The authors would like to acknowledge the technical advice and support from Ren Sun (University of California, Los Angeles) and Seungmin Hwang (Washington University). This work was funded by the Baxter Foundation, National Institutes of Health grants (R01 CA140964 and R21 AI083841 to C. Liang).

The following protocol will describe the study of virus titers and viral genome loads in the lytic and latent infection cycle of &gamma;HV68 in mice, which can theoretically be used to evaluate infection by other viruses sharing similar lifestyle to that of &gamma;HV68.
1. Amplification of &gamma;HV68
<ol>
	<li>Thaw a frozen vial of &gamma;HV68 in 37 &deg;C water bath.</li>
	<li>Add viral inoculums to NIH3T12 or 3T3 cell culture (~50% confluency) in 10 cm dishes and culture the infected cells at 37 &deg;C in 5% CO2.</li>
	<li>Examine the culture by microscopy for cytopathic effect (CPE) and collect the media at a time when greater than 80% of cells show CPE 4 ~5 days after infection. To maximize the yield of virus, the infected cell culture can be frozen-and-thawed twice to release all cell-associated &gamma;HV68.</li>
	<li>Centrifuge the collected media at 1000 rpm for 5 min at room temperature (RT) to remove cell debris.</li>
	<li>Carefully transfer the supernatants to new tubes (high-speed centrifuge tube) without touching the cell debris at the bottom.</li>
	<li>High-speed centrifuge at 12,000 rpm (for Sorvall SA-600) at 4 &deg;C for at least 1.5 hrs to concentrate viral particles.</li>
	<li>Discard the supernatants into 10&gamma; bleach solution and carefully re-suspend the pellet (virus and residual cell debris) with 1ml serum-free DMEM. Transfer the re-suspended pellet into a 1.5 ml micro-centrifuge tube and mix well by vortexing.</li>
	<li>Centrifuge for 2 min at maximum speed to remove residual cell debris and transfer the supernatant (virus stock) to a new tube. This is the final viral stock for infection. The titer of the virus stock is determined by plaque assay (see below).</li>
</ol>
2. Intranasal Infection of Mice with &gamma;HV68
<ol>
	<li>Infect mice at ~6 weeks of age with 1,000 ~5,000 plaque-forming units (PFU) of &gamma;HV68 per mice.</li>
	<li>Anesthetize mice by injection of ketamine/xylazine (60 &mu;l/mouse of a mixture of 80 mg/ml ketamine and 12 mg/ml xylazine) into peritoneal cavity. Monitor anesthesia by pinching the mice toe. It usually takes ~5-10 min. If mice are not fully anesthetized, they will sneeze the virus.</li>
	<li>When the mouse is fully anesthetized, use a pipette to inoculate ~30 &mu;l of PBS containing &gamma;HV68 (15 &mu;l at each nostril) to mice drop-by-drop slowly but steadily. Be sure the mouse is indeed inhaling the drops without trying to form bubbles.</li>
	<li>Allow the mouse to recover for 10-15 min and monitor the welfare of the mice (e.g. consciousness, breathing, etc) before returning them to the cage. Animals are checked daily for illness and adequacy of food, water, and bedding conditions. If clinical signs of illness, pain or distress develop, routine diagnostics to determine the etiology will be conducted. Animals that lose more than 20% of their body weight will be recorded for maximum weight loss and euthanized. The final decision to perform euthanasia is at the discretion of the clinical veterinarian and is made following consultation with the principal investigator.</li>
</ol>
3. Plaque Assay to Determine the Virus Titer in Acutely Infected Lungs
<ol>
	<li>Virus infectivity titers are determined by the plaque formation on monolayers of Vero cells.</li>
	<li>Vero cells are seeded at 2.5x104 cells/well in 12 well-plates the day before plaque assay. The cells should be evenly distributed and the cell density should reach 30 - 40% on the day of plaque assay.</li>
	<li>Prepare 0.5% (w/v) methylcellulose (MC) overlay medium (Table 1).</li>
	<li>Sacrifice &gamma;HV68-infected mice 5-7 days after intranasal infection to determine acute-phase virus titers in the lungs. For euthanization Ketamine HCl (80-100 mg/kg SC, IM, IP) will be administrated IM followed by intravenous overdose of Na pentobarbital (30-50 mg/kg IP). This method is approved by the American Veterinary Medical Association.</li>
	<li>Harvest the lungs and rinse twice with 1 x PBS to remove blood cells. Collect one-side of the lungs in 1 ml ice-cold complete DMEM medium and keep on ice. Rapidly freeze the other side of the lungs and store at -80&deg;C for examining viral DNA loads in the lungs by qPCR (see below).</li>
