저자는 기술적 조언과 르네 일 (캘리포니아 대학, 로스 앤젤레스)와 Seungmin 황 (워싱턴 대학)에서 지원을 인정하고 싶습니다. 이 작품은 박스터 재단, 건강 보조금 국립 연구소 (C. 리앙에 R01과 R21 CA140964 AI083841)에 의해 재정 지원되었다.

다음 프로토콜은 이론적 γHV68의와 비슷한 라이프 스타일을 공유하는 다른 바이러스에 의해 감염을 평가하는 데 사용할 수있는 마우스에 γHV68의 lytic 및 잠재 감염 사이클에 바이러스 titers 및 바이러스성 게놈로드의 연구를 설명합니다. 1. γHV68의 증폭 <ol><li> 37 ° C의 물을 욕조에 γHV68의 냉동 병을 녹여. </li><li> 37 10cm의 요리와 문화 감염된 세포 NIH3T12 또는 3T3 세포 배양 (~ 50% confluency)에 바이러스 inoculums 추가 ° C에서 5 % CO 2. </li><li> cytopathic 효과 (CPE)에 대한 현미경으로 문화를 검사하고 세포의 이상 80 % ~ 오일 감염 후 CPE 4를 보여줄 때 한 번에 미디어를 수집합니다. 바이러스의 수율을 최대화하기 위해 감염된 세포 배양은 세포 관련 γHV68을 해제 두 번 냉동 및 해동 수 있습니다. </li><li> 세포 파편을 제거하는 실내 온도 (RT)에서 5 분 1,000 RPM에서 수집된 미디어를 원심 분리기. </li><li> 조심스럽게 하단에있는 세포 파편을 건드리지 않고 새로운 튜브 (고속 원심 분리기 튜브)로 supernatants을 전송. </li><li> 4 12,000 rpm으로 고속 원심 분리기는 (Sorvall SA - 600) · C가 최소 1.5 시간에 대한 바이러스 입자를 집중합니다. </li><li> 10γ 표백 용액으로 supernatants을 취소하고 신중하게 1ml 혈청 프리 DMEM으로 펠렛을 (바이러스와 잔여 세포 파편) 다시 일시 중지합니다. 1.5 ML 마이크로 원심 튜브에 다시 정지 펠렛을 전송하고 vortexing하여 잘 섞는다. </li><li> 잔여 세포 파편을 제거하고 새 튜브로 (바이러스 재고) 뜨는을 전송하는 최대 속도에서 2 분 원심 분리기. 이것은 감염에 대한 최종 입소문 재고입니다. 바이러스 주식의 titer는 상패 분석​​ (아래 참조)에 의해 결정됩니다. </li></ol> 2. γHV68와 마우스의 비강 감염 <ol><li> 1000과 함께 세 ~ 6 주가되면 쥐를 감염 ~ γHV68 당 생쥐 5,000 상패 - 형성 단위 (PFU)를. </li><li> 마취복막 캐비티에 케타민을 / xylazine (80 MG / ML 케타민을 12 밀리그램 / ML xylazine의 혼합물 60 μl / 마우스)의 주사로 쥐. 쥐 발가락을 곤란하게하여 마취를 모니터링합니다. 그것은 보통 ~ 50-10 분 정도 소요됩니다. 마우스가 완전히 anesthetized하지 않으면, 그들은 바이러스를 재채기를합니다. </li><li> 마우스를 완전히 anesthetized 때, 느리지만 꾸준히 드롭하여 드롭 마우스로 PBS가 포함된 γHV68의 ~ 30 μl (각 콧구멍 15 μl)을 예방하기 위해 피펫을 사용합니다. 마우스 실제로 거품을 형성하려고하지 않고 방울을 흡입 있는지 확인하십시오. </li><li> 마우스 10-15 분 복구 및 케이지에게 반환하기 전에 생쥐 (예 : 의식, 호흡, 등)의 복지를 모니터링하도록 허용합니다. 동물은 음식, 물, 그리고 침대 조건의 질병 및 타당성에 대한 매일 확인하고 있습니다. 질병, 통증이나 고통의 임상 증상이 개발하는 경우, 병인을 결정하기 위해 일상적인 진단이 실시됩니다. 자신의 몸무게의 20 % 이상을 잃게 동물은 최대 체중 감량에 대한 기록됩니다그리고 euthanized. 안락사를 수행하는 최종 결정은 임상 수의사의 재량이며, 주요 조사와 함께 다음과 같은 상담 이루어집니다. </li></ol> 3. 심하게 감염된 폐 속의 바이러스 Titer를 확인하는 상패 분석 <ol><li> 바이러스 감염의 titers는 Vero 세포 monolayers에 상패 형성에 따라 결정됩니다. </li><li> Vero 세포는 / 잘 잘 접시 12 2.5x10 4 세포에서 상패 분석 전날 씨앗을 품고있다. 세포가 균일하게 분산되어야하며 세포 밀도가 30에 도달한다 - 40 % 상패 분석​​ 당일. </li><li> 0.5 % (W / V) 메틸 셀룰로오스 (MC) 오버레이 매체 (표 1) 준비합니다. </li><li> 5~7일 폐의 급성 상 바이러스 titers을 결정하기 위해 비강 감염 후 γHV68에 감염된 생쥐를 희생. euthanization 케타민을 HCL (80-100 밀리그램 / kg SC, IM, IP)의 IM 나 pe​​ntobarbital (30-50 MG / kg IP)의 정맥 과다 복용에 의해 다음 administrated 것입니다. 이 방법은 t의 승인을그는 미국 수의 의학 협회. </li><li> 폐를 수확하고 혈액 세포를 제거 1 X PBS로 두 번 씻어. 한 ML 얼음처럼 차가운 완전한 DMEM 매체에있는 폐 한 측면을 수집하고 얼음에 보관. 신속 qPCR (아래 참조)에 의해 폐가에서 바이러스성 DNA로드 검사를 위해 -80 ° C에서 폐 및 저장의 다른 측면을 동결. </li><li> 1 초, 냉동 및 해동 세 번의 최대 속도로 폐 조직을 homogenize하는 조직 균질 화기를 사용합니다. 