Yazarlar, teknik danışmanlık ve destek Ren Sun (University of California, Los Angeles) ve Seungmin Hwang (Washington Üniversitesi) kabul etmek istiyorum. Bu çalışma, Baxter Vakfı, Ulusal Sağlık hibe Enstitüleri (C. Liang R01 CA140964 ve R21 AI083841) tarafından finanse edildi.

Aşağıdaki protokol teorik γHV68, benzer yaşam tarzı paylaşan diğer virüsler tarafından enfeksiyona değerlendirmek için kullanılabilir farelerde γHV68 litik ve latent enfeksiyon döngüsü, virüs titreleri ve viral genomun yükler çalışma anlatacağız. 1. ΓHV68, amplifikasyon <ol><li> 37 ° C su banyosunda γHV68 donmuş bir flakon çözülme. </li><li> 37 NIH3T12 veya 3T3 hücre kültürü (~% 50 confluency) 10 cm yemekleri ve kültürü enfekte olmuş hücrelerde virüs inoculums ° C,% 5 CO 2. </li><li> Sitopatik etki (CPE) mikroskopi, kültür inceleyin ve hücrelerin% 80 den daha büyük CPE 4 ~ 5 gün sonra enfeksiyon eklendiğinde, bir anda medya toplamak. Virüs verimi en üst düzeye çıkarmak için, enfekte hücre kültürü ile ilişkili tüm hücre γHV68 serbest bırakmak için iki kez dondurulmuş ve çözülmüş olabilir. </li><li> Hücre enkaz kaldırmak için toplanan medya Santrifüj için 1000 rpm&#39;de 5 dakika oda sıcaklığında (RT). </li><li> Süpernatantlar yeni tüpleri (yüksek hızda santrifüj tüp) altındaki hücre enkaz dokunmadan dikkatlice aktarın. </li><li> 12.000 devirde yüksek hızda santrifüj (Sorvall SA-600 için) 4 ° C&#39;de en az 1.5 saat viral parçacıkların konsantre. </li><li> Süpernatantlar 10γ çamaşır suyu çözeltisi içine atın ve dikkatle 1ml serum serbest DMEM pelet (virüs ve artık hücre artıkları) yeniden askıya. 1,5 ml mikro-santrifüj tüpü içine yeniden askıya pelet aktarın ve vorteks ile iyice karıştırın. </li><li> Kalan hücre enkaz kaldırmak ve yeni bir tüp (virüs stok) supernatant aktarmak için maksimum hızda 2 dakika boyunca santrifüjleyin. Bu enfeksiyon için son viral stoğu. Virüs stokunun titresi plak assay (aşağıya bakınız) tarafından belirlenir. </li></ol> 2. ΓHV68 fareler intranazal Enfeksiyon <ol><li> 1.000 ile yaş ~ 6 hafta fareleri enfekte ~ γHV68 başına farelerin 5000 plak oluşturan birim (PFU). </li><li> Uyutmakketamin / xylazine (80 mg / ml ketamin ve 12 mg / ml ksilizin bir karışımı 60 ul / fare) periton boşluğuna enjeksiyonu ile fareler. Fareler ayak kısma anestezi izleyin. Genellikle ~ 5-10 dakika sürer. Fareler tamamen anestezi değilse, bu virüs hapşırık. </li><li> Fare tam anestezi olduğunda, yavaş fakat istikrarlı bir damla bırak farelere PBS içeren γHV68 ~ 30 ul (her bir burun deliğine 15 ul) aşılamak için bir pipet kullanın. Fare gerçekten kabarcıkları oluşturmaya çalışıyor kalmadan damla teneffüs emin olun. </li><li> Fareyi 10-15 dk kurtarmak ve onları kafes dönmeden önce fareler (örneğin bilinç, solunum, vb.) Refah izlemek için izin verin. Hayvanlar, gıda, su, ve yatak koşulları hastalık ve yeterliliği için günlük olarak kontrol edilir. Hastalık, ağrı veya sıkıntı klinik belirtileri ortaya çıkarsa, etyolojisini belirlemek için rutin teşhis yapılacaktır. Kendi vücut ağırlığının% 20&#39;den fazla kaybetmek Hayvanlar maksimum ağırlık kaybı için kaydedilecektirötenazi. Ötenazi gerçekleştirmek için nihai karar klinik veteriner takdirine ve baş araştırmacısı olan aşağıdaki istişare yapılır. </li></ol> 3. Akut Etkilenmiş Akciğerler Virus titresi belirleme Plak Testi <ol><li> Virüs enfektivite titreleri Vero hücreleri mono tabakaları üzerinde plak oluşumu ile belirlenir. </li><li> Vero hücreleri 2.5x10 4 hücre / kuyu iyi plakaları 12 gün önce plak tahlil numaralı seribaşı. Hücreler eşit olarak dağıtılmış olmalıdır ve ulaşmak hücre yoğunluğu 30 -% 40 plak testinin günü. </li><li> % 0.5 (w / v) metilselüloz (MC) kaplama orta (Tablo 1) hazırlayın. </li><li> 5-7 gün sonra burun içi enfeksiyonu, akciğerlerde akut faz virüs titreleri belirlemek için γHV68-enfekte olmuş fareler Kurban. Euthanization Ketamin HCl (80-100 mg / kg SC, IM, IP) IM Na pentobarbital (30-50 mg / kg IP), intravenöz doz aşımı takip yönetilecek. Bu yöntem, t tarafından onaylanmıştırAmerikan Veteriner Hekimleri Birliği. </li><li> Hasat ve akciğerlere kan hücreleri çıkarmak için 1 x PBS ile iki kez yıkayın. 