	<li>Use a tissue homogenizer to homogenize lung tissues at maximum speed for 1 sec, freeze-and-thaw three times. Wash the homogenizer with 70% ethanol at every step when changing the sample.</li>
	<li>Centrifuge the homogenized tissue at 3,000 rpm for 10 min at 4 &deg;C. Collect the supernatant and transfer to new tubes for plaque assay.</li>
	<li>Prepare serial dilutions (usually from 10&deg; to 10-8) of lung homogenate samples in 1.5 ml micro-centrifuge tubes with plain DMEM by vortex. Prefill the appropriate number of tubes with 540 &mu;l DMEM and dilute 60 &mu;l homogenate into the first tube. Transfer 60 &mu;l from the first tube into the next one, and so on.</li>
	<li>Aspirate media from the prepared Vero monolayers in the 12-well plates and load 200 &mu;l/well serially diluted homogenate containing infectious viruses in a reverse order (from 10-8 to 10&deg;). Use two wells for each titration (in duplicate).</li>
	<li>Incubate Vero cells with the virus inoculums 1 hr at 37 &deg;C. Gently swirl the plates every 15 minutes to evenly distribute the virus over the monolayer.</li>
	<li>Remove the inoculums and replace it with 2 ml/well of the overlay medium (Table 1). Incubate the plates for one week at 37 &deg;C.</li>
	<li>Remove overlay medium (does not need to be complete) and replace with the fix/stain medium of plaque assay (Table 1) and incubate for at least 1 hr at RT.</li>
	<li>When the plates are dried, count the number of well-isolated plaques at each dilution. To minimize error, only the wells containing between 10 and 100 plaques are counted.</li>
	<li>Calculate the virus titer using the following formula: titer (pfu/ml) = [(number of plaques/well)/(volume of inoculums/well)] x dilution factor.</li>
</ol>
4. Infectious Center Assay to Determine the Virus Load in Latently Infected Splenocytes
<ol>
	<li>Viral latent load is determined by infectious center (IC) assay on the monolayer of Vero cells. The day before IC assay, seed Vero cells in 6-well plates (1 - 2.5 X 105 cells/well. We usually use 11 wells per spleen sample, 10 wells will be used for the serially diluted splenocytes suspension and one well for testing spontaneous reactivation of the virus after freeze-thaw cycles.</li>
	<li>Sacrifice the infected mice after latency is established (12 - 14 days after infection). Harvest the mouse spleen and pool them into 1 ml chilled DMEM.</li>
	<li>Mechanical dissociation of mouse spleen. Transfer the freshly isolated mouse spleens into a 10 cm plate and add 10 ml of desired medium such as DMEM with 2% FBS. Wet two frosted-end glass microscope slides with ice-cold medium. Place the spleen on the frosted side of one slide and nick the capsule with the edge of the frosted end of the other slide. Mechanically dissociate the spleen between two slides until all red clumps are crushed (also remove fat particles if present).</li>
	<li>Rinse slides with DMEM to recover remaining cells on both slides.</li>
	<li>Transfer the entire tissue suspension gently through a cell strainer (40 &mu;m nylon mesh) into a 50 ml conical screw-cap tube. Wash the 10 cm dish containing the spleen homogenates with 10 ml PBS and transfer while filtering.</li>
	<li>Centrifuge the single cell suspensions 10 min at 375 x g and discard supernatant. Flick the cell pellets to break up existing cell clumps. Add 5 ml ACK buffer (Table 1) to lyse the red blood cells. Incubate 5 min and centrifuge again at 375 x g.</li>
	<li>Discard the supernatant and re-suspend the pellets, thoroughly, yet gently, in PBS with 2% FBS. Keep cells at 4 &deg;C. Use a pipette to remove debris, if any. Count viable cells using an automatic cell counter (Bio-Rad).</li>
	<li>Spin down the PBS-resuspended splenocytes at 375 x g for 4 min. Discard supernatant and resuspend the cells in 4 ml complete DMEM (2 x 1 ml will be used for the IC assay of the original suspension; 0.6 ml used for serial five-fold dilution in IC assay; 0.4 ml for viral DNA preparation and qPCR, and 1 ml suspension will be used to evaluate spontaneous reactivation of the latent virus after three freeze-thaw cycles)</li>
	<li>Prepare serial five-fold dilutions (i.e. 1/5, 1/25, 1/125, 1/250) of splenocytes suspension in duplicates. Prefill the 15 ml conical tubes with 2.4 ml DMEM and dilute 600 &mu;l splenocytes suspension into the first tube and mix well. Transfer 600 &mu;l from previous tube into the next tube, etc. Do not vortex!</li>
