Latent murine gamma-herpesvirus infection is established in activated B cells, dendritic cells, and macrophages.</a> J. Immunol. 165, 1074-1081 (2000).</li><li>Sunil-Chandra, N. P., Efstathiou, S., Nash, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+establishes+a+latent+infection+in+mouse+B+lymphocytes+in+vivo.">Murine gammaherpesvirus 68 establishes a latent infection in mouse B lymphocytes in vivo.</a> J. Gen. Virol. 73, 3275-3279 (1992).</li><li>Simas, J. P., Swann, D., Bowden, R., Efstathiou, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+murine+gammaherpesvirus-68+transcription+during+lytic+and+latent+infection.">Analysis of murine gammaherpesvirus-68 transcription during lytic and latent infection.</a> J. Gen. Virol. 80, 75-82 (1999).</li><li>Ganem, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KSHV+and+the+pathogenesis+of+Kaposi+sarcoma:+listening+to+human+biology+and+medicine.">KSHV and the pathogenesis of Kaposi sarcoma: listening to human biology and medicine.</a> J. Clin. Invest. 120, 939-949 (2010).</li><li>Wen, K. W., Damania, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kaposi+sarcoma-associated+herpesvirus+(KSHV):+molecular+biology+and+oncogenesis.">Kaposi sarcoma-associated herpesvirus (KSHV): molecular biology and oncogenesis.</a> Cancer. Lett. 289, 140-150 (2009).</li><li>E, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Bcl-2-mediated+evasion+of+autophagy+aids+chronic+infection+of+gammaherpesvirus+68.">Viral Bcl-2-mediated evasion of autophagy aids chronic infection of gammaherpesvirus 68.</a> PLoS. Pathog. 5, e1000609-e1000609 (2009).</li><li>Marques, S., Efstathiou, S., Smith, K. G., Haury, M., Simas, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+gene+expression+of+latent+murine+gammaherpesvirus+68+in+B+lymphocytes.">Selective gene expression of latent murine gammaherpesvirus 68 in B lymphocytes.</a> J. Virol. 77, 7308-7318 (2003).</li><li>McCausland, M. M., Crotty, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+PCR+technique+for+detecting+lymphocytic+choriomeningitis+virus+in+vivo.">Quantitative PCR technique for detecting lymphocytic choriomeningitis virus in vivo.</a> J. Virol. Methods. 147, 167-176 (2008).</li><li>Weck, K. E., Kim, S. S., Virgin, H. I., Speck, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cells+regulate+murine+gammaherpesvirus+68+latency.">B cells regulate murine gammaherpesvirus 68 latency.</a> J. Virol. 73, 4651-4661 (1999).</li><li>Weck, K. E., Kim, S. S., Virgin, H. I., Speck, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Macrophages+are+the+major+reservoir+of+latent+murine+gammaherpesvirus+68+in+peritoneal+cells.">Macrophages are the major reservoir of latent murine gammaherpesvirus 68 in peritoneal cells.</a> J. Virol. 73, 3273-3283 (1999).</li></ol>

Não há conflitos de interesse declarados.

γHV68 tem sido amplamente utilizado como modelo para compreender a patogênese da humana γ-HVs 2,4,5. Neste protocolo, descrevemos três métodos rotineiramente usados, incluindo ensaio de placa para o título de vírus infecciosos, teste de IC para carga viral latente, e qPCR para carga genoma viral, para avaliar a infecção aguda e latente de γHV68 após a inoculação intranasal em camundongos. O ensaio de placa tem sido amplamente utilizado para determinar o título de ví...