예제를 변경하면 모든 단계에서 70 % 에탄올로 균 질기 씻으십시오. </li><li> 4 10 분 3,000 rpm으로 균질 조직을 원심 분리기 ° C. 뜨는를 수집 및 상패 분석​​을위한 새로운 튜브로 전송할 수 있습니다. </li><li> 와동에 의해 일반 DMEM과 1.5 ML 마이크로 원심 튜브에 폐 homogenate 샘플 시리얼 dilutions (보통 10 °에서 10 -8)를 준비. 미리 기입 해당 540 μl DMEM과 튜브의 번호와 최초의 튜브에 60 μl homogenate를 희석. 저는 처음 튜브에서 60 μl를 전송아니라 다음, 등등. </li><li> 12 잘 접시에 준비 Vero monolayers에서 미디어를 기음과 역순 (10 -8로 10 °에서)에서 전염성 바이러스를 포함하고 / 잘 순차적으로 희석 homogenate 200 μl를로드합니다. 각각의 적정 (중복)를 두 우물을 사용합니다. </li><li> 37 바이러스 inoculums 1 시간과 Vero 세포를 품어 ° C. 부드럽게 소용돌이 매 15 분 균등 monolayer를 통해 바이러스를 배포하는 번호판을. </li><li> inoculums를 제거하고 / 잘 오버레이 매체 (표 1) 2 ML로 바꾸십시오. 37 한 주일 동안 번호판을 품어 ° C. </li><li> 오버레이 매체를 제거합니다 (완료 할 필요가 없다)와 수정 / 상패 분석​​의 얼룩 매체 (표 1)과 교체하고 RT 적어도 1 시간을 위해 알을 품다. </li><li> 접시가 건조되면, 각 희석에서 잘 절연 plaques의 수를 계산합니다. 오류를 최소화하기 위해, 10과 100 plaques 사이의 포함하는 우물이 계산됩니다. </li><li> follo를 사용하여 바이러스 titer를 계산날개 공식 : titer (pfu / ML) = [/ (/ 잘 plaques의 수) (inoculums / 음의 볼륨)] X 희석 요인. </li></ol> 4. Latently 감염된 Splenocytes의 바이러스로드를 확인하는 전염성 센터 분석 <ol><li> 바이러스 잠재로드 Vero 세포의 monolayer에 전염성 센터 (IC) 분석에 의해 결정됩니다. 6 잘 접시의 IC 분석, 종자 Vero 세포 전날 (1 -. 1.0 X 10 5 세포 / 물론 우리는 일반적으로 비장 샘플 당 11 우물을 사용하여, 10 우물이 순차적으로 희석 splenocytes 서스펜션에 사용되며 테스트들이 한 냉동 해동 사이클 후 바이러스의 재활 성화 자연. </li><li> 지연이 (- 십사일 감염 후 12) 설립 후 감염된 생쥐를 희생. 마우스 비장과 수영장 그들이 한 ML 차게 DME​​M에를 수확. </li><li> 마우스 비장의 기계를 분해. 10cm 접시에 신선한 고립 마우스 spleens를 전송하고 2% FBS DMEM과 같은 원하는 매체의 10 ML를 추가합니다. 습식이 프로스트 엔드 유리 microsc얼음처럼 차가운 매체 ope 슬라이드. 슬라이드와 닉 다른 슬라이드의 프로스트 엔드의 가장자리와 캡슐의 프로스트쪽에 비장 놓으십시오. 모두 빨간 대단히 짧은 시간은 (있을 경우에는 지방 입자를 제거) 조각되기 전까지 기계적으로 두 슬라이드 사이의 비장을 떼어 놓다. </li><li> 두 슬라이드에 남아있는 세포를 복구하는 DMEM과 슬라이드를 씻어. </li><li> 50 ML 원추형 나사 캡 튜브에 세포 스트레이너 (40 μm의 나일론 메쉬)를 통해 부드럽게 전체 조직 현탁액을 전송합니다. 필터링 동안 10 ML PBS 및 전송과 비장의 homogenates을 포함하고있는 10cm의 접시를 씻으십시오. </li><li> 375 XG에서 단세포 정지 10 분 원심 분리기와 뜨는 폐기. 기존의 세포 대단히 짧은 시간을 해산시키기 위해 세포 알약을 톡. 붉은 혈액 세포를 lyse 5 ML ACK 버퍼 (표 1)을 추가합니다. 5 분 부화하고 375 X G.에서 다시 원심 분리기 </li><li> 뜨는을 취소하고 PBS에 부드럽게 아직 완전히 다시 중단 산탄,,, 2% FBS와 함께. 4 ° C. 세포 보관 에 피펫을 사용하여경우, 파편을 제거하십시오. 자동 세포 계수기 (생물 RAD)를 사용하여 가능한 세포를 세어보세요. </li><li> 4 분에 대한 375 XG에서 PBS - resuspended splenocytes을 돌린다. 뜨는 취소 및 4 ML 완전한 DMEM (2 × 1 ML 원래 정지의 IC 분석에 사용됩니다에있는 세포를 resuspend, 0.6 ML는 IC 분석에 시리얼 다섯 배 희석 사용, 바이러스성 DNA의 준비와 qPCR에 대한 0.4 ML, 1 ML 서스펜션은) 3 냉동 해동 사이클 후 잠재 바이러스의 재활 성화 자연을 평가하는 데 사용됩니다 </li><li> 중복 splenocytes 서스펜션의 직렬 5 배는 dilutions (예 : 5분의 1, 1 / 25, 1백25분의 1, 1 / 250) 준비합니다. 2.4 ML DMEM과 최초의 튜브에 600 μl splenocytes 서스펜션을 희석하고 잘 혼합과 함께 미리 기입은 15 ML 원뿔 튜브. 다음 튜브로 이전 튜브에서 600 μl을 전송 등 와동하지 마! </li><li> Vero 세포의 준비 6 잘 monolayer에서 매체를 기음. 