1 ml buz gibi komple DMEM orta akciğerlerin bir tarafı toplayın ve buz üzerinde tutmak. Hızla qPCR (aşağıya bakınız) akciğerlere viral DNA yükleri incelenmesi için -80 ° C&#39;de, akciğerler ve mağaza diğer tarafı dondurmak. </li><li> Akciğer dokularında, 1 sn, donma ve çözülme üç kez maksimum hızda homojenize bir doku Homojenizatör kullanın. Örnek değiştirirken Homojenizatör her adımda% 70 etanol ile yıkayın. </li><li> 3.000 rpm&#39;de 10 dakika süreyle homojenize doku Santrifüj 4 ° C Süpernatantı toplayın ve plak tayini için yeni tüplere transfer. </li><li> Girdap tarafından düz DMEM ile 1.5 ml mikro-santrifüj tüplerine akciğer Homojenat örneklerinin seri dilüsyonları (genellikle 10 ° 10 -8) hazırlayın. Önceden doldurunuz 540 ul DMEM uygun tüpleri numarası ve ilk tüp içine 60 ul Homojenat sulandırmak. I ilk tüp 60 ul transferbir sonraki, vb. </li><li> 12 kuyucuğu hazırlanan Vero mono tabakaları medya aspire ve yük / ters sırayla (10 -8 10 °) bulaşıcı virüsler içeren iyi seri seyreltilmiş Homojenat 200 ul. Her titrasyon (çift) için iki kuyu kullanın. </li><li> 37 virüs inoculums 1 saat Vero hücreleri inkübe ° C Her 15 dakikada bir, eşit, tek tabaka üzerinde virüs dağıtmak için plakalar yavaşça girdap. </li><li> Inoculums çıkarın ve 2 ml / bindirme orta (Tablo 1) ile değiştirin. 37 tabak az bir hafta süreyle inkübe ° C </li><li> Bindirme orta çıkartın (tam olması gerekmez) ve düzeltme / plak testinin leke orta (Tablo 1) ile değiştirin ve oda sıcaklığında en az 1 saat süreyle inkübe edin. </li><li> Plakalar kurutulur, her seyreltme iyi izole plakların sayısını. Hatayı en aza indirmek için, sadece 10 ve 100 plaklar arasında içeren kuyu sayılır. </li><li> Follo kullanarak virüs titresi hesaplayınkanat formül: titresi (pfu / ml) = [/ (/ iyi plakların sayısı) (inoculums / iyi hacmi)] x seyreltme faktörü. </li></ol> 4. Latent Etkilenmiş splenositlerin Virüs Yük belirleme Enfeksiyon Merkezi Testi <ol><li> Latent viral yük Vero hücreleri tek tabaka üzerinde bulaşıcı merkezi (IC) tayini ile belirlenir. 6-kuyucuğu IC tahlil, tohum Vero hücreleri (1 - 2.5 X 10 5 hücre / Biz genellikle dalak örnek başına 11 kuyu, 10 kuyu seri seyreltilmiş splenositlerin süspansiyon için kullanılan olacak ve test etmek için iyi bir gün önce donma-çözülme döngüsünden sonra virüs spontan reaktivasyon. </li><li> Gecikme süresi (12 - 14 gün sonra enfeksiyon) kurulduktan sonra enfekte olmuş fareler Kurban. Fare dalak ve havuz, 1 ml soğutulmuş DMEM içine Hasat. </li><li> Mekanik fare dalak çözülmesi. Taze izole fare dalak 10 cm tabak içine aktarın ve 10 ml% 2 FBS ile DMEM gibi istenilen orta ekleyin. Islak iki buzlu uç cam microscbuz orta yerdir slaytlar. Bir slayt nick ve diğer slayt buzlu sonu kenarı ile kapsül buzlu tarafta dalak yerleştirin. Bütün kırmızı kümeleri (eğer varsa da yağ parçacıkları kaldırmak) ezilmiş kadar mekanik iki slaytlar arasındaki dalak ayrıştırmaları. </li><li> DMEM ile hem slaytlar üzerinde kalan hücreleri kurtarmak için slaytlar durulayın. </li><li> 50 ml konik vidalı kapaklı tüp içine bir hücre süzgeç (40 mikron naylon mesh) ile tüm doku süspansiyonu yavaşça aktarın. 10 cm çanak dalak homojenatlarında içeren filtreleme ise 10 ml PBS ve transferi ile yıkayın. </li><li> 375 xg&#39;de tek hücre süspansiyonları 10 dakika santrifüj ve supernatant atın. Mevcut hücre kümeleri break up hücre pelletleri Flick. 5 ml ACK tamponu (Tablo 1), kırmızı kan hücreleri lyse ekleyin. 5 dakika inkübe ve 375 x g. tekrar santrifüj </li><li> Süpernatantı atın ve PBS içinde yavaşça henüz iyice yeniden askıya pelet,% 2 FBS. Hücreleri, 4 ° C tutun Bir pipet kullanınvarsa pislikleri temizleyin. Canlı hücreler kullanarak bir otomatik hücre sayıcı (Bio-Rad) güvenin. </li><li> 4 dakika için 375 xg PBS yeniden süspanse splenositlerin dönerler. Süpernatant atın ve 4 ml tam DMEM (2 x 1 ml süspansiyon IC testi için kullanılacak hücreler tekrar süspansiyon; IC tayininde seri beş kat seyreltme için kullanılan 0,6 ml; viral DNA hazırlığı ve qPCR için 0.4 ml, ve 1 ml süspansiyon) üç donma-çözülme döngüsünden sonra latent virüs spontan reaktivasyon değerlendirmek için kullanılır. </li><li> Çiftleri splenositlerin süspansiyon seri beş kat dilüsyonları (yani 1 / 5, 1 / 25, 1 / 125, 1 / 250) hazırlayın. 