Die Autoren bedanken sich bei der technischen Beratung und Unterstützung von Ren Sun (University of California, Los Angeles) und Seungmin Hwang (Washington University) bestätigen. Diese Arbeit wurde von der Baxter Foundation, National Institutes of Health gewährt (R01 und R21 CA140964 AI083841 C. Liang) finanziert.

Das folgende Protokoll beschreibt die Studie der Virustiter und viralen Genoms Lasten in den lytischen und latenten Infektion Zyklus γHV68 in Mäusen, die theoretisch benutzt werden, um Infektionen durch andere Viren, die ähnliche Lebensweise, dass der γHV68 bewerten. 1. Verstärkung von γHV68 <ol><li> Tauwetter eine gefrorene Flasche γHV68 in 37 ° C Wasserbad. </li><li> Add viralen Inokulums zu NIH3T12 oder 3T3 Zellkultur (~ 50% Konfluenz) in 10 cm Schalen und Kultur der infizierten Zellen bei 37 ° C in 5% CO 2. </li><li> Untersuchen Sie die Kultur von Mikroskopie für zytopathischen Effekts (CPE) und sammeln die Medien zu einem Zeitpunkt mehr als 80% der Zellen CPE 4 zeigen ~ 5 Tage nach der Infektion. Zur Maximierung der Ausbeute an Virus, kann die infizierte Zellkultur zweimal, um alle Zell-assoziierten γHV68 Release eingefroren und aufgetaut. </li><li> Centrifuge der gesammelten Medien bei 1000 rpm für 5 min bei Raumtemperatur (RT), um Zelltrümmer zu entfernen. </li><li> Sorgfältig Transfer der Überstände, neue Rohre (High-Speed-Zentrifugenröhrchen), ohne die Zelltrümmer am Boden. </li><li> High-Speed-Zentrifuge bei 12.000 rpm (Sorvall SA für-600) bei 4 ° C für mindestens 1,5 Stunden zu konzentrieren Viruspartikel. </li><li> Entsorgen Sie die Überstände in 10γ Bleichlösung und sorgfältig resuspendieren des Pellets (Virus-und Rest-Zelltrümmer) mit 1 ml serumfreiem DMEM. Übertragen Sie die resuspendierten Pellets in ein 1,5 ml Mikro-Zentrifugenröhrchen und gut mischen durch Vortexen. </li><li> Säule für 2 min bei maximaler Geschwindigkeit, um restliche Zelltrümmer zu entfernen und den Überstand (Virus Lager) in ein neues Röhrchen. Dies ist der letzte virale Lager für eine Infektion. Der Titer des Virus Lager wird durch Plaque-Assay (siehe unten) bestimmt. </li></ol> 2. Intranasale Infektion von Mäusen mit γHV68 <ol><li> Infect Mäuse bei ~ Alter von 6 Wochen mit 1.000 ~ 5.000 Plaque-bildenden Einheiten (PFU) von γHV68 pro Mäusen. </li><li> AnästhesierenMäusen durch Injektion von Ketamin / Xylazin (60 ul / Maus aus einer Mischung von 80 mg / ml Ketamin und 12 mg / ml Xylazin) in Bauchhöhle. Monitor-Anästhesie durch Kneifen der Mäuse Zeh. Es dauert in der Regel ~ 5-10 min. Wenn Mäuse nicht vollständig betäubt, werden sie niesen das Virus. </li><li> Wenn die Maus voll narkotisiert ist, verwenden Sie eine Pipette auf ~ 30 ul PBS γHV68 (15 ul an jedem Nasenloch), um Mäuse zu impfen langsam, aber stetig Drop-by-drop. Seien Sie sicher, dass die Maus ist in der Tat das Einatmen der Tropfen ohne zu versuchen, Blasen zu bilden. </li><li> Lassen Sie die Maus für 10-15 min zu erholen und zu überwachen das Wohlbefinden der Mäuse (zB Bewusstsein, Atmung, etc.), bevor sie dann wieder in den Käfig. Die Tiere werden täglich für die Krankheit und die Angemessenheit von Nahrung, Wasser und Einstreu Bedingungen überprüft. Wenn klinische Zeichen einer Krankheit, Schmerzen oder Ängste zu entwickeln, wird der Routinediagnostik zur Ätiologie zu bestimmen durchgeführt werden. Tiere, die mehr als 20% ihres Körpergewichts verlieren, wird für maximale Gewichtsverlust aufgezeichnet werdenund eingeschläfert. Die endgültige Entscheidung zur Euthanasie führen, liegt im Ermessen der klinischen Tierarzt und wird nach Rücksprache mit dem Principal Investigator. </li></ol> 3. Plaque-Assay auf der Virustiter in akut infizierten Lunge fest <ol><li> Virus Infektiositätstiter werden durch die Bildung von Plaque auf Monoschichten von Vero-Zellen bestimmt. </li><li> Vero-Zellen werden bei 2.5x10 4 Zellen / well in 12-Well-Platten ausgesät am Tag vor Plaque-Assay. Die Zellen sollten gleichmäßig verteilt werden und die Zelldichte sollte 30 zu erreichen - 40% am Tag der Plaque-Assay. </li><li> Bereiten Sie 0,5% (w / v) Methylcellulose (MC)-Overlay-Medium (Tabelle 1). </li><li> Sacrifice γHV68-infizierten Mäusen 5-7 Tage nach intranasaler Infektion Akute-Phase-Virustiter in der Lunge zu bestimmen. Für euthanization Ketamin HCl (80-100 mg / kg SC, IM, IP) wird verwaltet IM durch intravenöse Überdosis Pentobarbital Na (30-50 mg / kg IP) verfolgt werden. Diese Methode wird von t zugelassenEr American Veterinary Medical Association. </li><li> Ernte der Lunge und spülen Sie zweimal mit 1 x PBS, um Blutzellen zu entfernen. Sammeln einseitig von den Lungen in 1 ml eiskaltem kompletten DMEM-Medium und halten auf dem Eis. Schnell frieren Sie die andere Seite der Lunge und bei -80 ° C für die Prüfung virale DNA Lasten in die Lunge, die durch qPCR (siehe