	<li>Aspirate the medium from the prepared 6-well monolayer of Vero cells. Seed 1 ml of the serially-diluted splenocytes onto Vero cells with each dilution duplicated (10 wells will be used for 0, 1/5, 1/25, 1/125, 1/250 dilutions).</li>
	<li>Incubate plates 8-12 hrs at 37 &deg;C and 5% CO2. Do not exceed 24 hrs. Aspirate the seeded splenocytes suspension and load 4 ml overlay media (Table 1) to each well. Incubate for an additional 6 days.</li>
	<li>Determine the levels of spleen infectious centers by staining the plates with 0.2% (w/v) crystal violet as shown in plaque assay.</li>
</ol>
5. Quantification of the Viral Genome
<ol>
	<li>Extract total genomic DNA from the &gamma;HV68-infected tissues, such as lung and spleen samples in this experiment. Use the DNeasy Blood &amp; Tissue Kit (Qiagen), following the manufacturer&prime;s protocol.</li>
	<li>Determine the DNA concentration of each sample to ensure the same amount of DNA being used for qPCR assay. Design the virus-specific primers (~200 bp amplicon is preferred for a qPCR assay). We used the &gamma;HV68 ORF56-specific primers (forward primer: 5&prime;- GTAACTCGAGACTGAAACCTCGCAGAGGTCC - 3&prime;; reverse primer: 5&prime;-CCGAAGCTTGCACGGTGCAATGTGTCACAG-3&prime;) for this assay and &beta;-actin primers (forward primer: 5&prime;-cacccacactgtggcccatcat-3&prime; reverse primer: 5&prime;-gtgaggatcttcatgaggtagtc-3&prime;) as a control for the qPCR reaction.</li>
	<li>Mix the DNA sample (100 - 500 ng is good) and appropriate primers with 2 x SYBR master mix (Bio-Rad iQ SYBR Green Supermix). Use the Bio-Rad Real-Time PCR System to quantify the viral load in the infected tissues. Perform PCR at the following condition: 95 &deg;C for 15 min and 45 cycles of 95&deg;C for 30 min, 60&deg;C for 30 min, and 72&deg;C for 30 min, followed by melting curve analyses, for both the viral and actin amplicons.</li>
	<li>To make a standard curve for the quantification of viral genomes, serially dilute known amounts of a &gamma;HV68 bacmid DNA with the genomic DNA isolated from uninfected cells. Run qPCR in parallel with the DNAs retrieved from the infected tissues using the same sets of virus-specific primers.</li>
	<li>Present the viral genome load in the tissues as viral DNA copy number per unit (e.g. 100 ng or 500 ng) of genomic DNA after actin normalization.</li>
</ol>
6. Representative Results:
Figure 1 depicts the overall scheme of the experiments for the measurement of &gamma;HV68 infection in mice in vivo. Representative results of virus titers in the lungs during acute infection of &gamma;HV68, as determined by plaque assay, were shown in Figure 2A. A mutant strain of &gamma;HV68 containing non-functional viral Bcl-2 (vBcl-2) replicated at levels comparable to wild-type &gamma;HV68 in the lungs after 7 days intranasal infection of BALB/c mice (6 - 7 mice per group). No statistically significant differences in the lung titers of the virus were detected between two groups. This data indicates that vBcl-2 is not a crucial factor for the acute infection of &gamma;HV68 in mice. However, by 28 days postinfection, the titer of vBcl-2 mutant virus in the spleens dropped 6- to 10- fold compared to the WT, as measured by infectious center assay (Figure 2B), suggesting that the vBcl-2 mutant &gamma;HV68 virus is defective in the maintenance of splenic latency after infection. In agreement with the reduced infectious center titers, the viral genome load of the vBcl-2 mutant virus was severely reduced compared to that of WT viruses at day 28 in repeated experiments, as shown in Figure 2C. The close correlation between viral genome loads and the frequency of latent-HV68vBcl-2 mutant virus reactivation ex vivo at latent stage of infection highlights a latency defect of this mutant virus infection.
<img alt="Figure 1" src="/files/ftp_upload/3472/3472fig1.jpg" /> 
Figure 1. Schematic diagram for the measurement of &gamma;HV68 infection in mice by means of plaque formation, infectious center, and qPCR assays.
<img alt="Figure 2" src="/files/ftp_upload/3472/3472fig2.jpg" /> 
Figure 2. Lytic and latent infection of the WT and mutant &gamma;HV68 viruses in vivo. Acute replication (A) of the WT and mutant vBcl-2 &gamma;HV68 viruses in the lungs of the BALB/c mice at 7 dpi (day post infection) was determined by plaque assay. (B and C) Splenic infectious centers (B) and viral genome load (C) in the spleens of infected mice were measured at 28 dpi by infectious center assay and qPCR, respectively. Red lines, the averages of indicated values. n.s., not significant.