<table border="1"><tbody><tr><td> Nome do material </td><td> Procedimento de preparação </td></tr><tr><td> Metilcelulose meio de cobertura (MC) para o ensaio de placa viral </td><td><ol><li> Calor ~ 250 ml de água destilada em frasco para TC&gt; 80 ° C (a ferver durante 3 minutos no microondas) </li><li> Adicionar gradualmente 2,5 g de pó MC em água aquecida, mexendo em fogo baixo até dissolver. </li><li> Autoclave imediatamente por 15 min no ciclo de líquido. </li><li> Agitando os meios de comunicação MC autoclavados a 4 ° C durante a noite. </li><li> Combine 250 ml MC mídia com 200ml 2 x MEM (Gibco-BRL) + 50 ml FBS dar 500 ml de mídia overlay. </li></ol></td></tr><tr><td> Fix / mancha meio de ensaio de placa </td><td> 0,2% (w / v) cristal violeta em etanol 20%. </td></tr><tr><td> Tampão de Lise ACK </td><td> NH 4 Cl 0,15 M, KHCO 3 10mM, EDTA 0,1 mM </td></tr><tr><td> DMEM completo </td><td> Meio modificado Dulbecco Águia(DMEM) suplementado com 10% de soro fetal bovino (FBS; Invitrogen), 2 mM L-glutamina, e 1% de penicilina-estreptomicina (Gibco-BRL). </td></tr></tbody></table> Tabela 1. Mídias específicas utilizadas neste protocolo <table border="1"><tbody><tr><td> Nome do reagente </td><td> Companhia </td><td> Número de catálogo </td></tr><tr><td> Ketamina </td><td> Sigma-Aldrich </td><td> K2753 </td></tr><tr><td> Xilazina </td><td> Sigma-Aldrich </td><td> X1251 </td></tr><tr><td> Metilcelulose </td><td> Sigma-Aldrich </td><td> M0512-250g </td></tr><tr><td> 2 x MEM </td><td> Life Technologies </td><td> 11935 </td></tr><tr><td> Coador celular </td><td> BD Faclon </td><td> 352340 </td></tr><tr><td> Omni tecido homogeneizador </td><td> OMNI Internacional </td><td> TH115 </td></tr><tr><td> Sangue Dneasy &amp; Tissue Kit </td><td> Qiagen </td><td> 69504 </td></tr><tr><td> iQTM SYBRH Verde Supermix </td><td> BioRad </td><td> 170-8882 </td></tr><tr><td> CFX96 sistema em tempo real PCR </td><td> Bio-Rad </td><td> 184-5072 </td></tr><tr><td> Contador de células </td><td> Bio-Rad </td><td> 145-0001 </td></tr><tr><td> Sorvall SA-600 </td><td> Thermo Scientific </td><td> 096-124022 </td></tr></tbody></table> Tabela 2. Reagentes específicos e equipamentos

measurement of &#947;hv68 infection in mice

γ-Herpesviruses (γ-HVS) são notáveis ​​por sua capacidade de estabelecer infecções latentes de células linfóides 1. A gama de hospedeiros humanos estreito de γ-HVS, como EBV e KSHV, foi severamente prejudicado estudos detalhados patogênicos. Murino γ herpesvirus-68 (γHV68) ações extensa semelhanças genéticas e biológicas humanas com γ-HVS e é um patógeno natural de roedores murids 2. Portanto, a avaliação de γHV68 infecção de camundongos cepas puras em diferentes estágios da infecção viral fornece um modelo importante para a compreensão do ciclo de vida viral e patogênese durante γ-HVs infecção. Após inoculação intranasal, γHV68 infecção resulta em viremia aguda no pulmão, que é posteriormente resolvido em uma infecção latente de esplenócitos e outras células, que pode ser reativada ao longo da vida do hospedeiro 3,4. Neste protocolo, vamos descrever como usar a placa de ensaio para avaliars título de vírus infeccioso no pulmão homogeneizados em monocamadas de células Vero na fase inicial (5-7 dias) do pós-infecção intranasal (dpi). Quando a infecção aguda é em grande parte limpa 2-3 postinfection semanas, uma infecção latente de γHV68 é estabelecida em torno de 14 dpi e mantido posteriormente no baço dos camundongos. Infecção latente geralmente afeta uma população muito pequena de células nos tecidos infectados, segundo o qual o vírus permanece latente e desliga a maioria de sua expressão gênica. Esplenócitos latentemente infectadas pelo vírus espontaneamente reativar sobre explanting em cultura de tecidos, que pode ser reproduzido por um centro de ensaio infecciosas (IC) para determinar a carga viral latente. Para melhor estimar a quantidade de cópias do genoma viral na forma aguda e / ou tecidos infectados de forma latente, quantitativa PCR em tempo real (qPCR) é usado para a sua sensibilidade máxima e precisão. As análises combinadas dos resultados da qPCR e placa de ensaio, e / ou ensaio IC irá revelar os perfis espaço-temporal de viralreplicação e infectividade in vivo.

