Name: bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses
Uploaded: 2015-12-29T13:00:00
Duration: 12 min 20 s
Description: Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

The authors would like to acknowledge the Utah Science Technology and Research fund for support of YML and the Korea National Research Foundation grants (2009-0069679 and 2010-0010154) for support of SIY. This research was supported by the Utah Agricultural Experiment Station, Utah State University, and approved as journal paper number UAES #8753. Also, the authors thank Dr. Deborah McClellan for editorial assistance.

The authors have declared that they have no competing financial interests.

The current protocol has been successfully used to generate full-length infectious cDNA clones for two different strains (CNU/LP227 and SA14-14-228) of JEV, a flavivirus whose functional cDNA has proved to be inherently difficult to construct and propagate because of host cell toxicity and the genetic instability of the cloned cDNA.8,74-76 This protocol involves three major components: first, maximizing the synthesis/amplification of a faithful cDNA copy of the viral RNA using high-fidelity reverse transcriptase/DNA polymerase; second, cloning the viral prM-E coding region containing toxic sequences (unpublished data)74,77,78 in a very low-copy number vector BAC from the initial cDNA subcloning to the final full-length cDNA assembly steps; and third, utilizing a cloning vector BAC that can accommodate a foreign DNA with an average size of 120-350 kb,19-21 which apparently tolerates larger DNA inserts than do other cloning vectors. This cloning approach will be generally applicable to many other positive-strand RNA viruses, particularly those with a large RNA genome of ~10 to 32 kb. Generation of an infectious cDNA clone is a key step in developing a reverse genetics system for RNA viruses, especially for positive-strand RNA viruses, because its genome acts as viral mRNA that is translated into proteins by host cell ribosomes. Thus, viral replication can be initiated by the introduction of a cDNA-derived genome-length RNA molecule into a susceptible host cell. The availability of an infectious JEV cDNA clone, when combined with recombinant DNA technology, has increased our understanding of various aspects of the viral life cycle at the molecular level, such as gene expression73,79 and genome replication.63,64 Also, a full-length JEV cDNA clone has proven to be a valuable tool for the development of antiviral vaccines28 and gene delivery vectors.80,81
As with all positive-strand RNA viruses, there are multiple critical steps in constructing a reliable functional cDNA for JEV from which highly infectious RNAs can be synthesized in vitro. Ideally, the sequence of the synthetic RNAs transcribed from a clone of the full-length cDNA should be identical to that of the viral genomic RNA, particularly the 5&#39;- and 3&#39;-terminal sequences that are required for the initiation of viral RNA replication.60-62 In the current protocol, the authentic 5&#39;- and 3&#39;-ends were ensured by placing the SP6 promoter sequence upstream of the first adenine nucleotide of the viral genome and positioning a unique artificial Xba I restriction site downstream of the last thymine nucleotide of the viral genome, respectively. Capped synthetic RNAs with the authentic 5&#39; and 3&#39; ends were produced by run-off transcription of an Xba I-linearized and MBN-treated cDNA template using SP6 RNA polymerase primed with the m7G(5&#39;)ppp(5&#39;)A cap analog. This protocol can be modified in several ways. For in vitro transcription, another bacteriophage RNA polymerase (e.g., T3 or T7) can be used in conjunction with its well-defined promoter sequence.27 As a run-off site, a different restriction site can be utilized if it is not present in the viral genome and if synthetic RNA from the linearized cDNA ends with the authentic 3&#39; end. The importance of the 3&#39;-end nucleotide sequence has been demonstrated by a ~10-fold decrease in RNA infectivity when a synthetic RNA contains three or four virus-unrelated nucleotides at its 3&#39; end.27 In an in vitro transcription reaction, both the m7G(5&#39;)ppp(5&#39;)A and m7G(5&#39;)ppp(5&#39;)G cap analog can be used equally well, although the latter places an unrelated extra G nucleotide upstream of the viral 5&#39;-end, but that addition does not alter the infectivity or replication of synthetic RNA.27 Moreover, removal of the cDNA template from the RNA transcripts by DNase I digestion is not necessary for RNA infectivity tests, because the cDNA template itself is not infectious.27
The BAC technology has now been applied to constructing infectious cDNA clones for a handful of positive-strand RNA viruses, namely, two JEVs, CNU/LP227 and SA14-14-228 (genome size, ~11 kb); two dengue viruses, BR/9026 and NGC29 (~11 kb); the bovine viral diarrhea virus, SD1 (~12 kb);25 two classical swine fever viruses, C and Paderborn (~12 kb);24 the border disease virus, Gifhorn (~12 kb);24 the porcine reproductive and respiratory syndrome virus, PL97-1/LP1 (~15 kb);30 the transmissible gastroenteritis virus, PUR46-MAD (~29 kb);16 the feline infectious peritonitis virus, DF-2 (~29 kb);32 the severe acute respiratory syndrome coronavirus, Urbani (~30 kb);9 the Middle East respiratory syndrome coronavirus, EMC/2012 (~30 kb);17 and the human coronavirus, OC43 (~31 kb).31 The main advantage of using BACs for cDNA construction is the high genetic stability of the large, 1- or 2-copy BAC plasmids; however, the intrinsic nature of its extremely low-copy number is also a great disadvantage, because of very low yields of BAC DNA and the consequent reduction in the purity of the BAC DNA with respect to host chromosomal DNA. In the current protocol, the yield of BAC DNA is maximized by growing E. coli DH10B transformed with the infectious BAC pBAC/SA14-14-2 in a nutrient-rich medium, 2xYT. Despite this effort, the average yield is only ~15 &#181;g of BAC DNA from 500 ml of 2xYT broth. Also, the purity of the BAC DNA is best achieved by using CsCl-EtBr density gradient centrifugation for purification, rather than the commonly used column-based plasmid isolation. However, it is important to keep in mind that the BAC-transformed E. coli should not overgrow because it might jeopardize the genetic stability of the cloned cDNA, and higher growth does not necessarily lead to greater yields or higher-purity BAC DNA.
The protocol described here is an optimized, efficient, and streamlined method for the construction and propagation of a genetically stable full-length infectious cDNA clone as a BAC for JEV, a procedure once thought practically impossible. This same cloning strategy may also be applied to many other positive-strand RNA viruses. In general, infectious cDNA clones enable us to introduce a variety of mutations (e.g., deletions, insertions, and point mutations) into a viral RNA genome to study their biological functions in viral replication and pathogenesis. This cDNA-based reverse genetics system makes it possible to develop and test vaccine and therapeutic candidates targeting a virulence factor(s) of a particular positive-strand RNA virus of interest. In addition, this infectious cDNA technology can also be utilized as a viral vector, capable of expressing a foreign gene(s) of interest for many applications in biomedical research.