<ol>
	<li>Damania, B., Choi, J. K., Jung, J. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Signaling+activities+of+gammaherpesvirus+membrane+proteins.">Signaling activities of gammaherpesvirus membrane proteins.</a> J. Virol. 74, 1593-1601 (2000).</li><li>Stevenson, P. G., Efstathiou, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+mechanisms+in+murine+gammaherpesvirus-68+infection.">Immune mechanisms in murine gammaherpesvirus-68 infection.</a> Viral. Immunol. 18, 445-456 (2005).</li><li>Flano, E., Husain, S. M., Sample, J. T., Woodland, D. L., Blackman, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Latent+murine+gamma-herpesvirus+infection+is+established+in+activated+B+cells,+dendritic+cells,+and+macrophages.">Latent murine gamma-herpesvirus infection is established in activated B cells, dendritic cells, and macrophages.</a> J. Immunol. 165, 1074-1081 (2000).</li><li>Sunil-Chandra, N. P., Efstathiou, S., Nash, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+establishes+a+latent+infection+in+mouse+B+lymphocytes+in+vivo.">Murine gammaherpesvirus 68 establishes a latent infection in mouse B lymphocytes in vivo.</a> J. Gen. Virol. 73, 3275-3279 (1992).</li><li>Simas, J. P., Swann, D., Bowden, R., Efstathiou, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+murine+gammaherpesvirus-68+transcription+during+lytic+and+latent+infection.">Analysis of murine gammaherpesvirus-68 transcription during lytic and latent infection.</a> J. Gen. Virol. 80, 75-82 (1999).</li><li>Ganem, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KSHV+and+the+pathogenesis+of+Kaposi+sarcoma:+listening+to+human+biology+and+medicine.">KSHV and the pathogenesis of Kaposi sarcoma: listening to human biology and medicine.</a> J. Clin. Invest. 120, 939-949 (2010).</li><li>Wen, K. W., Damania, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kaposi+sarcoma-associated+herpesvirus+(KSHV):+molecular+biology+and+oncogenesis.">Kaposi sarcoma-associated herpesvirus (KSHV): molecular biology and oncogenesis.</a> Cancer. Lett. 289, 140-150 (2009).</li><li>E, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Bcl-2-mediated+evasion+of+autophagy+aids+chronic+infection+of+gammaherpesvirus+68.">Viral Bcl-2-mediated evasion of autophagy aids chronic infection of gammaherpesvirus 68.</a> PLoS. Pathog. 5, e1000609-e1000609 (2009).</li><li>Marques, S., Efstathiou, S., Smith, K. G., Haury, M., Simas, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+gene+expression+of+latent+murine+gammaherpesvirus+68+in+B+lymphocytes.">Selective gene expression of latent murine gammaherpesvirus 68 in B lymphocytes.</a> J. Virol. 77, 7308-7318 (2003).</li><li>McCausland, M. M., Crotty, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+PCR+technique+for+detecting+lymphocytic+choriomeningitis+virus+in+vivo.">Quantitative PCR technique for detecting lymphocytic choriomeningitis virus in vivo.</a> J. Virol. Methods. 147, 167-176 (2008).</li><li>Weck, K. E., Kim, S. S., Virgin, H. I., Speck, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cells+regulate+murine+gammaherpesvirus+68+latency.">B cells regulate murine gammaherpesvirus 68 latency.</a> J. Virol. 73, 4651-4661 (1999).</li><li>Weck, K. E., Kim, S. S., Virgin, H. I., Speck, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Macrophages+are+the+major+reservoir+of+latent+murine+gammaherpesvirus+68+in+peritoneal+cells.">Macrophages are the major reservoir of latent murine gammaherpesvirus 68 in peritoneal cells.</a> J. Virol. 73, 3273-3283 (1999).</li></ol>