각 희석 dupl와 Vero 세포에 순차적으로 희석된 splenocytes의 씨 하나 MLicated (10 우물은 0, 5분의 1, 1 / 25, 125분의 1, 2백50분의 1 dilutions에 사용됩니다.) </li><li> 37 접시 8-12 시간에게 품어 ° C와 5퍼센트 CO 2. 24 시간을 초과하지 마십시오. 씨앗을 품고 splenocytes 서스펜션을 기음 각 잘 ~ 4 ML 오버레이 미디어 (표 1)로드합니다. 추가로 6 일간 알을 품다. </li><li> 플라크 분석과 같이 크리스탈 바이올렛 0.2 % (W / V)와 함께 접시 염색법에 의해 비장 전염성 센터의 수준을 결정합니다. </li></ol> 5. 바이러스성 게놈의 부량 <ol><li> 본 실험에서는 이러한 폐와 비장 샘플로 γHV68에 감염된 조직에서 전체 게놈 DNA를 추출합니다. 제조 업체의 프로토콜 다음 DNeasy 혈액 및 조직 키트 (Qiagen)를 사용합니다. </li><li> qPCR 분석에 사용되는 DNA의 동일한 금액을 보장하기 위해 각 샘플의 DNA 농도를 결정합니다. 바이러스 특정 primers를 (~ 200 BP의 amplicon은 qPCR 분석에 대한 선호) 설계. 5 &amp;​​ PR : 우리는 γHV68 ORF56 특정 primers를 (앞으로 뇌관 사용IME, - GTAACTCGAGACTGAAACCTCGCAGAGGTCC - 3 &#39;; 역방향 프라이머 : 5&#39; - CCGAAGCTTGCACGGTGCAATGTGTCACAG - 3&#39;)이 분석 및 β - 굴지의 primers (앞으로 뇌관을 위해 : 5&#39; - cacccacactgtggcccatcat - 3 &#39;리버스 프라이머 : 5&#39; - gtgaggatcttcatgaggtagtc - 3&#39;)로 qPCR 반응에 대한 제어합니다. </li><li> (- 500 NG 좋은 100) 2 X SYBR 마스터 믹스 (바이오 - RAD IQ SYBR 녹색 Supermix)와 적절한 primers DNA 샘플을 섞는다. 감염된 조직에서 바이러스 부하를 수치 바이오 RAD 리얼 타임 PCR 시스템을 사용합니다. 다음과 같은 조건에서 PCR을 수행 : 15 분 및 95 45 사이클에 대해 95 ° C ° 30 분 C, 60 ° 30 분, 72에 대한 C ° C 바이러스와 모두, 곡선 분석을 용융 다음 30 분에 대한 굴지의 amplicons. </li><li> , 바이러스성 genomes의 부량에 대한 표준 곡선을 만들어 순차적으로 감염되지 않은 세포에서 분리된 게놈 DNA와 γHV68 bacmid DNA 알려진 양의 희석합니다. DNAs은 infec에서 검색한와 병렬로 qPCR을 실행바이러스 특정 primers의 동일한 집합을 사용하여 테드 조직. </li><li> 굴지 정규화 후 게놈 DNA의 단위 당 바이러스의 DNA 복사본 번호 (예 : 100 또는 500 NG NG)로 조직에서 바이러스 게놈로드를 제시한다. </li></ol> 6. 대표 결과 : 그림 1은 생체내의 생쥐에 γHV68 감염의 측정을위한 실험의 전반적인 구조를 묘사. 로 상패 분석​​에 의해 결정 γHV68의 급성 감염시 폐에서 바이러스 titers의 대표 결과, 그림 2A에 표시된되었습니다. 포함 γHV68의 돌연변이 변형되지 않은 기능 바이러스성 BCL - 2 칠일 BALB / C 생쥐 (6 - 그룹당 7 생쥐)의 비강 감염 후 폐에 야생 형 γHV68에 비해 레벨에서 복제 (vBcl - 2). 바이러스의 폐 titers에 통계적으로 의미있는 차이는 두 그룹 사이에 감지되지 않았습니다. 이 데이터는 vBcl - 2가 γHV68의 급성 감염 중요한 요소되지 않았음을 나타냅니다마우스. 그러나 28 일 postinfection으로 spleens에서 vBcl - 2 돌연변이 바이러스의 titer는 6 떨어뜨 렸어 - 10 - 배와 같은 전염성 센터 분석 (그림 2B)에 의해 측정 WT에 비해 제안하는 vBcl - 2 돌연변이 γHV68 바이러스 감염 후 지라 대기의 정비에 결함이 있습니다. 감소 전염성 센터 titers와 계약에서 vBcl - 2 돌연변이 바이러스의 바이러스 게놈로드는 심각하게 그림 2C와 같이 반복 실험에서 일 28시 WT 바이러스의에 비해 감소했다. 감염의 잠재 단계에서 잠재 - HV68vBcl - 2 돌연변이 바이러스 재활 성화 전의 생체내의 바이러스 게놈로드와 주파수 사이의 가까운 상관 관계는이 돌연변이 바이러스 감염의 지연 결함을 강조 표시합니다. <img alt="그림 1" src="/files/ftp_upload/3472/3472fig1.jpg" /> 그림 1. 상패 형성 수단, 전염성 센터 및 qPCR 분석하여 마우스에 γHV68 감염의 측정 도식 다이어그램S. <img alt="그림 2" src="/files/ftp_upload/3472/3472fig2.jpg" /> 그림 2. 생체내에서 WT와 돌연변이 바이러스의 γHV68 Lytic 및 잠재 감염. 7 DPI (일 게시물 감염)에서 BALB / C 생쥐의 폐에서 WT와 돌연변이 vBcl - 2 γHV68 바이러스의 급성 복제는 (A) 상패 분석​​에 의해 결정되었다. (B와 C) 지라 전염성 센터 (B)와 감염된 생쥐의 spleens에서 바이러스 게놈로드 (C) 각각 전염성 센터 분석 및 qPCR에 의해 28 DPI에서 측정되었다. 레드 라인, 표시된 값의 평균. NS, 중요하지 않습니다.