Watch this Scientific Journal Video about Measurement of Î³HV68 Infection in Mice at JoVE.com

Measurement of &amp;#947;HV68 Infection in Mice

γ-Herpesviruses (γ-HVS) estabelecer ao longo da vida a persistência em seus hospedeiros. Infecção de camundongos com γ-HV68 oferece uma geneticamente tractable<em&gt; In vivo</em&gt; Modelo para a caracterização do ciclo de vida / patogênese da γHVs. Este protocolo descreve a detecção e quantificação de γHV68 infecção em fase aguda e após a infecção latente por placas formadoras de centro, infecciosas, e ensaios de qPCR.

Medição de γHV68 Infecção em Camundongos

&gamma;-Herpesviruses (&gamma;-HVs) are notable for their ability to establish latent infections of lymphoid cells1. The narrow host range of human ...

Research

JoVE Journal

Immunology and Infection

Measurement of &#947;HV68 Infection in Mice

13.5K visualizações.  University of Southern California, Los Angeles. γ-Herpesviruses (γ-HVS) estabelecer ao longo da vida a persistência em seus hospedeiros. Infecção de camundongos com γ-HV68 oferece uma geneticamente tractable In vivo Modelo para a caracterização do ciclo de vida / patogênese da γHVs. Este protocolo descreve a detecção e quantificação de γHV68 infecção em fase aguda e após a infecção latente por placas formadoras de centro, infecciosas, e ensaios de qPCR.

Vídeo: Measurement of &#947;HV68 Infection in Mice

A Method for Labeling Vasculature in Embryonic Mice

The establishment of a functional blood vessel network is an essential part of organogenesis, and is required for optimal organ function. For example, in the thymus proper vasculature formation and patterning is essential for thymocyte entry into the organ and mature T-cell exit to the periphery. The spatial arrangement of blood vessels in the thymus is dependent upon signals from the local microenvironment, namely thymic epithelial cells (TEC). Several recent reports suggest that disruption of these signals results in thymus blood vessel defects 1,2. Previous studies have described techniques used to label the neonatal and adult thymus vasculature 1,2. We demonstrate here a technique for labeling blood vessels in the embryonic thymus. This method combines the use of FITC-dextran or Griffonia (Bandeiraea) Simplicifolia Lectin I (GSL 1 - isolectin B4) facial vein injections and CD31 antibody staining to identify thymus vascular structures and PDGFR-&beta; to label thymic perivascular mesenchyme 3-5. The option of using cryosections or vibratome sections is also provided. This protocol can be used to identify thymus vascular defects, which is critical for defining the roles of TEC-derived molecules in thymus blood vessel formation. As the method labels the entire vasculature, it can also be used to analyze the vascular networks in multiple organs and tissues throughout the embryo including skin and heart 6-10.

This article describes a method for labeling embryonic skin and thymus blood vessels.

Um método para Etiquetagem Vascularização no embrião do rato

The establishment of a functional blood vessel network is an essential part of organogenesis, and is required for optimal organ function. For example, in ...