No conflicts of interest declared.

&gamma;HV68 has been widely used as a model to understand the pathogenesis of human &gamma;-HVs2,4,5. In this protocol, we described three routinely used methods, including plaque assay for infectious virus titer, IC assay for viral latent load, and qPCR for viral genome load, to evaluate the acute and latent infection of &gamma;HV68 after intranasal inoculation in mice.
The plaque assay has been used extensively to determine the virus titer in infected cells or tissues, but the op...

<table border="1">
	<tbody>
		<tr>
			<td>Material Name</td>
			<td>Preparation Procedure</td>
		</tr>
		<tr>
			<td>Methylcellulose (MC) overlay medium for viral plaque assay</td>
			<td><ol>
			<li>Heat ~ 250 ml of distilled water in TC bottle to &gt; 80&deg;C (boiling for 3 min in microwave)</li>
			<li>Add gradually 2.5 g MC powder into heated water, stirring over low heat until dissolved.</li>
			<li>Autoclave immediately for 15 min at liquid cycle.</li>
			<li>Stirring the autoclaved MC media at 4&deg;C overnight.</li>
			<li>Combine 250 ml MC media with 200ml 2 x MEM (Gibco-BRL) + 50 ml FBS to give 500 ml overlay media. </li>
			</ol></td>
		</tr>
		<tr>
			<td>Fix/stain medium for plaque assay</td>
			<td>0.2% (w/v) crystal violet in 20% ethanol.</td>
		</tr>
		<tr>
			<td>ACK Lysis Buffer</td>
			<td>NH4Cl 0.15M, KHCO3 10mM, EDTA 0.1mM</td>
		</tr>
		<tr>
			<td>Complete DMEM</td>
			<td>Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Invitrogen), 2 mM L-glutamine, and 1% penicillin-streptomycin (Gibco-BRL).</td>
		</tr>
	</tbody>
</table>
Table 1. Specific media used in this protocol
<table border="1">
	<tbody>
		<tr>
			<td>Name of the reagent</td>
			<td>Company</td>
			<td>Catalogue number</td>
		</tr>
		<tr>
			<td>Ketamine</td>
			<td>Sigma-Aldrich</td>
			<td>K2753</td>
		</tr>
		<tr>
			<td>Xylazine</td>
			<td>Sigma-Aldrich</td>
			<td>X1251</td>
		</tr>
		<tr>
			<td>Methylcellulose</td>
			<td>Sigma-Aldrich</td>
			<td>M0512-250g</td>
		</tr>
		<tr>
			<td>2 x MEM</td>
			<td>Life Technologies</td>
			<td>11935</td>
		</tr>
		<tr>
			<td>Cell strainer</td>
			<td>BD Faclon</td>
			<td>352340</td>
		</tr>
		<tr>
			<td>Omni tissue homogenizer</td>
			<td>OMNI International</td>
			<td>TH115</td>
		</tr>
		<tr>
			<td>DNeasy Blood & Tissue Kit</td>
			<td>Qiagen</td>
			<td>69504</td>
		</tr>
		<tr>
			<td>iQTM SYBRH Green Supermix</td>
			<td>BioRad</td>
			<td>170-8882</td>
		</tr>
		<tr>
			<td>CFX96 real-time PCR system</td>
			<td>Bio-Rad</td>
			<td>184-5072</td>
		</tr>
		<tr>
			<td>Cell counter</td>
			<td>Bio-Rad</td>
			<td>145-0001</td>
		</tr>
		<tr>
			<td>Sorvall SA-600</td>
			<td>Thermo Scientific</td>
			<td>096-124022</td>
		</tr>
	</tbody>
</table>
Table 2. Specific reagents and equipment

measurement of &#947;hv68 infection in mice

&gamma;-Herpesviruses (&gamma;-HVs) are notable for their ability to establish latent infections of lymphoid cells1. The narrow host range of human &gamma;-HVs, such as EBV and KSHV, has severely hindered detailed pathogenic studies. Murine &gamma;-herpesvirus 68 (&gamma;HV68) shares extensive genetic and biological similarities with human &gamma;-HVs and is a natural pathogen of murid rodents2. As such, evaluation of &gamma;HV68 infection of mice inbred strains at different stages of viral infection provides an important model for understanding viral lifecycle and pathogenesis during &gamma;-HVs infection.
Upon intranasal inoculation, &gamma;HV68 infection results in acute viremia in the lung that is later resolved into a latent infection of splenocytes and other cells, which may be reactivated throughout the life of the host3,4. In this protocol, we will describe how to use the plaque assay to assess infectious virus titer in the lung homogenates on Vero cell monolayers at the early stage (5 - 7 days) of post-intranasal infection (dpi). While acute infection is largely cleared 2 - 3 weeks postinfection, a latent infection of &gamma;HV68 is established around 14 dpi and maintained later on in the spleen of the mice. Latent infection usually affects a very small population of cells in the infected tissues, whereby the virus stays dormant and shuts off most of its gene expression. Latently-infected splenocytes spontaneously reactivate virus upon explanting into tissue culture, which can be recapitulated by an infectious center (IC) assay to determine the viral latent load. To further estimate the amount of viral genome copies in the acutely and/or latently infected tissues, quantitative real-time PCR (qPCR) is used for its maximal sensitivity and accuracy. The combined analyses of the results of qPCR and plaque assay, and/or IC assay will reveal the spatiotemporal profiles of viral replication and infectivity in vivo.

Watch this Scientific Journal Video about Measurement of ÃŽÂ³HV68 Infection in Mice at JoVE.com

Measurement of &#947;HV68 Infection in Mice

&#947;-Herpesviruses (&#947;-HVs) establish life-long persistency in their host. Infection of mice with &#947;-HV68 provides a genetically tractable in vivo model for the characterization of the lifecycle/pathogenesis of &#947;HVs. This protocol describes the detection and quantitation of &#947;HV68 infection at acute and latent stages following infection by plaque-forming, infectious center, and qPCR assays.

&gamma;-Herpesviruses (&gamma;-HVs) are notable for their ability to establish latent infections of lymphoid cells1. The narrow host range of human ...

Research

JoVE Journal

Immunology and Infection

13.5K Views.  University of Southern California, Los Angeles. γ-Herpesviruses (γ-HVs) establish life-long persistency in their host. Infection of mice with γ-HV68 provides a genetically tractable in vivo model for the characterization of the lifecycle/pathogenesis of γHVs. This protocol describes the detection and quantitation of γHV68 infection at acute and latent stages following infection by plaque-forming, infectious center, and qPCR assays.