2.4 ml DMEM ve ilk tüpe 600 ul splenositlerin süspansiyon sulandırmak ve iyice karıştırın önceden doldurunuz 15 ml konik tüpler. Sonraki tüpe bir önceki tüpten 600 ul Transferi, vb girdap etmeyin! </li><li> Vero hücrelerinden hazırlanan 6 sıra tek tabaka, orta aspire. Tohum 1 ml her seyreltme dupl ile Vero hücreleri üzerine seri olarak seyreltilmiş splenositlerinicated (10 kuyu, 0, 1 / 5, 1 / 25, 1 / 125, 1 / 250 dilüsyonları için kullanılır). </li><li> Plakalar 8-12 saat 37 ° ° C&#39;de ve% 5 CO 2. 24 saat aşmayın. Aspire numaralı seribaşı splenositlerin süspansiyon ve her bir kuyu için 4 ml bindirme medya (Tablo 1) yüklemek. Ek bir 6 gün boyunca inkübe edin. </li><li> Plak tayininde gösterildiği gibi kristal viyole% 0.2 (w / v) ile tabak boyama dalak bulaşıcı merkezleri düzeylerini belirlemek. </li></ol> 5. Viral Genom, Niceleme <ol><li> Bu deneyde, akciğer ve dalak örnekleri gibi γHV68 enfekte dokular, toplam genomik DNA ayıklayın. Üreticinin protokolü takip DNeasy Kan ve Doku Seti (Qiagen) kullanın. </li><li> QPCR tayini için kullanılan DNA aynı miktarda sağlamak için her numunenin DNA konsantrasyonu belirleyin. Tasarım virüs spesifik primerler (~ 200 bp Amplikon qPCR testi için tercih edilir). ΓHV68 ORF56 spesifik primerler (ileri astar kullandı: Biz 5 ve prime - GTAACTCGAGACTGAAACCTCGCAGAGGTCC - 3 &#39;; ters astar: CCGAAGCTTGCACGGTGCAATGTGTCACAG 5&#39;-3&#39;) bu tahlil ve β-aktin primerler (ileri astar: 5&#39;-cacccacactgtggcccatcat-3 &#39;ters astar: 5&#39;-gtgaggatcttcatgaggtagtc 3&#39;) qPCR reaksiyon için bir denetim. </li><li> (- 500 ng 100) ve 2 x SYBR master miks (Bio-Rad iQ SYBR Green Supermix) uygun primerler DNA örneği karıştırın. Bio-Rad Real-Time PCR sistemi enfekte dokularda viral yükü ölçmek için kullanın. Aşağıdaki koşul PCR yapın: 15 dakika ve 45 döngüleri 95 - 95 ° C ° C, 30 dakika 60 ° C için 30 dakika ve 72 ° C 30 dakika, viral ve her ikisi de, erime eğrisi analizleri ile takip aktin amplikonlarının. </li><li> Viral genomların ölçümü için bir standart eğri olması, enfekte olmamış hücrelerden izole edilen genomik DNA ile γHV68 bacmid DNA bilinen miktarlarda seri sulandırmak için. Enfeksiyon alınan DNA&#39;lar ile paralel olarak qPCR çalıştırınTed virüs spesifik primerler aynı setleri kullanarak dokular. </li><li> Aktin normalleşme sonra genomik DNA birim başına viral DNA kopya sayısı (örneğin 100 ng veya 500 ng) gibi dokularda viral genom yük sunun. </li></ol> 6. Temsilcisi Sonuçlar: Şekil 1 genel şeması γHV68 enfeksiyon farelerde in vivo olarak ölçmek için deneyler gösteriyor. Şekil 2A plak yöntemi ile belirlenen γHV68, akut enfeksiyon sırasında akciğerlerde virüs titreleri Temsilcisi sonuçlar gösterilmiştir. Içeren γHV68 bir mutant suşu fonksiyonel olmayan viral Bcl-2, 7 gün BALB / c farelerde (grup başına 6 - 7 fareler) intranazal enfeksiyon sonra akciğerlerde yabani tip γHV68 karşılaştırılabilir seviyelerde çoğaltılır (vBcl 2). Virüs akciğer titreleri iki grup arasında istatistiksel olarak anlamlı farklılıklar tespit edildi. Bu veri vBcl-2 γHV68 akut enfeksiyon için önemli bir faktör olmadığını gösterirfareler. Ancak, 28 gün postinfection, dalak vBcl-2 mutant virüs titresi 6 düştü - 10 kat WT, bulaşıcı merkezi assay (Şekil 2B) ile ölçülen ile karşılaştırıldığında, öne vBcl-2 mutant γHV68 virüs , enfeksiyon sonrası splenik gecikme bakım arızalı. Azaltılmış bulaşıcı merkezi titreleri ile anlaşma, vBcl-2 mutant virüs viral genomun yükü ciddi Şekil 2C gösterildiği gibi tekrarlanan deneylerde 28 gün WT virüsler, kıyasla azalmıştır. Enfeksiyon latent aşamada latent-HV68vBcl-2 mutant virüs reaktivasyonu ex vivo viral genomun yükler ve sıklığı arasında yakın bir ilişki, bu mutant virüs enfeksiyonu bir gecikme kusur vurgulamaktadır . <img alt="Şekil 1" src="/files/ftp_upload/3472/3472fig1.jpg" /> Şekil 1 plak oluşumu sayesinde, bulaşıcı merkezi ve qPCR tahlil farelerde γHV68 enfeksiyon ölçümü için şematiks <img alt="Şekil 2" src="/files/ftp_upload/3472/3472fig2.jpg" /> Şekil 2, in vivo WT ve mutant γHV68 virüs Parçalayıcı ve latent infeksiyon . 7 dpi (günlük yazılan enfeksiyonu) BALB / c farelerde akciğerlerde WT ve mutant vBcl-2 γHV68 virüsleri akut çoğaltma (A) plak yöntemi ile tespit edildi. Dalak bulaşıcı merkezleri (B) ve enfekte farelerde dalak viral genomun yük (C) (B ve C), sırasıyla, 28 dpi çözünürlükte, bulaşıcı merkezi tahlil ve qPCR tarafından ölçüldü. Kırmızı çizgiler, belirtilen değerlerin ortalamaları. NS, anlamlı değil.