Imunologia e Infecção

Measurement of Cytosolic Ca2+ in Isolated Contractile Lymphatics

Lymphatic vessels comprise a multifunctional transport system that maintains fluid homeostasis, delivers lipids to the central circulation, and acts as a surveillance system for potentially harmful antigens, optimizing mucosal immunity and adaptive immune responses1. Lymph is formed from interstitial fluid that enters blind-ended initial lymphatics, and then is transported against a pressure gradient in larger collecting lymphatics. Each collecting lymphatic is made up of a series of segments called lymphangions, separated by bicuspid valves that prevent backflow. Each lymphangion possesses a contractile cycle that propels lymph against a pressure gradient toward the central circulation2. This phasic contractile pattern is analogous to the cardiac cycle, with systolic and diastolic phases, and with a lower contraction frequency4. In addition, lymphatic smooth muscle generates tone and displays myogenic constriction and dilation in response to increases and decreases in luminal pressure, respectively5. A hybrid of molecular mechanisms that support both the phasic and tonic contractility of lymphatics are thus proposed.
Contraction of smooth muscle is generally regulated by the cytosolic Ca2+ concentration ([Ca2+]i) plus sensitivity to Ca2+, of the contractile elements in response to changes in the environment surrounding the cell6. [Ca2+]i is determined by the combination of the movement of Ca2+ through plasma membrane ligand or voltage gated Ca2+ channels and the release and uptake of Ca2+ from internal stores. Cytosolic Ca2+ binds to calmodulin and activates enzymes such as myosin light chain (MLC) kinase (MLCK), which in turn phosphorylates MLC leading to actin-myosin-mediated contraction8. However, the sensitivity of this pathway to Ca2+ can be regulated by the MLC phosphatase (MLCP)9. MLCP activity is regulated by Rho kinase (ROCK) and the myosin phosphatase inhibitor protein CPI-17.
Here, we present a method to evaluate changes in [Ca2+]i over time in isolated, perfused lymphatics in order to study Ca2+-dependent and Ca2+-sensitizing mechanisms of lymphatic smooth muscle contraction. Using isolated rat mesenteric collecting lymphatics we studied stretch-induced changes in [Ca2+]i and contractile activity. The isolated lymphatic model offers the advantage that pressure, flow, and the chemical composition of the bath solution can be tightly controlled. [Ca2+]i was determined by loading lymphatics with the ratiometric, Ca2+-binding dye Fura-2. These studies will provide a new approach to the broader problem of studying the different molecular mechanisms that regulate phasic contractions versus tonic constriction in lymphatic smooth muscle.

Measurement of Cytosolic Ca2+ in Isolated Contractile Lymphatics

We introduce an approach to evaluate the cytosolic Ca2+ concentration in isolated lymphatics to study Ca2+-dependent and Ca2+-sensitizing mechanisms of lymphatic smooth muscle contraction.

Medição do Ca citosólico 2 + Em Isolated linfáticos contráteis

Lymphatic vessels comprise a multifunctional transport system that maintains fluid homeostasis, delivers lipids to the central circulation, and acts as a ...

4D Multimodality Imaging of Citrobacter rodentium Infections in Mice

This protocol outlines the steps required to longitudinally monitor a bioluminescent bacterial infection using composite 3D diffuse light imaging tomography with integrated &mu;CT (DLIT-&mu;CT) and the subsequent use of this data to generate a four dimensional (4D) movie of the infection cycle. To develop the 4D infection movies and to validate the DLIT-&mu;CT imaging for bacterial infection studies using an IVIS Spectrum CT, we used infection with bioluminescent C. rodentium, which causes self-limiting colitis in mice. In this protocol, we outline the infection of mice with bioluminescent C. rodentium and non-invasive monitoring of colonization by daily DLIT-&mu;CT imaging and bacterial enumeration from feces for 8 days.
The use of the IVIS Spectrum CT facilitates seamless co-registration of optical and &mu;CT scans using a single imaging platform. The low dose &mu;CT modality enables the imaging of mice at multiple time points during infection, providing detailed anatomical localization of bioluminescent bacterial foci in 3D without causing artifacts from the cumulative radiation. Importantly, the 4D movies of infected mice provide a powerful analytical tool to monitor bacterial colonization dynamics in vivo.

4D Multimodality Imaging of Citrobacter rodentium Infections in Mice

Multi-modality imaging is a valuable approach for studying bacterial colonization in small animal models. This protocol outlines infection of mice with bioluminescent Citrobacter rodentium and the longitudinal monitoring of bacterial colonization using composite 3D diffuse light imaging tomography with &mu;CT imaging to create a 4D movie of C. rodentium infection.