unten). </li><li> Verwenden Sie ein Gewebe-Homogenisator zu Lungengewebe bei maximaler Geschwindigkeit homogenisieren für 1 sec, Frost-und Tauwetter-dreimal. Waschen Sie den Homogenisator mit 70% Ethanol bei jedem Schritt beim Wechsel der Probe. </li><li> Centrifuge das homogenisierte Gewebe bei 3.000 rpm für 10 min bei 4 ° C. Sammeln Sie den Überstand und Übertragung auf neue Röhren für Plaque-Assay. </li><li> Bereiten Sie serielle Verdünnungen (in der Regel von 10 ° bis 10 -8) der Lunge Homogenat Proben in 1,5 ml Mikro-Zentrifugenröhrchen mit klarem DMEM durch Wirbel. Prefill die entsprechende Anzahl von Rohren mit 540 ul DMEM und verdünne 60 ul Homogenat in das erste Rohr. Transfer-60 ul vom ersten Rohr inicht die nächste, und so weiter. </li><li> Saugen Sie Medien aus dem vorbereiteten Vero Monoschichten in der 12-Well-Platten und laden 200 ul / well seriell verdünnt Homogenat mit infektiösen Viren in umgekehrter Reihenfolge (von 10 -8 bis 10 °). Verwenden Sie zwei Vertiefungen für jede Titration (in zweifacher Ausfertigung). </li><li> Inkubieren Vero-Zellen mit dem Virus Impfkulturen 1 Stunde bei 37 ° C. Vorsichtig schwenken die Platten alle 15 Minuten gleichmäßig zu verteilen, um das Virus über die Monoschicht. </li><li> Entfernen Sie die Impfkulturen und ersetzen Sie es mit 2 ml / well der Overlay-Medium (Tabelle 1). Die Platten für eine Woche bei 37 ° C. </li><li> Entfernen Sie Overlay-Medium (muss nicht vollständig sein), und ersetzen mit dem Update / Fleck Medium der Plaque-Assay (Tabelle 1) und Inkubation für mindestens 1 h bei RT. </li><li> Wenn die Platten werden getrocknet, zählen die Anzahl der gut isolierte Plaques bei jeder Verdünnung. Zur Minimierung der Fehler, werden nur die Brunnen, die zwischen 10 und 100 Plaques gezählt. </li><li> Berechnen Sie die Virustiter mit folFlügel Formel: Titer (pfu / ml) = [(Anzahl der Plaques / well) / (Volumen von Impfkulturen / well)] x Verdünnungsfaktor. </li></ol> 4. Infektiöse Zentrum Assay auf die Viruslast in latent infizierten Milzzellen Bestimmen <ol><li> Viral latente Belastung durch infektiöse Center (IC)-Assay auf dem Monolayer von Vero-Zellen bestimmt. Am Tag vor IC-Assay, Saatgut Vero-Zellen in 6-Well-Platten (1 -. 2,5 x 10 5 Zellen / well Wir verwenden normalerweise 11 Brunnen pro Milz Probe, 10 Brunnen werden für die seriell verdünnt Splenozyten Suspension eingesetzt werden und eine gut zum Testen spontanen Reaktivierung des Virus nach Frost-Tau-Zyklen. </li><li> Sacrifice den infizierten Mäusen nach Latenz etabliert ist (12 bis 14 Tage nach der Infektion). Ernten Sie die Maus-Milz-und Pool sie in 1 ml DMEM gekühlt. </li><li> Mechanische Dissoziation von Maus-Milz. Übertragen Sie die frisch isolierten Maus Milz in eine 10 cm Platte und mit 10 ml der gewünschten Medium wie DMEM mit 2% FBS. Wet Zwei matt-End-Glas MikroskopOPE Dias mit eiskaltem Medium. Legen Sie die Milz auf der mattierten Seite einer Rutsche und nick die Kapsel mit dem Rand der mattierten Ende des anderen gleiten. Mechanisch distanzieren der Milz zwischen zwei Folien, bis alle roten Klumpen zerkleinert werden (auch entfernen, Fett-Teilchen falls vorhanden). </li><li> Spülen Sie Folien mit DMEM, um die verbleibenden Zellen auf beiden Folien zu erholen. </li><li> Übertragen Sie die gesamte Gewebesuspension sanft durch eine Zelle Sieb (40 um Nylon-Mesh) in einen 50 ml konischen Röhrchen mit Schraubverschluss. Waschen Sie die 10 cm Schüssel mit dem Milz-Homogenate mit 10 ml PBS und Transfer während Filterung. </li><li> Zentrifugieren Sie die einzelnen Zellsuspensionen 10 min bei 375 xg und Überstand verwerfen. Flick die Zellpellets zu brechen bestehende Zellklumpen. 5 ml ACK-Puffer (Tabelle 1), um die roten Blutzellen zu lysieren. Inkubieren 5 min und Zentrifuge wieder bei 375 x g. </li><li> Überstand verwerfen und wieder aussetzen Pellets, gründlich und schonend, in PBS mit 2% FBS. Keep Zellen bei 4 ° C. Mit einer PipetteSchmutz entfernen, falls vorhanden. Graf lebensfähigen Zellen mit Hilfe eines automatischen Zell-Zähler (Bio-Rad). </li><li> Spin auf der PBS-resuspendiert Splenozyten bei 375 xg für 4 min. Überstand verwerfen und die Zellen in 4 ml komplettem DMEM (2 x 1 ml wird für die IC-Assay der ursprünglichen Suspension eingesetzt werden, 0,6 ml für serielle fünffache Verdünnung in IC-Assay verwendet, 0,4 ml für die virale DNA-Präparation und qPCR, und 1 ml Suspension wird zur spontanen Reaktivierung des latenten Virus nach drei Gefrier-Auftau-Zyklen zu bewerten) </li><li> Bereiten Sie serielle fünffache Verdünnung (dh 1 / 5, 1 / 25, 1 / 125, 1 / 250) von Splenozyten Suspension in Duplikaten. Prefill die 15 ml konischen Röhrchen mit 2,4 ml DMEM und verdünne 600 ul Splenozyten Suspension in das erste Rohr und gut mischen. Transfer-600 ul der letzten Röhre in die nächste Röhre, etc. Nicht