Video: Measurement of γHV68 Infection in Mice

A Method for Labeling Vasculature in Embryonic Mice

The establishment of a functional blood vessel network is an essential part of organogenesis, and is required for optimal organ function. For example, in the thymus proper vasculature formation and patterning is essential for thymocyte entry into the organ and mature T-cell exit to the periphery. The spatial arrangement of blood vessels in the thymus is dependent upon signals from the local microenvironment, namely thymic epithelial cells (TEC). Several recent reports suggest that disruption of these signals results in thymus blood vessel defects 1,2. Previous studies have described techniques used to label the neonatal and adult thymus vasculature 1,2. We demonstrate here a technique for labeling blood vessels in the embryonic thymus. This method combines the use of FITC-dextran or Griffonia (Bandeiraea) Simplicifolia Lectin I (GSL 1 - isolectin B4) facial vein injections and CD31 antibody staining to identify thymus vascular structures and PDGFR-&beta; to label thymic perivascular mesenchyme 3-5. The option of using cryosections or vibratome sections is also provided. This protocol can be used to identify thymus vascular defects, which is critical for defining the roles of TEC-derived molecules in thymus blood vessel formation. As the method labels the entire vasculature, it can also be used to analyze the vascular networks in multiple organs and tissues throughout the embryo including skin and heart 6-10.

This article describes a method for labeling embryonic skin and thymus blood vessels.

The establishment of a functional blood vessel network is an essential part of organogenesis, and is required for optimal organ function. For example, in ...

Measurement of Cytosolic Ca2+ in Isolated Contractile Lymphatics

Lymphatic vessels comprise a multifunctional transport system that maintains fluid homeostasis, delivers lipids to the central circulation, and acts as a surveillance system for potentially harmful antigens, optimizing mucosal immunity and adaptive immune responses1. Lymph is formed from interstitial fluid that enters blind-ended initial lymphatics, and then is transported against a pressure gradient in larger collecting lymphatics. Each collecting lymphatic is made up of a series of segments called lymphangions, separated by bicuspid valves that prevent backflow. Each lymphangion possesses a contractile cycle that propels lymph against a pressure gradient toward the central circulation2. This phasic contractile pattern is analogous to the cardiac cycle, with systolic and diastolic phases, and with a lower contraction frequency4. In addition, lymphatic smooth muscle generates tone and displays myogenic constriction and dilation in response to increases and decreases in luminal pressure, respectively5. A hybrid of molecular mechanisms that support both the phasic and tonic contractility of lymphatics are thus proposed.
Contraction of smooth muscle is generally regulated by the cytosolic Ca2+ concentration ([Ca2+]i) plus sensitivity to Ca2+, of the contractile elements in response to changes in the environment surrounding the cell6. [Ca2+]i is determined by the combination of the movement of Ca2+ through plasma membrane ligand or voltage gated Ca2+ channels and the release and uptake of Ca2+ from internal stores. Cytosolic Ca2+ binds to calmodulin and activates enzymes such as myosin light chain (MLC) kinase (MLCK), which in turn phosphorylates MLC leading to actin-myosin-mediated contraction8. However, the sensitivity of this pathway to Ca2+ can be regulated by the MLC phosphatase (MLCP)9. MLCP activity is regulated by Rho kinase (ROCK) and the myosin phosphatase inhibitor protein CPI-17.
Here, we present a method to evaluate changes in [Ca2+]i over time in isolated, perfused lymphatics in order to study Ca2+-dependent and Ca2+-sensitizing mechanisms of lymphatic smooth muscle contraction. Using isolated rat mesenteric collecting lymphatics we studied stretch-induced changes in [Ca2+]i and contractile activity. The isolated lymphatic model offers the advantage that pressure, flow, and the chemical composition of the bath solution can be tightly controlled. [Ca2+]i was determined by loading lymphatics with the ratiometric, Ca2+-binding dye Fura-2. These studies will provide a new approach to the broader problem of studying the different molecular mechanisms that regulate phasic contractions versus tonic constriction in lymphatic smooth muscle.

Measurement of Cytosolic Ca2+ in Isolated Contractile Lymphatics

We introduce an approach to evaluate the cytosolic Ca2+ concentration in isolated lymphatics to study Ca2+-dependent and Ca2+-sensitizing mechanisms of lymphatic smooth muscle contraction.

Lymphatic vessels comprise a multifunctional transport system that maintains fluid homeostasis, delivers lipids to the central circulation, and acts as a ...

4D Multimodality Imaging of Citrobacter rodentium Infections in Mice

This protocol outlines the steps required to longitudinally monitor a bioluminescent bacterial infection using composite 3D diffuse light imaging tomography with integrated &mu;CT (DLIT-&mu;CT) and the subsequent use of this data to generate a four dimensional (4D) movie of the infection cycle. To develop the 4D infection movies and to validate the DLIT-&mu;CT imaging for bacterial infection studies using an IVIS Spectrum CT, we used infection with bioluminescent C. rodentium, which causes self-limiting colitis in mice. In this protocol, we outline the infection of mice with bioluminescent C. rodentium and non-invasive monitoring of colonization by daily DLIT-&mu;CT imaging and bacterial enumeration from feces for 8 days.
The use of the IVIS Spectrum CT facilitates seamless co-registration of optical and &mu;CT scans using a single imaging platform. The low dose &mu;CT modality enables the imaging of mice at multiple time points during infection, providing detailed anatomical localization of bioluminescent bacterial foci in 3D without causing artifacts from the cumulative radiation. Importantly, the 4D movies of infected mice provide a powerful analytical tool to monitor bacterial colonization dynamics in vivo.