<ol>
	<li>Damania, B., Choi, J. K., Jung, J. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Signaling+activities+of+gammaherpesvirus+membrane+proteins.">Signaling activities of gammaherpesvirus membrane proteins.</a> J. Virol. 74, 1593-1601 (2000).</li><li>Stevenson, P. G., Efstathiou, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+mechanisms+in+murine+gammaherpesvirus-68+infection.">Immune mechanisms in murine gammaherpesvirus-68 infection.</a> Viral. Immunol. 18, 445-456 (2005).</li><li>Flano, E., Husain, S. M., Sample, J. T., Woodland, D. L., Blackman, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Latent+murine+gamma-herpesvirus+infection+is+established+in+activated+B+cells,+dendritic+cells,+and+macrophages.">Latent murine gamma-herpesvirus infection is established in activated B cells, dendritic cells, and macrophages.</a> J. Immunol. 165, 1074-1081 (2000).</li><li>Sunil-Chandra, N. P., Efstathiou, S., Nash, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+establishes+a+latent+infection+in+mouse+B+lymphocytes+in+vivo.">Murine gammaherpesvirus 68 establishes a latent infection in mouse B lymphocytes in vivo.</a> J. Gen. Virol. 73, 3275-3279 (1992).</li><li>Simas, J. P., Swann, D., Bowden, R., Efstathiou, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+murine+gammaherpesvirus-68+transcription+during+lytic+and+latent+infection.">Analysis of murine gammaherpesvirus-68 transcription during lytic and latent infection.</a> J. Gen. Virol. 80, 75-82 (1999).</li><li>Ganem, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KSHV+and+the+pathogenesis+of+Kaposi+sarcoma:+listening+to+human+biology+and+medicine.">KSHV and the pathogenesis of Kaposi sarcoma: listening to human biology and medicine.</a> J. Clin. Invest. 120, 939-949 (2010).</li><li>Wen, K. W., Damania, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kaposi+sarcoma-associated+herpesvirus+(KSHV):+molecular+biology+and+oncogenesis.">Kaposi sarcoma-associated herpesvirus (KSHV): molecular biology and oncogenesis.</a> Cancer. Lett. 289, 140-150 (2009).</li><li>E, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Bcl-2-mediated+evasion+of+autophagy+aids+chronic+infection+of+gammaherpesvirus+68.">Viral Bcl-2-mediated evasion of autophagy aids chronic infection of gammaherpesvirus 68.</a> PLoS. Pathog. 5, e1000609-e1000609 (2009).</li><li>Marques, S., Efstathiou, S., Smith, K. G., Haury, M., Simas, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+gene+expression+of+latent+murine+gammaherpesvirus+68+in+B+lymphocytes.">Selective gene expression of latent murine gammaherpesvirus 68 in B lymphocytes.</a> J. Virol. 77, 7308-7318 (2003).</li><li>McCausland, M. M., Crotty, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+PCR+technique+for+detecting+lymphocytic+choriomeningitis+virus+in+vivo.">Quantitative PCR technique for detecting lymphocytic choriomeningitis virus in vivo.</a> J. Virol. Methods. 147, 167-176 (2008).</li><li>Weck, K. E., Kim, S. S., Virgin, H. I., Speck, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cells+regulate+murine+gammaherpesvirus+68+latency.">B cells regulate murine gammaherpesvirus 68 latency.</a> J. Virol. 73, 4651-4661 (1999).</li><li>Weck, K. E., Kim, S. S., Virgin, H. I., Speck, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Macrophages+are+the+major+reservoir+of+latent+murine+gammaherpesvirus+68+in+peritoneal+cells.">Macrophages are the major reservoir of latent murine gammaherpesvirus 68 in peritoneal cells.</a> J. Virol. 73, 3273-3283 (1999).</li></ol>