Wirbel! </li><li> Saugen Sie das Medium aus den vorbereiteten 6-well Monolayer von Vero-Zellen. Seed 1 ml der seriell verdünnten Splenozyten auf Vero-Zellen mit jeder Verdünnung duplicated (10 Bohrungen werden für 0, 1 / 5, 1 / 25, 1 / 125, 1 / 250 Verdünnung verwendet werden). </li><li> Die Platten 8-12 Uhr bei 37 ° C und 5% CO 2. Nicht mehr als 24 Stunden. Saugen Sie die gesetzten Splenozyten Federung und Last 4 ml Overlay-Medium (Tabelle 1) in jede Vertiefung. Inkubieren für weitere 6 Tage. </li><li> Bestimmen Sie die Höhe der Milz infektiösen Zentren durch die Färbung der Platten mit 0,2% (w / v) Kristallviolett als in Plaque-Assay gezeigt. </li></ol> 5. Die Quantifizierung des viralen Genoms <ol><li> Auszug gesamten genomischen DNA aus dem γHV68-infizierten Geweben, wie Lunge und Milz Proben in diesem Experiment. Verwenden Sie die DNeasy Blood &amp; Tissue Kit (Qiagen) nach dem Protokoll des Herstellers. </li><li> Bestimmen Sie die DNA-Konzentration jeder Probe die gleiche Menge an DNA, die für die qPCR-Assay verwendet sicherzustellen. Entwerfen Sie das virus-spezifischen Primer (~ 200 bp Amplikon ist für eine qPCR-Assay bevorzugt). Wir nutzten die γHV68 ORF56-spezifische Primer (forward-Primer: 5 &amp; prime; - GTAACTCGAGACTGAAACCTCGCAGAGGTCC - 3 &#39;; Reverse-Primer: 5&#39;-CCGAAGCTTGCACGGTGCAATGTGTCACAG-3&#39;) für diesen Assay und β-Aktin-Primer (forward-Primer: 5&#39;-cacccacactgtggcccatcat-3 &#39;Reverse-Primer: 5&#39;-gtgaggatcttcatgaggtagtc-3&#39;) als eine Steuerung für die qPCR-Reaktion. </li><li> Mischen Sie die DNA-Probe (100 bis 500 ng ist gut) und geeigneten Primer mit 2 x SYBR Master Mix (Bio-Rad iQ SYBR Green Supermix). Verwenden Sie die Bio-Rad Real-Time PCR-System, um die Viruslast in den infizierten Geweben zu quantifizieren. Führen Sie die PCR unter folgender Bedingung: 95 ° C für 15 min und 45 Zyklen bei 95 ° C für 30 min, 60 ° C für 30 min und 72 ° C für 30 min, von Schmelzkurve analysiert gefolgt, sowohl für die virale und Aktin-Amplikons. </li><li> Um eine Standardkurve für die Quantifizierung der viralen Genomen zu machen, seriell verdünnt bekannten Mengen eines γHV68 Bacmid DNA mit der genomischen DNA aus nicht infizierten Zellen isoliert. Run qPCR parallel mit der DNAs Von der InfektionTed Gewebe mit dem gleichen Satz von Virus-spezifischen Primer. </li><li> Gegenwart des viralen Genoms Belastung in den Geweben, wie virale DNA Kopienzahl pro Einheit (zB 100 ng oder 500 ng) genomischer DNA nach Aktin-Normalisierung. </li></ol> 6. Repräsentative Ergebnisse: Abbildung 1 zeigt die allgemeine Systematik der Experimente zur Messung der γHV68 Infektion in Mäusen in vivo. Repräsentative Ergebnisse der Virustiter in der Lunge während der akuten Infektion der γHV68, wie durch Plaque-Assay bestimmt wurden in Abbildung 2a dargestellt. Eine Mutante von γHV68 mit nicht-funktionale virale Bcl-2 (vBcl-2) auf einem Niveau vergleichbar mit Wildtyp-γHV68 in der Lunge nach 7 Tagen intranasale Infektion von BALB / c-Mäuse (6 bis 7 Mäuse pro Gruppe) repliziert. Keine statistisch signifikanten Unterschiede in der Lunge Titer des Virus wurden zwischen beiden Gruppen festgestellt. Diese Daten zeigen, dass vBcl-2 ist kein entscheidender Faktor für die akute Infektion γHV68 inMäusen. Doch durch 28 Tage nach Infektion, sank der Titer vBcl-2-Mutante Virus in der Milz 6 - bis 10 - fache im Vergleich zu den WT, als durch infektiöse Zentrum Assay (Abbildung 2B) gemessen, was darauf hindeutet, dass die vBcl-2-Mutante γHV68 Virus ist bei der Aufrechterhaltung der Milz Latenzzeit nach der Infektion defekt. In Absprache mit den reduzierten infektiösen Zentrum Titer wurde das virale Genom Belastung der vBcl-2-Mutante Virus schwer im Vergleich zu der WT-Viren am Tag 28 in wiederholten Experimenten, wie in Abbildung 2C dargestellt reduziert. Der enge Zusammenhang zwischen viralen Genoms Lasten und der Häufigkeit der latent-HV68vBcl-2-Mutante Virusreaktivierung ex vivo bei latenten Stadium der Infektion Highlights einer Latenzzeit Defekt dieser Mutante Virus-Infektion. <img alt="Abbildung 1" src="/files/ftp_upload/3472/3472fig1.jpg" /> Abbildung 1. Schematische Darstellung zur Messung von γHV68 Infektion in Mäusen durch die Bildung von Plaque, Infektions-Center und qPCR-Assays. <img alt="Abbildung 2" src="/files/ftp_upload/3472/3472fig2.jpg" /> Abbildung 2. Lytic und latente Infektion der WT-und Mutanten-γHV68 Viren in vivo. Akute Replikation (A) des WT-und Mutanten-vBcl-2 γHV68 Viren in den Lungen der BALB / c-Mäusen bei 7 dpi (Tag nach der Infektion) wurde durch Plaque-Assay bestimmt. (B und C) Milz infektiösen Zentren (B) und viralen Genoms Last (C) in der Milz infizierter Mäuse wurden bei 28 dpi durch infektiöse Zentrum Assay und qPCR gemessen. Rote Linien, die Mittelwerte der angegebenen Werte. ns, nicht signifikant.