<ol>
	<li>Damania, B., Choi, J. K., Jung, J. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Signaling+activities+of+gammaherpesvirus+membrane+proteins.">Signaling activities of gammaherpesvirus membrane proteins.</a> J. Virol. 74, 1593-1601 (2000).</li><li>Stevenson, P. G., Efstathiou, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+mechanisms+in+murine+gammaherpesvirus-68+infection.">Immune mechanisms in murine gammaherpesvirus-68 infection.</a> Viral. Immunol. 18, 445-456 (2005).</li><li>Flano, E., Husain, S. M., Sample, J. T., Woodland, D. L., Blackman, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Latent+murine+gamma-herpesvirus+infection+is+established+in+activated+B+cells,+dendritic+cells,+and+macrophages.">Latent murine gamma-herpesvirus infection is established in activated B cells, dendritic cells, and macrophages.</a> J. Immunol. 165, 1074-1081 (2000).</li><li>Sunil-Chandra, N. P., Efstathiou, S., Nash, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+establishes+a+latent+infection+in+mouse+B+lymphocytes+in+vivo.">Murine gammaherpesvirus 68 establishes a latent infection in mouse B lymphocytes in vivo.</a> J. Gen. Virol. 73, 3275-3279 (1992).</li><li>Simas, J. P., Swann, D., Bowden, R., Efstathiou, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+murine+gammaherpesvirus-68+transcription+during+lytic+and+latent+infection.">Analysis of murine gammaherpesvirus-68 transcription during lytic and latent infection.</a> J. Gen. Virol. 80, 75-82 (1999).</li><li>Ganem, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KSHV+and+the+pathogenesis+of+Kaposi+sarcoma:+listening+to+human+biology+and+medicine.">KSHV and the pathogenesis of Kaposi sarcoma: listening to human biology and medicine.</a> J. Clin. Invest. 120, 939-949 (2010).</li><li>Wen, K. W., Damania, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kaposi+sarcoma-associated+herpesvirus+(KSHV):+molecular+biology+and+oncogenesis.">Kaposi sarcoma-associated herpesvirus (KSHV): molecular biology and oncogenesis.</a> Cancer. Lett. 289, 140-150 (2009).</li><li>E, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Bcl-2-mediated+evasion+of+autophagy+aids+chronic+infection+of+gammaherpesvirus+68.">Viral Bcl-2-mediated evasion of autophagy aids chronic infection of gammaherpesvirus 68.</a> PLoS. Pathog. 5, e1000609-e1000609 (2009).</li><li>Marques, S., Efstathiou, S., Smith, K. G., Haury, M., Simas, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+gene+expression+of+latent+murine+gammaherpesvirus+68+in+B+lymphocytes.">Selective gene expression of latent murine gammaherpesvirus 68 in B lymphocytes.</a> J. Virol. 77, 7308-7318 (2003).</li><li>McCausland, M. M., Crotty, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+PCR+technique+for+detecting+lymphocytic+choriomeningitis+virus+in+vivo.">Quantitative PCR technique for detecting lymphocytic choriomeningitis virus in vivo.</a> J. Virol. Methods. 147, 167-176 (2008).</li><li>Weck, K. E., Kim, S. S., Virgin, H. I., Speck, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cells+regulate+murine+gammaherpesvirus+68+latency.">B cells regulate murine gammaherpesvirus 68 latency.</a> J. Virol. 73, 4651-4661 (1999).</li><li>Weck, K. E., Kim, S. S., Virgin, H. I., Speck, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Macrophages+are+the+major+reservoir+of+latent+murine+gammaherpesvirus+68+in+peritoneal+cells.">Macrophages are the major reservoir of latent murine gammaherpesvirus 68 in peritoneal cells.</a> J. Virol. 73, 3273-3283 (1999).</li></ol>