관심 없음 충돌 선언하지 않습니다.

γHV68 널리 인간 γ - HVs 2,4,5의 pathogenesis을 이해하기위한 모델로 사용되고 있습니다. 이 프로토콜에서는, 우리는 생쥐의 비강 접종 후 γHV68의 급성 및 잠재 감염을 평가하는, 전염성 바이러스 titer에 대한 상패 분석​​, 바이러스 잠재 부하에 대한 IC 분석 및 바이러스 게놈 하중에 대한 qPCR을 포함하여 세 정기적으로 사용하는 방법을 설명했다. 플라크 분석은 감염된 ?...

<table border="1"><tbody><tr><td> 재료 이름 </td><td> 준비 절차 </td></tr><tr><td> 바이러스성 플라크 분석을위한 메틸 셀룰로오스 (MC) 오버레이 매체 </td><td><ol><li> 열 ~&gt; 80 TC 병에 증류수 250 ML ° C (전자 레인지에서 3 분 끓는) </li><li> 녹아까지 저열 이상의 감동, 온수 물로 점차적으로 2.5 g MC 가루를 추가합니다. </li><li> 액체 사이클에서 15 분 즉시 압력솥. </li><li> 4 ° C 하룻밤에 autoclaved MC 미디어를 감동. </li><li> 200ml 2 250 ML MC 미디어를 결합하여 X 가상 (Gibco - BRL) + 500 ML 오버레이 미디어를주고 50 ML FBS. </li></ol></td></tr><tr><td> 수정 / 상패 분석​​을위한 매체를 얼룩 </td><td> 0.2 % (W / V) 20 % 에탄올에 크리스탈 바이올렛. </td></tr><tr><td> ACK 용해 완충액 </td><td> NH 4 망할 CIA 0.15M, KHCO 3 10mM, EDTA (에틸렌 다이아 민 테트라 초산) 0.1mM </td></tr><tr><td> 완전한 DMEM </td><td> Dulbecco의 수정된 이글 배지2 MM L - 글루타민,, 1 % 페니실린 - 스트렙토 마이신 (Gibco - BRL); (DMEM) 10 % 태아 소 혈청 (FBS Invitrogen)과 보완. </td></tr></tbody></table> 이 프로토콜에서 사용되는 표 1. 특정 미디어 <table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td></tr><tr><td> 케타민을 </td><td> 시그마 - 올드 리치 </td><td> K2753 </td></tr><tr><td> Xylazine </td><td> 시그마 - 올드 리치 </td><td> X1251 </td></tr><tr><td> 메틸 셀룰로오스 </td><td> 시그마 - 올드 리치 </td><td> M0512 - 250g </td></tr><tr><td> 이 X 가상 </td><td> 생명 기술 </td><td> 11,935 </td></tr><tr><td> 셀 스트레이너 </td><td> BD Faclon </td><td> 352,340 </td></tr><tr><td> 옴니 조직 균 질기 </td><td> 오마이 뉴스 인터내셔널 국제 </td><td> TH115 </td></tr><tr><td> DNeasy 혈액 및 조직 키트 </td><td> Qia세대 </td><td> 69,504 </td></tr><tr><td> iQTM SYBRH 그린 Supermix </td><td> BioRad </td><td> 170-8882 </td></tr><tr><td> CFX96 실시간 PCR 시스템 </td><td> 바이오 방사선 </td><td> 184-5072 </td></tr><tr><td> 세포 카운터 </td><td> 바이오 방사선 </td><td> 145-0001 </td></tr><tr><td> Sorvall SA - 600 </td><td> 써모 과학 </td><td> 096-124022 </td></tr></tbody></table> 표 2. 특정 시약 및 장비

measurement of &#947;hv68 infection in mice

γ - Herpesviruses은 (γ - HVs) 림프 세포 1 잠재 감염을 수립하는 능력에 대해 주목할 수 있습니다. 이러한 EBV 및 KSHV 인간 γ - HVs의 좁은 호스트 범위는, 심각하게 상세한 병원성 연구를 방해하고 있습니다. Murine γ - herpesvirus 68 (γHV68) 주 γ - HVs 인간과 함께 광범위한 유전 및 생물 학적 유사성이 murid 설치류 2 자연 병원체이다. 바이러스 감염의 다른 단계에 쥐를 근친 계통의 γHV68 감염 등, 평가는 γ - HVs 감염시 바이러스 라이프 사이클과 pathogenesis를 이해하는 중요한 모델을 제공합니다. 비강에 접종되면 폐에서 급성 viremia의 γHV68 감염 결과는 나중에 splenocytes와 호스트 3,4의 생활 전반에 걸쳐 활성화할 수 있습니다 기타 세포의 잠재 감염으로 해결되었는지. 이 프로토콜에서는, 우리는 엉덩이에 플라크 분석을 사용하는 방법을 설명합니다이후 비강 감염 (DPI)의 - 폐에의 전염성 바이러스 titer는 초기 단계 (7 일 5)에서 Vero 세포 monolayers에 homogenates. 급성 감염이 대부분이 취소되는 동안 - 3 주 postinfection, γHV68의 잠재 감염을 14 DPI 주변 설립 이후 생쥐의 비장에서 유지됩니다. 잠재 감염은 대개 바이러스가 잠복 숙박 및 유전자 발현의 대부분을 껐다 의하여, 감염된 조직에서 세포의 매우 작은 인구에 영향을 미칩니다. Latently에 감염된 splenocytes은 저절로 바이러스 잠재 하중을 결정하는 전염성 센터 (IC) 분석에 의해 recapitulated 수있는 조직 문화로 explanting에 따라 바이러스를 재활 성화. 더욱 심하게 및 / 또는 latently 감염된 조직, 정량 실시간 PCR의 바이러스성 게놈 복사의 양을 추정 (qPCR)는 최대한의 감도와 정확성을 위해 사용됩니다. qPCR과 플라크 분석, 및 / 또는 IC 분석의 결과를 결합 분석은 바이러스의 spatiotemporal 프로필을 공개합니다생체내의 복제 및 감염.