<ol>
	<li>Damania, B., Choi, J. K., Jung, J. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Signaling+activities+of+gammaherpesvirus+membrane+proteins.">Signaling activities of gammaherpesvirus membrane proteins.</a> J. Virol. 74, 1593-1601 (2000).</li><li>Stevenson, P. G., Efstathiou, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+mechanisms+in+murine+gammaherpesvirus-68+infection.">Immune mechanisms in murine gammaherpesvirus-68 infection.</a> Viral. Immunol. 18, 445-456 (2005).</li><li>Flano, E., Husain, S. M., Sample, J. T., Woodland, D. L., Blackman, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Latent+murine+gamma-herpesvirus+infection+is+established+in+activated+B+cells,+dendritic+cells,+and+macrophages.">Latent murine gamma-herpesvirus infection is established in activated B cells, dendritic cells, and macrophages.</a> J. Immunol. 165, 1074-1081 (2000).</li><li>Sunil-Chandra, N. P., Efstathiou, S., Nash, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+establishes+a+latent+infection+in+mouse+B+lymphocytes+in+vivo.">Murine gammaherpesvirus 68 establishes a latent infection in mouse B lymphocytes in vivo.</a> J. Gen. Virol. 73, 3275-3279 (1992).</li><li>Simas, J. P., Swann, D., Bowden, R., Efstathiou, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+murine+gammaherpesvirus-68+transcription+during+lytic+and+latent+infection.">Analysis of murine gammaherpesvirus-68 transcription during lytic and latent infection.</a> J. Gen. Virol. 80, 75-82 (1999).</li><li>Ganem, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KSHV+and+the+pathogenesis+of+Kaposi+sarcoma:+listening+to+human+biology+and+medicine.">KSHV and the pathogenesis of Kaposi sarcoma: listening to human biology and medicine.</a> J. Clin. Invest. 120, 939-949 (2010).</li><li>Wen, K. W., Damania, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kaposi+sarcoma-associated+herpesvirus+(KSHV):+molecular+biology+and+oncogenesis.">Kaposi sarcoma-associated herpesvirus (KSHV): molecular biology and oncogenesis.</a> Cancer. Lett. 289, 140-150 (2009).</li><li>E, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Bcl-2-mediated+evasion+of+autophagy+aids+chronic+infection+of+gammaherpesvirus+68.">Viral Bcl-2-mediated evasion of autophagy aids chronic infection of gammaherpesvirus 68.</a> PLoS. Pathog. 5, e1000609-e1000609 (2009).</li><li>Marques, S., Efstathiou, S., Smith, K. G., Haury, M., Simas, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+gene+expression+of+latent+murine+gammaherpesvirus+68+in+B+lymphocytes.">Selective gene expression of latent murine gammaherpesvirus 68 in B lymphocytes.</a> J. Virol. 77, 7308-7318 (2003).</li><li>McCausland, M. M., Crotty, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+PCR+technique+for+detecting+lymphocytic+choriomeningitis+virus+in+vivo.">Quantitative PCR technique for detecting lymphocytic choriomeningitis virus in vivo.</a> J. Virol. Methods. 147, 167-176 (2008).</li><li>Weck, K. E., Kim, S. S., Virgin, H. I., Speck, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cells+regulate+murine+gammaherpesvirus+68+latency.">B cells regulate murine gammaherpesvirus 68 latency.</a> J. Virol. 73, 4651-4661 (1999).</li><li>Weck, K. E., Kim, S. S., Virgin, H. I., Speck, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Macrophages+are+the+major+reservoir+of+latent+murine+gammaherpesvirus+68+in+peritoneal+cells.">Macrophages are the major reservoir of latent murine gammaherpesvirus 68 in peritoneal cells.</a> J. Virol. 73, 3273-3283 (1999).</li></ol>