4D Multimodality Imaging of Citrobacter rodentium Infections in Mice

Multi-modality imaging is a valuable approach for studying bacterial colonization in small animal models. This protocol outlines infection of mice with bioluminescent Citrobacter rodentium and the longitudinal monitoring of bacterial colonization using composite 3D diffuse light imaging tomography with &mu;CT imaging to create a 4D movie of C. rodentium infection.

This protocol outlines the steps required to  longitudinally monitor a bioluminescent bacterial infection using composite 3D diffuse light imaging ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

Measuring Local Anaphylaxis in Mice

Allergic responses are the result of the activation of mast cells and basophils, and the subsequent release of vasoactive and proinflammatory mediators. Exposure to an allergen in a sensitized individual can result in clinical symptoms that vary from minor erythema to life threatening anaphylaxis. In the laboratory, various animal models have been developed to understand the mechanisms driving allergic responses. Herein, we describe a detailed method for measuring changes in vascular permeability to quantify localized allergic responses. The local anaphylaxis assay was first reported in the 1920s, and has been adapted from the technique published by Kojima et al. in 20071. In this assay, mice sensitized to OVA are challenged in the left ear with vehicle and in the right ear with OVA. This is followed by an intravenous injection of Evans Blue dye. Ten min after injecting Evans Blue, the animal is euthanized and the dye that has extravasated into the ears is extracted overnight in formamide. The absorbance of the extracted dye is then quantified with a spectrophotometer. This method reliably results in a visual and quantifiable manifestation of a local allergic response.

Allergic responses, characterized by the activation of mast cells and basophils, are driven by the cross-linking of IgE and release of proinflammatory mediators. A quantitative assessment of allergic responses can be achieved by using Evans Blue dye to monitor changes in vascular permeability after allergen challenge.

Allergic responses are the result of the activation of mast cells and basophils, and the subsequent release of vasoactive and proinflammatory mediators. ...

Size Matters: Measurement of Capsule Diameter in Cryptococcus neoformans

The polysaccharide capsule of Cryptococcus neoformans is the primary virulence factor and one of the most commonly studied aspects of this pathogenic yeast. Capsule size can vary widely between strains, has the ability to grow rapidly when introduced to stressful or low nutrient conditions, and has been positively correlated with strain virulence. For these reasons, the size of the capsule is of great interest to C. neoformans researchers. The growth of the C. neoformans capsule is induced during phenotypic testing to help understand the effects of different treatments on the yeast or size differences between strains. Here we describe one of the standard methods of capsule induction and compare two accepted methods of staining and measuring capsule diameter: (i) India ink, a negative stain, used in conjunction with conventional light microscopy and (ii) co-staining with fluorescent dyes of both the cell wall and capsule followed by confocal microscopy. Finally, we show how measurement of capsule diameter from India ink-stained samples can be automated using computational image analysis.

Size Matters: Measurement of Capsule Diameter in Cryptococcus neoformans

The polysaccharide capsule is the primary virulence factor in Cryptococcus neoformans, and its size correlates with strain virulence. Capsule diameter measurements are used in phenotypic testing and to gauge therapeutic efficacy. Here a standard method of capsule induction is presented, and two methods of staining and measuring diameter are compared.

The polysaccharide capsule of Cryptococcus neoformans is the primary virulence factor and one of the most commonly studied aspects of this pathogenic ...

A Method for the Measurement of Salivary Gland Function in Mice

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced saliva production. Similarly, saliva production is severely compromised in patients receiving radiation treatment for head and neck cancers. Rodent models, developed to mimic these clinical conditions, facilitate an understanding of the disease pathogenesis and allow for the development of new therapeutic strategies. Therefore, the ability to accurately, reproducibly, and repeatedly measure salivary gland function in animal models is critical. Building on procedures previously described in the literature, a method was developed that meets these criteria and was used to evaluate salivary gland function in mice. An additional advantage of this new method is that it is easily mastered, and has little inter-operator variation. Salivary gland function is evaluated as the amount (weight or volume) or rate (mL/min) of saliva produced in response to pilocarpine stimulation. The collected saliva is a good source for the analyses of protein content, immunoglobulin concentrations, and other biomolecules.

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced ...