Çıkar çatışması ilan etti.

γHV68 yaygın insan γ-HVS 2,4,5 patogenezinde anlamak için bir model olarak kullanılmıştır. Bu protokol, farelerde intranazal aşılama sonrası γHV68 akut ve latent enfeksiyon değerlendirmek, plak için bulaşıcı bir virüs titresi tahlil, viral gizli yük için IC tahlil ve viral genomun yük için qPCR olmak üzere üç rutin olarak kullanılan yöntem tanımlanmıştır. Plak testi, enfekte olmuş hücrelerde ya da dokularda virüs titresi belirlemek için yaygın o...

<table border="1"><tbody><tr><td> Malzeme Adı </td><td> Hazırlama Prosedürü </td></tr><tr><td> Viral plak testi için Metilselüloz (MC) bindirme orta </td><td><ol><li> Isı ~&gt; 80 TC şişede 250 ml distile su ° C (mikrodalga fırında 3 dakika kaynar) </li><li> Eriyene kadar kısık ateşte karıştırarak sıcak su içine yavaş yavaş 2.5 g MC tozu ekleyin. </li><li> Sıvı döngüsü az 15 dakika boyunca hemen Otoklav. </li><li> 4 ° C gecede otoklavlanmış MC medya karıştırmaya devam edin. </li><li> 2 200 ml ile 250 ml MC medya birleştirin x MEM (Gibco-BRL) + 500 ml bindirme medya vermek için 50 ml FBS. </li></ol></td></tr><tr><td> Düzeltme / plak testi için orta leke </td><td> % 0.2 (w / v)% 20 etanol içinde kristal viyole. </td></tr><tr><td> ACK Lizis Tamponu </td><td> NH 4 Cl 0.15m, KHCO 3 10mM EDTA 0.1mm </td></tr><tr><td> Komple DMEM </td><td> Dulbecco&#39;nun modifiye Eagle orta2 mM L-glutamin, ve% 1 penisilin-streptomisin (Gibco-BRL) (DMEM)% 10 fetal sığır serumu (Invitrogan FBS) ile desteklenmiştir. </td></tr></tbody></table> Bu protokolde kullanılan Tablo 1: Belirli medya <table border="1"><tbody><tr><td> Reaktifi Adı </td><td> Şirket </td><td> Katalog numarası </td></tr><tr><td> Ketamin </td><td> Sigma-Aldrich </td><td> K2753 </td></tr><tr><td> Xylazine </td><td> Sigma-Aldrich </td><td> X1251 </td></tr><tr><td> Metilselüloz </td><td> Sigma-Aldrich </td><td> M0512-250g </td></tr><tr><td> 2 x MEM </td><td> Yaşam Teknolojileri </td><td> 11935 </td></tr><tr><td> Hücre süzgeç </td><td> BD Faclon </td><td> 352340 </td></tr><tr><td> Omni doku homojenizatör </td><td> OMNI Uluslararası </td><td> TH115 </td></tr><tr><td> DNeasy Kan ve Doku Seti </td><td> Qiagen </td><td> 69504 </td></tr><tr><td> iQTM SYBRH Yeşil Supermix </td><td> BioRad </td><td> 170-8882 </td></tr><tr><td> CFX96 real-time PCR sistemi </td><td> Bio-Rad </td><td> 184-5072 </td></tr><tr><td> Hücre sayıcı </td><td> Bio-Rad </td><td> 145-0001 </td></tr><tr><td> Sorvall SA-600 </td><td> Thermo Scientific </td><td> 096-124022 </td></tr></tbody></table> Tablo 2: Belirli reaktifler ve ekipman

measurement of &#947;hv68 infection in mice

γ-herpesvirüslerinin (γ-HVS) lenfoid hücrelerde 1 latent enfeksiyonlar kurmak için yeteneklerini dikkat çekicidir. EBV ve KSHV insan olarak γ-HVS, dar ana aralığı ciddi detaylı patojenik çalışmaları engellemiştir. Murin γ-herpesvirus 68 (γHV68) hisse senetleri γ-HVS insan ve yaygın genetik ve biyolojik benzerlik murid kemirgenler 2 doğal bir patojen . Viral enfeksiyon farklı aşamalarında fareler kendilenmiş suşları γHV68 enfeksiyon gibi, değerlendirme sırasında viral yaşam döngüsü ve γ-HVS enfeksiyon patogenezinde anlamak için önemli bir model sağlar. Intranazal aşılama üzerine, daha sonra dalak ve diğer hücrelere, ev sahibi 3,4 ömrü boyunca yeniden olabilir gizli bir enfeksiyon, akut akciğer viremi γHV68 enfeksiyonu sonuçları çözümlenir bu. Bu protokol, biz eşek plak testinin nasıl kullanılacağını anlatacağızpost-intranazal enfeksiyonu (dpi) - akciğer bulaşıcı bir virüs titresi erken evre (7 gün 5) Vero hücre mono tabakaları homojenatlarında. Akut enfeksiyon, büyük ölçüde 2 temizlenir, 3 hafta postinfection γHV68 bir latent enfeksiyon 14 dpi etrafında kurulan ve daha sonra farelerin dalak tutulur. Gizli virüs enfeksiyonu genellikle uykuda kalır ve onun gen ekspresyonu çoğu kapanır sayede enfekte dokular, hücrelerin çok küçük bir nüfus etkiler. Latent enfekte splenositlerin kendiliğinden virüs, viral gizli yükü belirlemek için bulaşıcı bir merkezi (IC) yöntemi ile değinmeyecek olabilir doku kültürü içine explanting sonra yeniden etkinleştirin. Akut ve / veya latent enfekte dokular, kantitatif real-time PCR viral genomun kopya miktarını hesaplamak için (qPCR), maksimum hassasiyet ve doğruluk için kullanılır. QPCR ve plak tahlil ve / veya IC tahlil sonuçlarının kombine analizler, viral Spatiotemporal profillerini ortaya koyacaktırin vivo çoğaltma ve enfektivite.