Keine Interessenskonflikte erklärt.

γHV68 wurde weithin als Modell benutzt, um die Pathogenese der menschlichen γ-HVs 2,4,5 verstehen. In diesem Protokoll beschrieben wir drei routinemäßig eingesetzten Methoden, einschließlich Plaque-Assay für infektiöse Virustiter, IC-Assay für die virale latente Belastung und qPCR für virale Genom zu laden, um die akute und latente Infektion der γHV68 nach intranasaler Impfung bei Mäusen zu bewerten. Die Plaque-Assay wurde intensiv an der Virustiter in den infizierten Z...

<table border="1"><tbody><tr><td> Material Name </td><td> Herstellvorschrift </td></tr><tr><td> Methylcellulose (MC)-Overlay-Medium für die virale Plaque-Assay </td><td><ol><li> Hitze ~ 250 ml destilliertem Wasser in TC-Flasche auf&gt; 80 ° C (Kochen für 3 min in der Mikrowelle) </li><li> Add allmählich 2,5 g MC-Pulver in das heiße Wasser, unter Rühren bei schwacher Hitze, bis sie gelöst. </li><li> Autoclave sofort für 15 min bei flüssigen Zyklus. </li><li> Das Rühren der autoklaviert MC Media bei 4 ° C über Nacht. </li><li> Kombinieren Sie 250 ml MC Medien mit 200ml 2 x MEM (Gibco-BRL) + 50 ml FBS auf 500 ml Overlay-Medien zu geben. </li></ol></td></tr><tr><td> Fix / Fleck Medium für Plaque-Assay </td><td> 0,2% (w / v) Kristallviolett in 20% Ethanol. </td></tr><tr><td> ACK-Lysepuffer </td><td> NH 4 Cl 0,15, KHCO 3 10 mM, EDTA 0,1 mM </td></tr><tr><td> Komplette DMEM </td><td> Dulbecco modifiziertem Eagle-Medium, 2 mM L-Glutamin und 1% Penicillin-Streptomycin (Gibco-BRL); (DMEM) mit 10% fötalem Rinderserum (FBS Invitrogen) ergänzt. </td></tr></tbody></table> Tabelle 1. Specific Media in diesem Protokoll <table border="1"><tbody><tr><td> Name des Reagenzes </td><td> Firma </td><td> Katalog-Nummer </td></tr><tr><td> Ketamin </td><td> Sigma-Aldrich </td><td> K2753 </td></tr><tr><td> Xylazin </td><td> Sigma-Aldrich </td><td> X1251 </td></tr><tr><td> Methylcellulose </td><td> Sigma-Aldrich </td><td> M0512-250g </td></tr><tr><td> 2 x MEM </td><td> Life Technologies </td><td> 11935 </td></tr><tr><td> Zellsieb </td><td> BD Faclon </td><td> 352340 </td></tr><tr><td> Omni Gewebe-Homogenisator </td><td> Omni International </td><td> TH115 </td></tr><tr><td> DNeasy Blood &amp; Tissue Kit </td><td> Qiagen </td><td> 69504 </td></tr><tr><td> IQTM SYBRH Green Supermix </td><td> BioRad </td><td> 170-8882 </td></tr><tr><td> CFX96 real-time PCR-System </td><td> Bio-Rad </td><td> 184-5072 </td></tr><tr><td> Zellzähler </td><td> Bio-Rad </td><td> 145-0001 </td></tr><tr><td> Sorvall SA-600 </td><td> Thermo Scientific </td><td> 096-124022 </td></tr></tbody></table> Tabelle 2. Reagenzien und Geräte

measurement of &#947;hv68 infection in mice

γ-Herpesviren (γ-HVS) zeichnen sich durch ihre Fähigkeit, latente Infektionen des lymphatischen Zellen 1 zu etablieren. Die engen Wirtsspektrum der menschlichen γ-HVS, wie EBV und KSHV hat stark detaillierte pathogene Studien erschwert. Murine γ-Herpesvirus 68 (γHV68) Aktien umfangreichen genetischen und biologischen Ähnlichkeiten mit menschlichen γ-HVS und ist eine natürliche Erreger der murid Nager 2. Als solche Auswertung γHV68 Infektion von Mäusen Inzuchtstämme in verschiedenen Stadien der Virusinfektion stellt ein wichtiges Modell für das Verständnis viralen Lebenszyklus und Pathogenese während γ-HVS-Infektion. Nach intranasaler Inokulation γHV68 Infektion führt zu einer akuten Virämie in der Lunge, die später in eine latente Infektion von Splenozyten und anderen Zellen, die während der gesamten Lebensdauer des Wirtes 3,4 reaktiviert behoben werden können. In diesem Protokoll werden wir beschreiben, wie die Plaque-Assay zu beurteilen verwendens infektiösen Virustiter in der Lunge Homogenaten auf Vero-Zell-Monolayer in einem frühen Stadium (5 bis 7 Tage) von post-intranasale Infektion (dpi). Während einer akuten Infektion ist weitgehend geklärt 2 - 3 Wochen nach der Infektion, eine latente Infektion der γHV68 ist rund 14 dpi erstellt und fortgeschrieben später in der Milz der Mäuse. Latente Infektion in der Regel wirkt sich auf eine sehr kleine Population von Zellen in den infizierten Geweben, wobei das Virus bleibt ruhend und schaltet den größten Teil seiner Genexpression. Latent infizierte Splenozyten spontan reaktivieren Virus auf Explantation in Gewebekulturen, die durch einen infektiösen Center (IC)-Assay rekapituliert werden kann, um das virale latente Belastung zu bestimmen. Zur weiteren Abschätzung der Menge des viralen Genoms Kopien in der akut-und / oder latent infizierten Geweben, quantitative real-time PCR (qPCR) ist bekannt für seine maximale Empfindlichkeit und Genauigkeit verwendet. Die kombinierte Analyse der Ergebnisse der qPCR und Plaque-Assay, und / oder IC-Assay wird zeigen, der raum-zeitlichen Profile der viralenReplikation und Infektiosität in vivo.