For RNA virologists, the advent of recombinant DNA technology in the late 1970s made it possible to convert viral RNA genomes into cDNA clones, which could then be propagated as plasmids in bacteria for the genetic manipulation of RNA viruses.1 The first RNA virus to be molecularly cloned was bacteriophage Q&#946;, a positive-strand RNA virus that infects Escherichia coli. A plasmid containing a complete cDNA copy of the Q&#946; genomic RNA gave rise to infectious Q&#946; phages when introduced into E. coli.2 Shortly thereafter, this technique was applied to poliovirus, a positive-strand RNA virus of humans and animals. A plasmid bearing a full-length cDNA of the poliovirus genomic RNA was infectious when transfected into mammalian cells and capable of producing infectious virions.3 In this &#34;DNA-launched&#34; approach, the cloned cDNAs should be transcribed intracellularly to initiate viral RNA replication; however, it is unclear how the transcription is initiated and how the transcripts are processed to the correct viral sequence. This concern has led to the development of an alternative &#34;RNA-launched&#34; approach, whereby a complete cDNA copy of the viral RNA genome is cloned under a promoter recognized by an E. coli or phage RNA polymerase for the production of synthetic RNAs in vitro with defined 5&#39; and 3&#39; termini, which undergo the complete viral replication cycle when introduced into host cells.4,5 The first success with this approach was reported for brome mosaic virus,6,7 a positive-strand RNA virus of plants. Since then, the RNA-launched approach has been developed for a wide range of positive-strand RNA viruses, including caliciviruses, alphaviruses, flaviviruses, arteriviruses, and coronaviruses.1,4,5,8
In both the DNA- and RNA-launched reverse genetics systems, the construction of a full-length cDNA clone is the key to generating infectious DNA or RNA of positive-strand RNA viruses, but it becomes a considerable technical challenge as the size of the viral genome increases.9-17 In particular, a large RNA genome of ~10-32 kb presents three major obstacles to the cloning of a full-length functional cDNA.18 The first difficulty is the synthesis of a faithful cDNA copy, since the fidelity of RT-PCR is inversely proportional to the length of the viral RNA. The second hurdle is the presence of potentially toxic sequences, since long RNA molecules are more likely to contain unexpected sequences capable of making the cDNA fragment in plasmids unstable in E. coli. The third and most critical issue is the availability of a suitable vector, since it is difficult to find a cloning vector that can house a viral cDNA insert of &#62;10 kb. Over the past three decades, these barriers have been overcome by several advances in enzymology, methodology, and vectorology.1,4,5,8 Of these, the most promising and innovative development is the cloning of large positive-strand RNA viruses as infectious bacterial artificial chromosomes (BACs). The BAC vector is a low-copy cloning plasmid (1-2 copies/cell) based on the E. coli fertility factor, with an average DNA insert size of ~120-350 kb.19-21 A DNA fragment is inserted into the BAC vector in a similar fashion to cloning into general cloning vectors; the resulting BAC clones are stable over many generations in E. coli.22,23 To date, the BAC technology has been used to create infectious cDNA clones for &#62;10 members of three positive-strand RNA virus families, i.e., Flaviviridae,24-29Arteriviridae,30 and Coronaviridae.9,16,17,31,32
Using Japanese encephalitis virus (JEV) as an example, the present work reports the detailed procedures that can be used to construct a genetically stable full-length infectious BAC for a variety of positive-strand RNA viruses. JEV is a zoonotic flavivirus33 that is transmitted in nature between birds, pigs, and other vertebrate hosts by mosquito vectors.34,35 In humans, JEV infection can cause the severe often fatal neurological disease Japanese encephalitis (JE),36 which occurs in Asia and parts of the Western Pacific,37,38 with an estimated annual incidence of ~50,000-175,000 clinical cases.39,40 The genome of JEV is an ~11-kb, single-stranded, positive-sense RNA molecule and consists of a single open reading frame (ORF) flanked by two non-coding regions (NCRs) at the 5&#39; and 3&#39; ends.41,42 The ORF encodes a polyprotein that is cleaved by host and viral proteases to generate 10 individual proteins, designated C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5 in the N- to C-terminal direction.34,43,44 Also, an extended form of NS1 (NS1&#39;) is expressed by -1 ribosomal frameshifting at codons 8-9 of NS2A.45,46 Of these 11 proteins, the three structural proteins (C, prM, and E) are essential for the formation of infectious virions,47,48 and the remaining eight nonstructural proteins (NS1 to NS5, and NS1&#39;) are crucial for viral RNA replication,49-51 particle assembly,52-56 and innate immunity evasion.57-59 Both the 5&#39; and 3&#39; NCRs contain conserved primary sequences and form RNA secondary/tertiary structures,60-62 which are important for modulating viral RNA replication.63,64
This protocol describes the tools, methods, and strategies for generating a full-length infectious BAC of JEV SA14-14-2.28 This functional BAC clone contains a complete cDNA copy of the JEV genomic RNA,65 which is encompassed by a promoter for the SP6 RNA polymerase upstream of the viral 5&#39;-end and a unique Xba I restriction site downstream of the viral 3&#39;-end for in vitro run-off transcription. This BAC technology is applicable to constructing a fully functional cDNA molecular clone for an array of positive-strand RNA viruses.