Watch this Scientific Journal Video about Measurement of Î³HV68 Infection in Mice at JoVE.com

Measurement of &#947;HV68 Infection in Mice

γ - Herpesviruses은 (γ - HVs) 자신의 호스트에서 평생 persistency을 설정합니다. γ - HV68과 생쥐의 감염은 유전자 다루기 쉬운을 제공합니다<em&gt; 생체내에</emγHVs의 라이프 사이클 / pathogenesis의 특성화를 위해&gt; 모델입니다. 이 프로토콜은 플라크 - 형성, 전염성 센터 및 qPCR의 assays에 의해 감염 다음과 같은 급성 및 잠재 단계에서 γHV68 감염의 탐지 및 quantitation을 설명합니다.

마우스에 γHV68 감염의 측정

&gamma;-Herpesviruses (&gamma;-HVs) are notable for their ability to establish latent infections of lymphoid cells1. The narrow host range of human ...

Research

JoVE Journal

Immunology and Infection

13.5K 조회수.  University of Southern California, Los Angeles. γ - Herpesviruses은 (γ - HVs) 자신의 호스트에서 평생 persistency을 설정합니다. γ - HV68과 생쥐의 감염은 유전자 다루기 쉬운을 제공합니다 생체내에 모델입니다. 이 프로토콜은 플라크 - 형성, 전염성 센터 및 qPCR의 assays에 의해 감염 다음과 같은 급성 및 잠재 단계에서 γHV68 감염의 탐지 및 quantitation을 설...

비디오: Measurement of γHV68 Infection in Mice

A Method for Labeling Vasculature in Embryonic Mice

The establishment of a functional blood vessel network is an essential part of organogenesis, and is required for optimal organ function. For example, in the thymus proper vasculature formation and patterning is essential for thymocyte entry into the organ and mature T-cell exit to the periphery. The spatial arrangement of blood vessels in the thymus is dependent upon signals from the local microenvironment, namely thymic epithelial cells (TEC). Several recent reports suggest that disruption of these signals results in thymus blood vessel defects 1,2. Previous studies have described techniques used to label the neonatal and adult thymus vasculature 1,2. We demonstrate here a technique for labeling blood vessels in the embryonic thymus. This method combines the use of FITC-dextran or Griffonia (Bandeiraea) Simplicifolia Lectin I (GSL 1 - isolectin B4) facial vein injections and CD31 antibody staining to identify thymus vascular structures and PDGFR-&beta; to label thymic perivascular mesenchyme 3-5. The option of using cryosections or vibratome sections is also provided. This protocol can be used to identify thymus vascular defects, which is critical for defining the roles of TEC-derived molecules in thymus blood vessel formation. As the method labels the entire vasculature, it can also be used to analyze the vascular networks in multiple organs and tissues throughout the embryo including skin and heart 6-10.

This article describes a method for labeling embryonic skin and thymus blood vessels.

배아 마우스에 Vasculature을 라벨링하는 방법

The establishment of a functional blood vessel network is an essential part of organogenesis, and is required for optimal organ function. For example, in ...

연구

면역학 및 감염병학

Measurement of Cytosolic Ca2+ in Isolated Contractile Lymphatics

Lymphatic vessels comprise a multifunctional transport system that maintains fluid homeostasis, delivers lipids to the central circulation, and acts as a surveillance system for potentially harmful antigens, optimizing mucosal immunity and adaptive immune responses1. Lymph is formed from interstitial fluid that enters blind-ended initial lymphatics, and then is transported against a pressure gradient in larger collecting lymphatics. Each collecting lymphatic is made up of a series of segments called lymphangions, separated by bicuspid valves that prevent backflow. Each lymphangion possesses a contractile cycle that propels lymph against a pressure gradient toward the central circulation2. This phasic contractile pattern is analogous to the cardiac cycle, with systolic and diastolic phases, and with a lower contraction frequency4. In addition, lymphatic smooth muscle generates tone and displays myogenic constriction and dilation in response to increases and decreases in luminal pressure, respectively5. A hybrid of molecular mechanisms that support both the phasic and tonic contractility of lymphatics are thus proposed.
Contraction of smooth muscle is generally regulated by the cytosolic Ca2+ concentration ([Ca2+]i) plus sensitivity to Ca2+, of the contractile elements in response to changes in the environment surrounding the cell6. [Ca2+]i is determined by the combination of the movement of Ca2+ through plasma membrane ligand or voltage gated Ca2+ channels and the release and uptake of Ca2+ from internal stores. Cytosolic Ca2+ binds to calmodulin and activates enzymes such as myosin light chain (MLC) kinase (MLCK), which in turn phosphorylates MLC leading to actin-myosin-mediated contraction8. However, the sensitivity of this pathway to Ca2+ can be regulated by the MLC phosphatase (MLCP)9. MLCP activity is regulated by Rho kinase (ROCK) and the myosin phosphatase inhibitor protein CPI-17.
Here, we present a method to evaluate changes in [Ca2+]i over time in isolated, perfused lymphatics in order to study Ca2+-dependent and Ca2+-sensitizing mechanisms of lymphatic smooth muscle contraction. Using isolated rat mesenteric collecting lymphatics we studied stretch-induced changes in [Ca2+]i and contractile activity. The isolated lymphatic model offers the advantage that pressure, flow, and the chemical composition of the bath solution can be tightly controlled. [Ca2+]i was determined by loading lymphatics with the ratiometric, Ca2+-binding dye Fura-2. These studies will provide a new approach to the broader problem of studying the different molecular mechanisms that regulate phasic contractions versus tonic constriction in lymphatic smooth muscle.

Measurement of Cytosolic Ca2+ in Isolated Contractile Lymphatics

We introduce an approach to evaluate the cytosolic Ca2+ concentration in isolated lymphatics to study Ca2+-dependent and Ca2+-sensitizing mechanisms of lymphatic smooth muscle contraction.

Cytosolic CA의 측정 2 + 절연 수축성 Lymphatics에

Lymphatic vessels comprise a multifunctional transport system that maintains fluid homeostasis, delivers lipids to the central circulation, and acts as a ...