Watch this Scientific Journal Video about Measurement of Î³HV68 Infection in Mice at JoVE.com

Measurement of &amp;#947;HV68 Infection in Mice

γ-Herpesviren (γ-HVS) zu etablieren lebenslange Persistenz in ihrem Gastland. Die Infektion von Mäusen mit γ-HV68 bietet einen genetisch manipulierbaren<em&gt; In vivo</em&gt; Modell für die Charakterisierung des Lebenszyklus / Pathogenese der γHVs. Dieses Protokoll beschreibt den Nachweis und die Quantifizierung von γHV68 Infektion bei akuten und latenten Stadium nach der Infektion durch Plaque-bildenden, Infektions-Center und qPCR-Assays.

Die Messung der γHV68 Infektion bei Mäusen

&gamma;-Herpesviruses (&gamma;-HVs) are notable for their ability to establish latent infections of lymphoid cells1. The narrow host range of human ...

Research

JoVE Journal

Immunology and Infection

Measurement of &#947;HV68 Infection in Mice

13.5K Aufrufe.  University of Southern California, Los Angeles. γ-Herpesviren (γ-HVS) zu etablieren lebenslange Persistenz in ihrem Gastland. Die Infektion von Mäusen mit γ-HV68 bietet einen genetisch manipulierbaren In vivo Modell für die Charakterisierung des Lebenszyklus / Pathogenese der γHVs. Dieses Protokoll beschreibt den Nachweis und die Quantifizierung von γHV68 Infektion bei akuten und latenten Stadium nach der Infektion durch Plaque-bildenden, Infektions-Center und qPCR-Assays.

Serie: Measurement of &#947;HV68 Infection in Mice

A Method for Labeling Vasculature in Embryonic Mice

The establishment of a functional blood vessel network is an essential part of organogenesis, and is required for optimal organ function. For example, in the thymus proper vasculature formation and patterning is essential for thymocyte entry into the organ and mature T-cell exit to the periphery. The spatial arrangement of blood vessels in the thymus is dependent upon signals from the local microenvironment, namely thymic epithelial cells (TEC). Several recent reports suggest that disruption of these signals results in thymus blood vessel defects 1,2. Previous studies have described techniques used to label the neonatal and adult thymus vasculature 1,2. We demonstrate here a technique for labeling blood vessels in the embryonic thymus. This method combines the use of FITC-dextran or Griffonia (Bandeiraea) Simplicifolia Lectin I (GSL 1 - isolectin B4) facial vein injections and CD31 antibody staining to identify thymus vascular structures and PDGFR-&beta; to label thymic perivascular mesenchyme 3-5. The option of using cryosections or vibratome sections is also provided. This protocol can be used to identify thymus vascular defects, which is critical for defining the roles of TEC-derived molecules in thymus blood vessel formation. As the method labels the entire vasculature, it can also be used to analyze the vascular networks in multiple organs and tissues throughout the embryo including skin and heart 6-10.

This article describes a method for labeling embryonic skin and thymus blood vessels.

Ein Verfahren zur Markierung Gefäßsystem in embryonalen Mäuse

The establishment of a functional blood vessel network is an essential part of organogenesis, and is required for optimal organ function. For example, in ...

Forschung

Immunologie und Infektion

Measurement of Cytosolic Ca2+ in Isolated Contractile Lymphatics

Lymphatic vessels comprise a multifunctional transport system that maintains fluid homeostasis, delivers lipids to the central circulation, and acts as a surveillance system for potentially harmful antigens, optimizing mucosal immunity and adaptive immune responses1. Lymph is formed from interstitial fluid that enters blind-ended initial lymphatics, and then is transported against a pressure gradient in larger collecting lymphatics. Each collecting lymphatic is made up of a series of segments called lymphangions, separated by bicuspid valves that prevent backflow. Each lymphangion possesses a contractile cycle that propels lymph against a pressure gradient toward the central circulation2. This phasic contractile pattern is analogous to the cardiac cycle, with systolic and diastolic phases, and with a lower contraction frequency4. In addition, lymphatic smooth muscle generates tone and displays myogenic constriction and dilation in response to increases and decreases in luminal pressure, respectively5. A hybrid of molecular mechanisms that support both the phasic and tonic contractility of lymphatics are thus proposed.
Contraction of smooth muscle is generally regulated by the cytosolic Ca2+ concentration ([Ca2+]i) plus sensitivity to Ca2+, of the contractile elements in response to changes in the environment surrounding the cell6. [Ca2+]i is determined by the combination of the movement of Ca2+ through plasma membrane ligand or voltage gated Ca2+ channels and the release and uptake of Ca2+ from internal stores. Cytosolic Ca2+ binds to calmodulin and activates enzymes such as myosin light chain (MLC) kinase (MLCK), which in turn phosphorylates MLC leading to actin-myosin-mediated contraction8. However, the sensitivity of this pathway to Ca2+ can be regulated by the MLC phosphatase (MLCP)9. MLCP activity is regulated by Rho kinase (ROCK) and the myosin phosphatase inhibitor protein CPI-17.
Here, we present a method to evaluate changes in [Ca2+]i over time in isolated, perfused lymphatics in order to study Ca2+-dependent and Ca2+-sensitizing mechanisms of lymphatic smooth muscle contraction. Using isolated rat mesenteric collecting lymphatics we studied stretch-induced changes in [Ca2+]i and contractile activity. The isolated lymphatic model offers the advantage that pressure, flow, and the chemical composition of the bath solution can be tightly controlled. [Ca2+]i was determined by loading lymphatics with the ratiometric, Ca2+-binding dye Fura-2. These studies will provide a new approach to the broader problem of studying the different molecular mechanisms that regulate phasic contractions versus tonic constriction in lymphatic smooth muscle.