4D Multimodalidade de imagens de<em&gt; Citrobacter rodentium</em&gt; Infecções em Ratos

This protocol outlines the steps required to  longitudinally monitor a bioluminescent bacterial infection using composite 3D diffuse light imaging ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

Crônica de Longo Prazo<em&gt; Pseudomonas aeruginosa</em&gt; Infecção das vias aéreas em ratos

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

A Method for the Measurement of Salivary Gland Function in Mice

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced saliva production. Similarly, saliva production is severely compromised in patients receiving radiation treatment for head and neck cancers. Rodent models, developed to mimic these clinical conditions, facilitate an understanding of the disease pathogenesis and allow for the development of new therapeutic strategies. Therefore, the ability to accurately, reproducibly, and repeatedly measure salivary gland function in animal models is critical. Building on procedures previously described in the literature, a method was developed that meets these criteria and was used to evaluate salivary gland function in mice. An additional advantage of this new method is that it is easily mastered, and has little inter-operator variation. Salivary gland function is evaluated as the amount (weight or volume) or rate (mL/min) of saliva produced in response to pilocarpine stimulation. The collected saliva is a good source for the analyses of protein content, immunoglobulin concentrations, and other biomolecules.

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

Um método para a medição da função da glândula salivar em ratos

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced ...

High-throughput Measurement of Plasma Membrane Resealing Efficiency in Mammalian Cells

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In response to these damages, complex molecular machineries rapidly reseal the plasma membrane to restore its barrier function and maintain cell survival. Despite 60 years of research in this field, we still lack a thorough understanding of the cell resealing machinery. With the goal of identifying cellular components that control plasma membrane resealing or drugs that can improve resealing, we have developed a fluorescence-based high-throughput assay that measures the plasma membrane resealing efficiency in mammalian cells cultured in microplates. As a model system for plasma membrane damage, cells are exposed to the bacterial pore-forming toxin listeriolysin O (LLO), which forms large 30-50 nm diameter proteinaceous pores in cholesterol-containing membranes. The use of a temperature-controlled multi-mode microplate reader allows for rapid and sensitive spectrofluorometric measurements in combination with brightfield and fluorescence microscopy imaging of living cells. Kinetic analysis of the fluorescence intensity emitted by a membrane impermeant nucleic acid-binding fluorochrome reflects the extent of membrane wounding and resealing at the cell population level, allowing for the calculation of the cell resealing efficiency. Fluorescence microscopy imaging allows for the enumeration of cells, which constitutively express a fluorescent chimera of the nuclear protein histone 2B, in each well of the microplate to account for potential variations in their number and allows for eventual identification of distinct cell populations. This high-throughput assay is a powerful tool expected to expand our understanding of membrane repair mechanisms via screening for host genes or exogenously added compounds that control plasma membrane resealing.

Here we describe a high-throughput fluorescence-based assay that measures the plasma membrane resealing efficiency through fluorometric and imaging analyses in living cells. This assay can be used for screening drugs or target genes that regulate plasma membrane resealing in mammalian cells.

Medição de alto rendimento da membrana plasmática, efectuou a eficiência em células de mamíferos

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In ...

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a striking increase in life expectancy around the globe. Nonetheless, determining vaccine efficacy remains a challenge. Emerging evidence suggests that the current acellular vaccine (aPV) for Bordetella pertussis (B. pertussis) induces suboptimal immunity. Therefore, a major challenge is designing a next-generation vaccine that induces protective immunity without the adverse side effects of a whole-cell vaccine (wPV). Here we describe a protocol that we used to test the efficacy of a promising, novel adjuvant that skews immune responses to a protective Th1/Th17 phenotype and promotes a better clearance of a B. pertussis challenge from the murine respiratory tract. This article describes the protocol for mouse immunization, bacterial inoculation, tissue harvesting, and analysis of immune responses. Using this method, within our model, we have successfully elucidated crucial mechanisms elicited by a promising, next-generation acellular pertussis vaccine. This method can be applied to any infectious disease model in order to determine vaccine efficacy.

Here we present an elegant protocol for in vivo evaluation of vaccine effectiveness and host immune responses. This protocol can be adapted for vaccine models that study viral, bacterial, or parasitic pathogens.

Avaliação das respostas do hospedeiro-patógeno e eficácia da vacina em camundongos

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a ...