4D Multimodality Imaging of Citrobacter rodentium Infections in Mice

This protocol outlines the steps required to longitudinally monitor a bioluminescent bacterial infection using composite 3D diffuse light imaging tomography with integrated &mu;CT (DLIT-&mu;CT) and the subsequent use of this data to generate a four dimensional (4D) movie of the infection cycle. To develop the 4D infection movies and to validate the DLIT-&mu;CT imaging for bacterial infection studies using an IVIS Spectrum CT, we used infection with bioluminescent C. rodentium, which causes self-limiting colitis in mice. In this protocol, we outline the infection of mice with bioluminescent C. rodentium and non-invasive monitoring of colonization by daily DLIT-&mu;CT imaging and bacterial enumeration from feces for 8 days.
The use of the IVIS Spectrum CT facilitates seamless co-registration of optical and &mu;CT scans using a single imaging platform. The low dose &mu;CT modality enables the imaging of mice at multiple time points during infection, providing detailed anatomical localization of bioluminescent bacterial foci in 3D without causing artifacts from the cumulative radiation. Importantly, the 4D movies of infected mice provide a powerful analytical tool to monitor bacterial colonization dynamics in vivo.

4D Multimodality Imaging of Citrobacter rodentium Infections in Mice

Multi-modality imaging is a valuable approach for studying bacterial colonization in small animal models. This protocol outlines infection of mice with bioluminescent Citrobacter rodentium and the longitudinal monitoring of bacterial colonization using composite 3D diffuse light imaging tomography with &mu;CT imaging to create a 4D movie of C. rodentium infection.

의 4D 좌석 Multimodality 이미징<em&gt; Citrobacter rodentium</em마우스에서&gt; 감염

This protocol outlines the steps required to  longitudinally monitor a bioluminescent bacterial infection using composite 3D diffuse light imaging ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

장기 만성<em&gt; 녹농균</em마우스의&gt;기도 감염

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

Measuring Local Anaphylaxis in Mice

Allergic responses are the result of the activation of mast cells and basophils, and the subsequent release of vasoactive and proinflammatory mediators. Exposure to an allergen in a sensitized individual can result in clinical symptoms that vary from minor erythema to life threatening anaphylaxis. In the laboratory, various animal models have been developed to understand the mechanisms driving allergic responses. Herein, we describe a detailed method for measuring changes in vascular permeability to quantify localized allergic responses. The local anaphylaxis assay was first reported in the 1920s, and has been adapted from the technique published by Kojima et al. in 20071. In this assay, mice sensitized to OVA are challenged in the left ear with vehicle and in the right ear with OVA. This is followed by an intravenous injection of Evans Blue dye. Ten min after injecting Evans Blue, the animal is euthanized and the dye that has extravasated into the ears is extracted overnight in formamide. The absorbance of the extracted dye is then quantified with a spectrophotometer. This method reliably results in a visual and quantifiable manifestation of a local allergic response.

Allergic responses, characterized by the activation of mast cells and basophils, are driven by the cross-linking of IgE and release of proinflammatory mediators. A quantitative assessment of allergic responses can be achieved by using Evans Blue dye to monitor changes in vascular permeability after allergen challenge.

마우스에 현지 아나필락시스 측정

Allergic responses are the result of the activation of mast cells and basophils, and the subsequent release of vasoactive and proinflammatory mediators. ...

Size Matters: Measurement of Capsule Diameter in Cryptococcus neoformans

The polysaccharide capsule of Cryptococcus neoformans is the primary virulence factor and one of the most commonly studied aspects of this pathogenic yeast. Capsule size can vary widely between strains, has the ability to grow rapidly when introduced to stressful or low nutrient conditions, and has been positively correlated with strain virulence. For these reasons, the size of the capsule is of great interest to C. neoformans researchers. The growth of the C. neoformans capsule is induced during phenotypic testing to help understand the effects of different treatments on the yeast or size differences between strains. Here we describe one of the standard methods of capsule induction and compare two accepted methods of staining and measuring capsule diameter: (i) India ink, a negative stain, used in conjunction with conventional light microscopy and (ii) co-staining with fluorescent dyes of both the cell wall and capsule followed by confocal microscopy. Finally, we show how measurement of capsule diameter from India ink-stained samples can be automated using computational image analysis.

Size Matters: Measurement of Capsule Diameter in Cryptococcus neoformans

The polysaccharide capsule is the primary virulence factor in Cryptococcus neoformans, and its size correlates with strain virulence. Capsule diameter measurements are used in phenotypic testing and to gauge therapeutic efficacy. Here a standard method of capsule induction is presented, and two methods of staining and measuring diameter are compared.

Cryptococcus neoformans 에서 캡슐 직경의 크기 문제: 측정

The polysaccharide capsule of Cryptococcus neoformans is the primary virulence factor and one of the most commonly studied aspects of this pathogenic ...

A Method for the Measurement of Salivary Gland Function in Mice

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced saliva production. Similarly, saliva production is severely compromised in patients receiving radiation treatment for head and neck cancers. Rodent models, developed to mimic these clinical conditions, facilitate an understanding of the disease pathogenesis and allow for the development of new therapeutic strategies. Therefore, the ability to accurately, reproducibly, and repeatedly measure salivary gland function in animal models is critical. Building on procedures previously described in the literature, a method was developed that meets these criteria and was used to evaluate salivary gland function in mice. An additional advantage of this new method is that it is easily mastered, and has little inter-operator variation. Salivary gland function is evaluated as the amount (weight or volume) or rate (mL/min) of saliva produced in response to pilocarpine stimulation. The collected saliva is a good source for the analyses of protein content, immunoglobulin concentrations, and other biomolecules.