Characterization of Thymus-dependent and Thymus-independent Immunoglobulin Isotype Responses in Mice Using Enzyme-linked Immunosorbent Assay

Antibodies, also termed as immunoglobulins (Ig), secreted by differentiated B lymphocytes, plasmablasts/plasma cells, in humoral immunity provide a formidable defense against invading pathogens via diverse mechanisms. One major goal of vaccination is to induce protective antigen-specific antibodies to prevent life-threatening infections. Both thymus-dependent (TD) and thymus-independent (TI) antigens can elicit robust antigen-specific IgM responses and can also induce the production of isotype-switched antibodies (IgG, IgA and IgE) as well as the generation of memory B cells with the help provided by antigen presenting cells (APCs). Here, we describe a protocol to characterize TD and TI Ig isotype responses in mice using enzyme-linked immunosorbent assay (ELISA). In this protocol, TD and TI Ig responses are elicited in mice by intraperitoneal (i.p.) immunization with hapten-conjugated model antigens TNP-KLH (in alum) and TNP-polysaccharide (in PBS), respectively. To induce TD memory response, a booster immunization of TNP-KLH in alum is given at 3 weeks after the first immunization with the same antigen/adjuvant. Mouse sera are harvested at different time points before and after immunization. Total serum Ig levels and TNP-specific antibodies are subsequently quantified using Ig isotype-specific Sandwich and indirect ELISA, respectively. In order to correctly quantify the serum concentration of each Ig isotype, the samples need to be appropriately diluted to fit within the linear range of the standard curves. Using this protocol, we have consistently obtained reliable results with high specificity and sensitivity. When used in combination with other complementary methods such as flow cytometry, in vitro culture of splenic B cells and immunohistochemical staining (IHC), this protocol will allow researchers to gain a comprehensive understanding of antibody responses in a given experimental setting.

In this paper, we describe a protocol to characterize T-dependent and T-independent immunoglobulin (Ig) isotype responses in mice using ELISA. This method used alone or in combination with flow cytometry will allow researchers to identify differences in B cell-mediated Ig isotype responses in mice following T-dependent and T-independent antigen immunization.

Antibodies, also termed as immunoglobulins (Ig), secreted by differentiated B lymphocytes, plasmablasts/plasma cells, in humoral immunity provide a ...

High-throughput Measurement of Plasma Membrane Resealing Efficiency in Mammalian Cells

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In response to these damages, complex molecular machineries rapidly reseal the plasma membrane to restore its barrier function and maintain cell survival. Despite 60 years of research in this field, we still lack a thorough understanding of the cell resealing machinery. With the goal of identifying cellular components that control plasma membrane resealing or drugs that can improve resealing, we have developed a fluorescence-based high-throughput assay that measures the plasma membrane resealing efficiency in mammalian cells cultured in microplates. As a model system for plasma membrane damage, cells are exposed to the bacterial pore-forming toxin listeriolysin O (LLO), which forms large 30-50 nm diameter proteinaceous pores in cholesterol-containing membranes. The use of a temperature-controlled multi-mode microplate reader allows for rapid and sensitive spectrofluorometric measurements in combination with brightfield and fluorescence microscopy imaging of living cells. Kinetic analysis of the fluorescence intensity emitted by a membrane impermeant nucleic acid-binding fluorochrome reflects the extent of membrane wounding and resealing at the cell population level, allowing for the calculation of the cell resealing efficiency. Fluorescence microscopy imaging allows for the enumeration of cells, which constitutively express a fluorescent chimera of the nuclear protein histone 2B, in each well of the microplate to account for potential variations in their number and allows for eventual identification of distinct cell populations. This high-throughput assay is a powerful tool expected to expand our understanding of membrane repair mechanisms via screening for host genes or exogenously added compounds that control plasma membrane resealing.

Here we describe a high-throughput fluorescence-based assay that measures the plasma membrane resealing efficiency through fluorometric and imaging analyses in living cells. This assay can be used for screening drugs or target genes that regulate plasma membrane resealing in mammalian cells.

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In ...

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a striking increase in life expectancy around the globe. Nonetheless, determining vaccine efficacy remains a challenge. Emerging evidence suggests that the current acellular vaccine (aPV) for Bordetella pertussis (B. pertussis) induces suboptimal immunity. Therefore, a major challenge is designing a next-generation vaccine that induces protective immunity without the adverse side effects of a whole-cell vaccine (wPV). Here we describe a protocol that we used to test the efficacy of a promising, novel adjuvant that skews immune responses to a protective Th1/Th17 phenotype and promotes a better clearance of a B. pertussis challenge from the murine respiratory tract. This article describes the protocol for mouse immunization, bacterial inoculation, tissue harvesting, and analysis of immune responses. Using this method, within our model, we have successfully elucidated crucial mechanisms elicited by a promising, next-generation acellular pertussis vaccine. This method can be applied to any infectious disease model in order to determine vaccine efficacy.

Here we present an elegant protocol for in vivo evaluation of vaccine effectiveness and host immune responses. This protocol can be adapted for vaccine models that study viral, bacterial, or parasitic pathogens.

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a ...