Measurement of Chitinase Activity in Biological Samples

Chitinases are the enzymes that cleave chitin. Even in the absence of chitin, mammalians have significant amounts of chitinases present in the body including at baseline. The precise role of chitinase is not known, however it was believed to play important role in digestion and host defense against chitin-containing food and pathogens, respectively. Recent work, including ours, has shown an important role of chitinase and chitinase-like proteins in host immunity and allergic diseases. Importantly, chitinase activities serve as important biomarkers of disease severity in a wide-range of diseases including type 2 inflammatory diseases such as asthma and pulmonary fibrosis. Similarly, patients with genetic disorders like Gaucher disease have significantly elevated chitinase levels, which not only correlate with disease severity but also serve as a reliable biomarker for therapeutic effectiveness. The protocol outlined here describes a simple, quick, and straightforward way to measure chitinase activity in BAL or serum samples of mice and can be widely adapted to human subjects and other model organisms due to the highly conserved nature of the enzymes.

Presented here is a simple method to measure chitinase activity in biological fluids such as bronchoalveolar lavage or serum.

Medição da atividade da quitinase em amostras biológicas

Chitinases are the enzymes that cleave chitin. Even in the absence of chitin, mammalians have significant amounts of chitinases present in the body ...

Evaluation of T Follicular Helper Cells and Germinal Center Response During Influenza A Virus Infection in Mice

T Follicular Helper (Tfh) cells are an independent CD4+&#160;T cell subset specialized in providing help for germinal center (GC) development and generation of high-affinity antibodies. In influenza virus infection, robust Tfh and GC B cell responses are induced to facilitate effective virus eradication, which confers a qualified mouse model for Tfh-associated study. In this paper, we described protocols in detection of basic Tfh-associated immune response during influenza virus infection in mice. These protocols include: intranasal inoculation of influenza virus; flow cytometry staining and analysis of polyclonal and antigen-specific Tfh cells, GC B cells and plasma cells; immunofluorescence detection of GCs; enzyme-linked immunosorbent assay (ELISA) of influenza virus-specific antibody in serum. These assays basically quantify the differentiation and function of Tfh cells in influenza virus infection, thus providing help for studies in elucidating differentiation mechanism and manipulation strategy.

This paper describes protocols of evaluating Tfh and GC B response in mouse model of influenza virus infection.

Avaliação de células auxiliares tolas e resposta do centro germinal durante a infecção pelo vírus da influenza A em camundongos

T Follicular Helper (Tfh) cells are an independent CD4+&#160;T cell subset specialized in providing help for germinal center (GC) development and ...

In Vivo Infection with Leishmania amazonensis to Evaluate Parasite Virulence in Mice

Leishmania spp. are protozoan parasites that cause leishmaniases, diseases that present a wide spectrum of clinical manifestations from cutaneous to visceral lesions. Currently, 12 million people are estimated to be infected with Leishmania worldwide and over 1 billion people live at the risk of infection. Leishmania amazonensis is endemic in Central and South America and usually leads to the cutaneous form of the disease, which can be directly visualized in an animal model. Therefore, L. amazonensis strains are good models for cutaneous leishmaniasis studies because they are also easily cultivated in vitro. C57BL/6 mice mimic the L. amazonensis-driven disease progression observed in humans and are considered one of the best mice strains model for cutaneous leishmaniasis. In the vertebrate host, these parasites inhabit macrophages despite the defense mechanisms of these cells. Several studies use in vitro macrophage infection assays to evaluate the parasite infectivity under different conditions. However, the in vitro approach is limited to an isolated cell system that disregards the organism&#39;s response. Here, we compile an in vivo murine infection method that provides a systemic physiological overview of the host-parasite interaction. The detailed protocol for the in vivo infection of C57BL/6 mice with L. amazonensis comprises parasite differentiation into infective amastigotes, mice footpad cutaneous inoculation, lesion development, and parasite load determination. We propose this well-established method as the most adequate method for physiological studies of the host immune and metabolic responses to cutaneous leishmaniasis.

In Vivo Infection with Leishmania amazonensis to Evaluate Parasite Virulence in Mice

Here, we present a compiled protocol to evaluate the cutaneous infection of mice with Leishmania amazonensis. This is a reliable method for studying parasite virulence, allowing a systemic view of the vertebrate host response to the infection.

In Vivo Infecção com Leishmania amazonensis avaliará virulence parasita em camundongos

Leishmania spp. are protozoan parasites that cause leishmaniases, diseases that present a wide spectrum of clinical manifestations from cutaneous to ...