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

쥐에 있는 침 샘 기능의 측정 하는 방법

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced ...

Characterization of Thymus-dependent and Thymus-independent Immunoglobulin Isotype Responses in Mice Using Enzyme-linked Immunosorbent Assay

Antibodies, also termed as immunoglobulins (Ig), secreted by differentiated B lymphocytes, plasmablasts/plasma cells, in humoral immunity provide a formidable defense against invading pathogens via diverse mechanisms. One major goal of vaccination is to induce protective antigen-specific antibodies to prevent life-threatening infections. Both thymus-dependent (TD) and thymus-independent (TI) antigens can elicit robust antigen-specific IgM responses and can also induce the production of isotype-switched antibodies (IgG, IgA and IgE) as well as the generation of memory B cells with the help provided by antigen presenting cells (APCs). Here, we describe a protocol to characterize TD and TI Ig isotype responses in mice using enzyme-linked immunosorbent assay (ELISA). In this protocol, TD and TI Ig responses are elicited in mice by intraperitoneal (i.p.) immunization with hapten-conjugated model antigens TNP-KLH (in alum) and TNP-polysaccharide (in PBS), respectively. To induce TD memory response, a booster immunization of TNP-KLH in alum is given at 3 weeks after the first immunization with the same antigen/adjuvant. Mouse sera are harvested at different time points before and after immunization. Total serum Ig levels and TNP-specific antibodies are subsequently quantified using Ig isotype-specific Sandwich and indirect ELISA, respectively. In order to correctly quantify the serum concentration of each Ig isotype, the samples need to be appropriately diluted to fit within the linear range of the standard curves. Using this protocol, we have consistently obtained reliable results with high specificity and sensitivity. When used in combination with other complementary methods such as flow cytometry, in vitro culture of splenic B cells and immunohistochemical staining (IHC), this protocol will allow researchers to gain a comprehensive understanding of antibody responses in a given experimental setting.

In this paper, we describe a protocol to characterize T-dependent and T-independent immunoglobulin (Ig) isotype responses in mice using ELISA. This method used alone or in combination with flow cytometry will allow researchers to identify differences in B cell-mediated Ig isotype responses in mice following T-dependent and T-independent antigen immunization.

Thymus 종속 및 독립 Thymus 면역 글로불린 Isotype 반응 효소 연결 된 Immunosorbent 분석 결과 사용 하 여 마우스의 특성

Antibodies, also termed as immunoglobulins (Ig), secreted by differentiated B lymphocytes, plasmablasts/plasma cells, in humoral immunity provide a ...

High-throughput Measurement of Plasma Membrane Resealing Efficiency in Mammalian Cells

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In response to these damages, complex molecular machineries rapidly reseal the plasma membrane to restore its barrier function and maintain cell survival. Despite 60 years of research in this field, we still lack a thorough understanding of the cell resealing machinery. With the goal of identifying cellular components that control plasma membrane resealing or drugs that can improve resealing, we have developed a fluorescence-based high-throughput assay that measures the plasma membrane resealing efficiency in mammalian cells cultured in microplates. As a model system for plasma membrane damage, cells are exposed to the bacterial pore-forming toxin listeriolysin O (LLO), which forms large 30-50 nm diameter proteinaceous pores in cholesterol-containing membranes. The use of a temperature-controlled multi-mode microplate reader allows for rapid and sensitive spectrofluorometric measurements in combination with brightfield and fluorescence microscopy imaging of living cells. Kinetic analysis of the fluorescence intensity emitted by a membrane impermeant nucleic acid-binding fluorochrome reflects the extent of membrane wounding and resealing at the cell population level, allowing for the calculation of the cell resealing efficiency. Fluorescence microscopy imaging allows for the enumeration of cells, which constitutively express a fluorescent chimera of the nuclear protein histone 2B, in each well of the microplate to account for potential variations in their number and allows for eventual identification of distinct cell populations. This high-throughput assay is a powerful tool expected to expand our understanding of membrane repair mechanisms via screening for host genes or exogenously added compounds that control plasma membrane resealing.

Here we describe a high-throughput fluorescence-based assay that measures the plasma membrane resealing efficiency through fluorometric and imaging analyses in living cells. This assay can be used for screening drugs or target genes that regulate plasma membrane resealing in mammalian cells.

포유류 세포에서 효율 Resealing 원형질 막의 높은 처리량 측정

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In ...

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a striking increase in life expectancy around the globe. Nonetheless, determining vaccine efficacy remains a challenge. Emerging evidence suggests that the current acellular vaccine (aPV) for Bordetella pertussis (B. pertussis) induces suboptimal immunity. Therefore, a major challenge is designing a next-generation vaccine that induces protective immunity without the adverse side effects of a whole-cell vaccine (wPV). Here we describe a protocol that we used to test the efficacy of a promising, novel adjuvant that skews immune responses to a protective Th1/Th17 phenotype and promotes a better clearance of a B. pertussis challenge from the murine respiratory tract. This article describes the protocol for mouse immunization, bacterial inoculation, tissue harvesting, and analysis of immune responses. Using this method, within our model, we have successfully elucidated crucial mechanisms elicited by a promising, next-generation acellular pertussis vaccine. This method can be applied to any infectious disease model in order to determine vaccine efficacy.

Here we present an elegant protocol for in vivo evaluation of vaccine effectiveness and host immune responses. This protocol can be adapted for vaccine models that study viral, bacterial, or parasitic pathogens.

호스트 병원 체 응답 및 쥐에 백신의 효능 평가

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a ...

마우스에 γHV68 감염의 측정

요약

더 많은 비디오 탐색

이 비디오의 챕터