Measurement of Cytosolic Ca2+ in Isolated Contractile Lymphatics

We introduce an approach to evaluate the cytosolic Ca2+ concentration in isolated lymphatics to study Ca2+-dependent and Ca2+-sensitizing mechanisms of lymphatic smooth muscle contraction.

Die Messung der cytosolischen Ca 2 + In Isolated Kontraktile Lymphgefäße

Lymphatic vessels comprise a multifunctional transport system that maintains fluid homeostasis, delivers lipids to the central circulation, and acts as a ...

4D Multimodality Imaging of Citrobacter rodentium Infections in Mice

This protocol outlines the steps required to longitudinally monitor a bioluminescent bacterial infection using composite 3D diffuse light imaging tomography with integrated &mu;CT (DLIT-&mu;CT) and the subsequent use of this data to generate a four dimensional (4D) movie of the infection cycle. To develop the 4D infection movies and to validate the DLIT-&mu;CT imaging for bacterial infection studies using an IVIS Spectrum CT, we used infection with bioluminescent C. rodentium, which causes self-limiting colitis in mice. In this protocol, we outline the infection of mice with bioluminescent C. rodentium and non-invasive monitoring of colonization by daily DLIT-&mu;CT imaging and bacterial enumeration from feces for 8 days.
The use of the IVIS Spectrum CT facilitates seamless co-registration of optical and &mu;CT scans using a single imaging platform. The low dose &mu;CT modality enables the imaging of mice at multiple time points during infection, providing detailed anatomical localization of bioluminescent bacterial foci in 3D without causing artifacts from the cumulative radiation. Importantly, the 4D movies of infected mice provide a powerful analytical tool to monitor bacterial colonization dynamics in vivo.

4D Multimodality Imaging of Citrobacter rodentium Infections in Mice

Multi-modality imaging is a valuable approach for studying bacterial colonization in small animal models. This protocol outlines infection of mice with bioluminescent Citrobacter rodentium and the longitudinal monitoring of bacterial colonization using composite 3D diffuse light imaging tomography with &mu;CT imaging to create a 4D movie of C. rodentium infection.

4D Imaging von Multimodalität<em&gt; Citrobacter rodentium</em&gt; Infektionen bei Mäusen

This protocol outlines the steps required to  longitudinally monitor a bioluminescent bacterial infection using composite 3D diffuse light imaging ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

Langzeitchronik<em&gt; Pseudomonas aeruginosa</em&gt; Airway-Infektion bei Mäusen

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

A Method for the Measurement of Salivary Gland Function in Mice

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced saliva production. Similarly, saliva production is severely compromised in patients receiving radiation treatment for head and neck cancers. Rodent models, developed to mimic these clinical conditions, facilitate an understanding of the disease pathogenesis and allow for the development of new therapeutic strategies. Therefore, the ability to accurately, reproducibly, and repeatedly measure salivary gland function in animal models is critical. Building on procedures previously described in the literature, a method was developed that meets these criteria and was used to evaluate salivary gland function in mice. An additional advantage of this new method is that it is easily mastered, and has little inter-operator variation. Salivary gland function is evaluated as the amount (weight or volume) or rate (mL/min) of saliva produced in response to pilocarpine stimulation. The collected saliva is a good source for the analyses of protein content, immunoglobulin concentrations, and other biomolecules.

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

Eine Methode zur Messung der Speicheldrüse Funktion bei Mäusen

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced ...

High-throughput Measurement of Plasma Membrane Resealing Efficiency in Mammalian Cells

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In response to these damages, complex molecular machineries rapidly reseal the plasma membrane to restore its barrier function and maintain cell survival. Despite 60 years of research in this field, we still lack a thorough understanding of the cell resealing machinery. With the goal of identifying cellular components that control plasma membrane resealing or drugs that can improve resealing, we have developed a fluorescence-based high-throughput assay that measures the plasma membrane resealing efficiency in mammalian cells cultured in microplates. As a model system for plasma membrane damage, cells are exposed to the bacterial pore-forming toxin listeriolysin O (LLO), which forms large 30-50 nm diameter proteinaceous pores in cholesterol-containing membranes. The use of a temperature-controlled multi-mode microplate reader allows for rapid and sensitive spectrofluorometric measurements in combination with brightfield and fluorescence microscopy imaging of living cells. Kinetic analysis of the fluorescence intensity emitted by a membrane impermeant nucleic acid-binding fluorochrome reflects the extent of membrane wounding and resealing at the cell population level, allowing for the calculation of the cell resealing efficiency. Fluorescence microscopy imaging allows for the enumeration of cells, which constitutively express a fluorescent chimera of the nuclear protein histone 2B, in each well of the microplate to account for potential variations in their number and allows for eventual identification of distinct cell populations. This high-throughput assay is a powerful tool expected to expand our understanding of membrane repair mechanisms via screening for host genes or exogenously added compounds that control plasma membrane resealing.

Here we describe a high-throughput fluorescence-based assay that measures the plasma membrane resealing efficiency through fluorometric and imaging analyses in living cells. This assay can be used for screening drugs or target genes that regulate plasma membrane resealing in mammalian cells.