Watch this Scientific Journal Video about Measurement of Î³HV68 Infection in Mice at JoVE.com

Measurement of &amp;#947;HV68 Infection in Mice

γ-herpesvirüslerinin (γ-HVS) ev sahibi ömür boyu kalıcılığı kurmak. Enfeksiyon γ-HV68 ile farelerin genetik çözülebilir sağlar<em&gt; In vivo</em&gt; ΓHVs ömrü / patogenezinde karakterizasyonu modeli. Bu protokol, plak oluşturan, bulaşıcı merkezi, ve qPCR deneyleri enfeksiyonu takip eden akut ve latent aşamasında γHV68 enfeksiyon tespit ve kantitatif açıklamaktadır.

Farelerde γHV68 Enfeksiyon ölçümü

&gamma;-Herpesviruses (&gamma;-HVs) are notable for their ability to establish latent infections of lymphoid cells1. The narrow host range of human ...

Research

JoVE Journal

Immunology and Infection

Measurement of &#947;HV68 Infection in Mice

13.5K Görüntüleme.  University of Southern California, Los Angeles. γ-herpesvirüslerinin (γ-HVS) ev sahibi ömür boyu kalıcılığı kurmak. Enfeksiyon γ-HV68 ile farelerin genetik çözülebilir sağlar In vivo ΓHVs ömrü / patogenezinde karakterizasyonu modeli. Bu protokol, plak oluşturan, bulaşıcı merkezi, ve qPCR deneyleri enfeksiyonu takip eden akut ve latent aşamasında γHV68 enfeksiyon tespit ve kantitatif açıklamaktadır.

Video: Measurement of &#947;HV68 Infection in Mice

A Method for Labeling Vasculature in Embryonic Mice

The establishment of a functional blood vessel network is an essential part of organogenesis, and is required for optimal organ function. For example, in the thymus proper vasculature formation and patterning is essential for thymocyte entry into the organ and mature T-cell exit to the periphery. The spatial arrangement of blood vessels in the thymus is dependent upon signals from the local microenvironment, namely thymic epithelial cells (TEC). Several recent reports suggest that disruption of these signals results in thymus blood vessel defects 1,2. Previous studies have described techniques used to label the neonatal and adult thymus vasculature 1,2. We demonstrate here a technique for labeling blood vessels in the embryonic thymus. This method combines the use of FITC-dextran or Griffonia (Bandeiraea) Simplicifolia Lectin I (GSL 1 - isolectin B4) facial vein injections and CD31 antibody staining to identify thymus vascular structures and PDGFR-&beta; to label thymic perivascular mesenchyme 3-5. The option of using cryosections or vibratome sections is also provided. This protocol can be used to identify thymus vascular defects, which is critical for defining the roles of TEC-derived molecules in thymus blood vessel formation. As the method labels the entire vasculature, it can also be used to analyze the vascular networks in multiple organs and tissues throughout the embryo including skin and heart 6-10.

This article describes a method for labeling embryonic skin and thymus blood vessels.

Embriyonik Farelerde damarları Etiketleme Bir Yöntem

The establishment of a functional blood vessel network is an essential part of organogenesis, and is required for optimal organ function. For example, in ...

İmmünoloji ve Enfeksiyon

Measurement of Cytosolic Ca2+ in Isolated Contractile Lymphatics

Lymphatic vessels comprise a multifunctional transport system that maintains fluid homeostasis, delivers lipids to the central circulation, and acts as a surveillance system for potentially harmful antigens, optimizing mucosal immunity and adaptive immune responses1. Lymph is formed from interstitial fluid that enters blind-ended initial lymphatics, and then is transported against a pressure gradient in larger collecting lymphatics. Each collecting lymphatic is made up of a series of segments called lymphangions, separated by bicuspid valves that prevent backflow. Each lymphangion possesses a contractile cycle that propels lymph against a pressure gradient toward the central circulation2. This phasic contractile pattern is analogous to the cardiac cycle, with systolic and diastolic phases, and with a lower contraction frequency4. In addition, lymphatic smooth muscle generates tone and displays myogenic constriction and dilation in response to increases and decreases in luminal pressure, respectively5. A hybrid of molecular mechanisms that support both the phasic and tonic contractility of lymphatics are thus proposed.
Contraction of smooth muscle is generally regulated by the cytosolic Ca2+ concentration ([Ca2+]i) plus sensitivity to Ca2+, of the contractile elements in response to changes in the environment surrounding the cell6. [Ca2+]i is determined by the combination of the movement of Ca2+ through plasma membrane ligand or voltage gated Ca2+ channels and the release and uptake of Ca2+ from internal stores. Cytosolic Ca2+ binds to calmodulin and activates enzymes such as myosin light chain (MLC) kinase (MLCK), which in turn phosphorylates MLC leading to actin-myosin-mediated contraction8. However, the sensitivity of this pathway to Ca2+ can be regulated by the MLC phosphatase (MLCP)9. MLCP activity is regulated by Rho kinase (ROCK) and the myosin phosphatase inhibitor protein CPI-17.
Here, we present a method to evaluate changes in [Ca2+]i over time in isolated, perfused lymphatics in order to study Ca2+-dependent and Ca2+-sensitizing mechanisms of lymphatic smooth muscle contraction. Using isolated rat mesenteric collecting lymphatics we studied stretch-induced changes in [Ca2+]i and contractile activity. The isolated lymphatic model offers the advantage that pressure, flow, and the chemical composition of the bath solution can be tightly controlled. [Ca2+]i was determined by loading lymphatics with the ratiometric, Ca2+-binding dye Fura-2. These studies will provide a new approach to the broader problem of studying the different molecular mechanisms that regulate phasic contractions versus tonic constriction in lymphatic smooth muscle.