Hochdurchsatz-Messung der Plasmamembran Wiederverschließen Effizienz in Säugerzellen

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In ...

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a striking increase in life expectancy around the globe. Nonetheless, determining vaccine efficacy remains a challenge. Emerging evidence suggests that the current acellular vaccine (aPV) for Bordetella pertussis (B. pertussis) induces suboptimal immunity. Therefore, a major challenge is designing a next-generation vaccine that induces protective immunity without the adverse side effects of a whole-cell vaccine (wPV). Here we describe a protocol that we used to test the efficacy of a promising, novel adjuvant that skews immune responses to a protective Th1/Th17 phenotype and promotes a better clearance of a B. pertussis challenge from the murine respiratory tract. This article describes the protocol for mouse immunization, bacterial inoculation, tissue harvesting, and analysis of immune responses. Using this method, within our model, we have successfully elucidated crucial mechanisms elicited by a promising, next-generation acellular pertussis vaccine. This method can be applied to any infectious disease model in order to determine vaccine efficacy.

Here we present an elegant protocol for in vivo evaluation of vaccine effectiveness and host immune responses. This protocol can be adapted for vaccine models that study viral, bacterial, or parasitic pathogens.

Bewertung der Wirt-Pathogen-Antworten und Wirksamkeit des Impfstoffes bei Mäusen

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a ...

Adoptive Immunotherapy of iNKT Cells in Glucose-6-Phosphate Isomerase (G6PI)-Induced RA Mice

Rheumatoid arthritis (RA) is a complex chronic inflammatory autoimmune disease. The pathogenesis of the disease is related to invariant natural killer T (iNKT) cells. Patients with active RA present fewer iNKT cells, defective cell function, and excessive polarization of Th1. In this study, an RA animal model was established using a mixture of hGPI325-339 and hGPI469-483 peptides. The iNKT cells were obtained by in vivo induction and in vitro purification, followed by infusion into RA mice for adoptive immunotherapy. The in vivo imaging system (IVIS) tracking revealed that iNKT cells were mainly distributed in the spleen and liver. On day 12 after cell therapy, the disease progression slowed down significantly, the clinical symptoms were alleviated, the abundance of iNKT cells in the thymus increased, the proportion of iNKT1 in the thymus decreased, and the levels of TNF-&#945;, IFN-&#947;, and IL-6 in the serum decreased. Adoptive immunotherapy of iNKT cells restored the balance of immune cells and corrected the excessive inflammation of the body.

Adoptive Immunotherapy of iNKT Cells in Glucose-6-Phosphate Isomerase G6PI-Induced RA Mice

This protocol uses G6PI mixed peptides to construct rheumatoid arthritis models that are closer to that of human rheumatoid arthritis in CD4+ T cells and cytokines. High purity invariant natural killer T cells (mainly iNKT2) with specific phenotypes and functions were obtained by in vivo induction and in vitro purification for adoptive immunotherapy.

Adoptive Immuntherapie von iNKT-Zellen in Glucose-6-Phosphat-Isomerase (G6PI)-Induzierte RA-Mäuse

Rheumatoid arthritis (RA) is a complex chronic inflammatory autoimmune disease. The pathogenesis of the disease is related to invariant natural killer T ...

Measurement of Chitinase Activity in Biological Samples

Chitinases are the enzymes that cleave chitin. Even in the absence of chitin, mammalians have significant amounts of chitinases present in the body including at baseline. The precise role of chitinase is not known, however it was believed to play important role in digestion and host defense against chitin-containing food and pathogens, respectively. Recent work, including ours, has shown an important role of chitinase and chitinase-like proteins in host immunity and allergic diseases. Importantly, chitinase activities serve as important biomarkers of disease severity in a wide-range of diseases including type 2 inflammatory diseases such as asthma and pulmonary fibrosis. Similarly, patients with genetic disorders like Gaucher disease have significantly elevated chitinase levels, which not only correlate with disease severity but also serve as a reliable biomarker for therapeutic effectiveness. The protocol outlined here describes a simple, quick, and straightforward way to measure chitinase activity in BAL or serum samples of mice and can be widely adapted to human subjects and other model organisms due to the highly conserved nature of the enzymes.

Presented here is a simple method to measure chitinase activity in biological fluids such as bronchoalveolar lavage or serum.

Messung der Chitinase-Aktivität in biologischen Proben

Chitinases are the enzymes that cleave chitin. Even in the absence of chitin, mammalians have significant amounts of chitinases present in the body ...

Evaluation of T Follicular Helper Cells and Germinal Center Response During Influenza A Virus Infection in Mice

T Follicular Helper (Tfh) cells are an independent CD4+&#160;T cell subset specialized in providing help for germinal center (GC) development and generation of high-affinity antibodies. In influenza virus infection, robust Tfh and GC B cell responses are induced to facilitate effective virus eradication, which confers a qualified mouse model for Tfh-associated study. In this paper, we described protocols in detection of basic Tfh-associated immune response during influenza virus infection in mice. These protocols include: intranasal inoculation of influenza virus; flow cytometry staining and analysis of polyclonal and antigen-specific Tfh cells, GC B cells and plasma cells; immunofluorescence detection of GCs; enzyme-linked immunosorbent assay (ELISA) of influenza virus-specific antibody in serum. These assays basically quantify the differentiation and function of Tfh cells in influenza virus infection, thus providing help for studies in elucidating differentiation mechanism and manipulation strategy.

This paper describes protocols of evaluating Tfh and GC B response in mouse model of influenza virus infection.