Measurement of Cytosolic Ca2+ in Isolated Contractile Lymphatics

We introduce an approach to evaluate the cytosolic Ca2+ concentration in isolated lymphatics to study Ca2+-dependent and Ca2+-sensitizing mechanisms of lymphatic smooth muscle contraction.

Sitosolik Ca ölçümü 2 + İzole Kontraktil Lenfatikler

Lymphatic vessels comprise a multifunctional transport system that maintains fluid homeostasis, delivers lipids to the central circulation, and acts as a ...

4D Multimodality Imaging of Citrobacter rodentium Infections in Mice

This protocol outlines the steps required to longitudinally monitor a bioluminescent bacterial infection using composite 3D diffuse light imaging tomography with integrated &mu;CT (DLIT-&mu;CT) and the subsequent use of this data to generate a four dimensional (4D) movie of the infection cycle. To develop the 4D infection movies and to validate the DLIT-&mu;CT imaging for bacterial infection studies using an IVIS Spectrum CT, we used infection with bioluminescent C. rodentium, which causes self-limiting colitis in mice. In this protocol, we outline the infection of mice with bioluminescent C. rodentium and non-invasive monitoring of colonization by daily DLIT-&mu;CT imaging and bacterial enumeration from feces for 8 days.
The use of the IVIS Spectrum CT facilitates seamless co-registration of optical and &mu;CT scans using a single imaging platform. The low dose &mu;CT modality enables the imaging of mice at multiple time points during infection, providing detailed anatomical localization of bioluminescent bacterial foci in 3D without causing artifacts from the cumulative radiation. Importantly, the 4D movies of infected mice provide a powerful analytical tool to monitor bacterial colonization dynamics in vivo.

4D Multimodality Imaging of Citrobacter rodentium Infections in Mice

Multi-modality imaging is a valuable approach for studying bacterial colonization in small animal models. This protocol outlines infection of mice with bioluminescent Citrobacter rodentium and the longitudinal monitoring of bacterial colonization using composite 3D diffuse light imaging tomography with &mu;CT imaging to create a 4D movie of C. rodentium infection.

4D modelli Görüntüleme<em&gt; Citrobacter rodentium</emFarelerde&gt; Enfeksiyonlar

This protocol outlines the steps required to  longitudinally monitor a bioluminescent bacterial infection using composite 3D diffuse light imaging ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

Uzun Vadeli Kronik<em&gt; Pseudomonas aeruginosa</emFarelerde&gt; Havayolu Enfeksiyon

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

A Method for the Measurement of Salivary Gland Function in Mice

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced saliva production. Similarly, saliva production is severely compromised in patients receiving radiation treatment for head and neck cancers. Rodent models, developed to mimic these clinical conditions, facilitate an understanding of the disease pathogenesis and allow for the development of new therapeutic strategies. Therefore, the ability to accurately, reproducibly, and repeatedly measure salivary gland function in animal models is critical. Building on procedures previously described in the literature, a method was developed that meets these criteria and was used to evaluate salivary gland function in mice. An additional advantage of this new method is that it is easily mastered, and has little inter-operator variation. Salivary gland function is evaluated as the amount (weight or volume) or rate (mL/min) of saliva produced in response to pilocarpine stimulation. The collected saliva is a good source for the analyses of protein content, immunoglobulin concentrations, and other biomolecules.

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

Tükürük bezi işlevi farelerde ölçülmesi için bir yöntem

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced ...

High-throughput Measurement of Plasma Membrane Resealing Efficiency in Mammalian Cells

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In response to these damages, complex molecular machineries rapidly reseal the plasma membrane to restore its barrier function and maintain cell survival. Despite 60 years of research in this field, we still lack a thorough understanding of the cell resealing machinery. With the goal of identifying cellular components that control plasma membrane resealing or drugs that can improve resealing, we have developed a fluorescence-based high-throughput assay that measures the plasma membrane resealing efficiency in mammalian cells cultured in microplates. As a model system for plasma membrane damage, cells are exposed to the bacterial pore-forming toxin listeriolysin O (LLO), which forms large 30-50 nm diameter proteinaceous pores in cholesterol-containing membranes. The use of a temperature-controlled multi-mode microplate reader allows for rapid and sensitive spectrofluorometric measurements in combination with brightfield and fluorescence microscopy imaging of living cells. Kinetic analysis of the fluorescence intensity emitted by a membrane impermeant nucleic acid-binding fluorochrome reflects the extent of membrane wounding and resealing at the cell population level, allowing for the calculation of the cell resealing efficiency. Fluorescence microscopy imaging allows for the enumeration of cells, which constitutively express a fluorescent chimera of the nuclear protein histone 2B, in each well of the microplate to account for potential variations in their number and allows for eventual identification of distinct cell populations. This high-throughput assay is a powerful tool expected to expand our understanding of membrane repair mechanisms via screening for host genes or exogenously added compounds that control plasma membrane resealing.

Here we describe a high-throughput fluorescence-based assay that measures the plasma membrane resealing efficiency through fluorometric and imaging analyses in living cells. This assay can be used for screening drugs or target genes that regulate plasma membrane resealing in mammalian cells.

Plazma zarı verimliliği memeli hücrelerinde yeniden mühürlemeden yüksek üretilen iş ölçümü

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In ...

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a striking increase in life expectancy around the globe. Nonetheless, determining vaccine efficacy remains a challenge. Emerging evidence suggests that the current acellular vaccine (aPV) for Bordetella pertussis (B. pertussis) induces suboptimal immunity. Therefore, a major challenge is designing a next-generation vaccine that induces protective immunity without the adverse side effects of a whole-cell vaccine (wPV). Here we describe a protocol that we used to test the efficacy of a promising, novel adjuvant that skews immune responses to a protective Th1/Th17 phenotype and promotes a better clearance of a B. pertussis challenge from the murine respiratory tract. This article describes the protocol for mouse immunization, bacterial inoculation, tissue harvesting, and analysis of immune responses. Using this method, within our model, we have successfully elucidated crucial mechanisms elicited by a promising, next-generation acellular pertussis vaccine. This method can be applied to any infectious disease model in order to determine vaccine efficacy.

Here we present an elegant protocol for in vivo evaluation of vaccine effectiveness and host immune responses. This protocol can be adapted for vaccine models that study viral, bacterial, or parasitic pathogens.

Ana bilgisayar-patojen yanıt ve aşı etkinliği farelerde değerlendirilmesi

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a ...

Adoptive Immunotherapy of iNKT Cells in Glucose-6-Phosphate Isomerase (G6PI)-Induced RA Mice

Rheumatoid arthritis (RA) is a complex chronic inflammatory autoimmune disease. The pathogenesis of the disease is related to invariant natural killer T (iNKT) cells. Patients with active RA present fewer iNKT cells, defective cell function, and excessive polarization of Th1. In this study, an RA animal model was established using a mixture of hGPI325-339 and hGPI469-483 peptides. The iNKT cells were obtained by in vivo induction and in vitro purification, followed by infusion into RA mice for adoptive immunotherapy. The in vivo imaging system (IVIS) tracking revealed that iNKT cells were mainly distributed in the spleen and liver. On day 12 after cell therapy, the disease progression slowed down significantly, the clinical symptoms were alleviated, the abundance of iNKT cells in the thymus increased, the proportion of iNKT1 in the thymus decreased, and the levels of TNF-&#945;, IFN-&#947;, and IL-6 in the serum decreased. Adoptive immunotherapy of iNKT cells restored the balance of immune cells and corrected the excessive inflammation of the body.

Adoptive Immunotherapy of iNKT Cells in Glucose-6-Phosphate Isomerase G6PI-Induced RA Mice

This protocol uses G6PI mixed peptides to construct rheumatoid arthritis models that are closer to that of human rheumatoid arthritis in CD4+ T cells and cytokines. High purity invariant natural killer T cells (mainly iNKT2) with specific phenotypes and functions were obtained by in vivo induction and in vitro purification for adoptive immunotherapy.

Glukoz-6-Fosfat İzomazlarında (G6PI)-Indüklenen RA Farelerde iNKT Hücrelerinin Benimseyici İmmünoterapisi

Rheumatoid arthritis (RA) is a complex chronic inflammatory autoimmune disease. The pathogenesis of the disease is related to invariant natural killer T ...

Measurement of Chitinase Activity in Biological Samples

Chitinases are the enzymes that cleave chitin. Even in the absence of chitin, mammalians have significant amounts of chitinases present in the body including at baseline. The precise role of chitinase is not known, however it was believed to play important role in digestion and host defense against chitin-containing food and pathogens, respectively. Recent work, including ours, has shown an important role of chitinase and chitinase-like proteins in host immunity and allergic diseases. Importantly, chitinase activities serve as important biomarkers of disease severity in a wide-range of diseases including type 2 inflammatory diseases such as asthma and pulmonary fibrosis. Similarly, patients with genetic disorders like Gaucher disease have significantly elevated chitinase levels, which not only correlate with disease severity but also serve as a reliable biomarker for therapeutic effectiveness. The protocol outlined here describes a simple, quick, and straightforward way to measure chitinase activity in BAL or serum samples of mice and can be widely adapted to human subjects and other model organisms due to the highly conserved nature of the enzymes.

Presented here is a simple method to measure chitinase activity in biological fluids such as bronchoalveolar lavage or serum.

Biyolojik Örneklerde Konitinaz Aktivitesinin Ölçülmesi

Chitinases are the enzymes that cleave chitin. Even in the absence of chitin, mammalians have significant amounts of chitinases present in the body ...

Evaluation of T Follicular Helper Cells and Germinal Center Response During Influenza A Virus Infection in Mice

T Follicular Helper (Tfh) cells are an independent CD4+&#160;T cell subset specialized in providing help for germinal center (GC) development and generation of high-affinity antibodies. In influenza virus infection, robust Tfh and GC B cell responses are induced to facilitate effective virus eradication, which confers a qualified mouse model for Tfh-associated study. In this paper, we described protocols in detection of basic Tfh-associated immune response during influenza virus infection in mice. These protocols include: intranasal inoculation of influenza virus; flow cytometry staining and analysis of polyclonal and antigen-specific Tfh cells, GC B cells and plasma cells; immunofluorescence detection of GCs; enzyme-linked immunosorbent assay (ELISA) of influenza virus-specific antibody in serum. These assays basically quantify the differentiation and function of Tfh cells in influenza virus infection, thus providing help for studies in elucidating differentiation mechanism and manipulation strategy.

This paper describes protocols of evaluating Tfh and GC B response in mouse model of influenza virus infection.