<table border="0" cellpadding="0" cellspacing="0" width="1054">
	<tbody>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">1. Molecular Cloning</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td style="width:235px;"></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2xYT Broth</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">Y2377</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">[3H]UTP</td>
			<td style="width:275px;">PerkinElmer</td>
			<td style="width:243px;">NET380250UC</td>
			<td>Radioactive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">50-mL Tube</td>
			<td style="width:275px;">Thermo Scientific (Nalgene)</td>
			<td style="width:243px;">3114-0050</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">250-mL Bottle</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">356011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose</td>
			<td style="width:275px;">Lonza</td>
			<td style="width:243px;">50004</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose (Low Melting Point)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">16520-100</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvaI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0152S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvrII</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0174S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BamHI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0136S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsiWI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0553S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsrGI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0575S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Butanol</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">A399-1&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cap Analog [m7G(5&#697;)ppp(5&#697;)A]</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">S1405S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cesium Chloride</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">BP1595-1</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloramphenicol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0378</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloroform</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C2432</td>
			<td>Carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">DE-81 Filter Paper</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">3658-023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">dNTP mix</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18427-088</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">E. coli DH10B&#160;</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18297-010</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">EDTA</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E5134</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethanol&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethidium Bromide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7637</td>
			<td>Toxic and highly mutagenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Filter Column (Plasmid Maxiprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-26</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glacial Acetic Acid</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">A6283</td>
			<td>Irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glucose</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">G5400</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glycogen&#160;</td>
			<td style="width:275px;">Roche</td>
			<td style="width:243px;">10901393001</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">High-Fidelity DNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isoamyl Alcohol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">I9392</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isopropanol&#160;</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0918</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">LB Broth</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">12795-027</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lithium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">L9650</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lysozyme</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0663</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Magnesium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M8266</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">M-MLV Reverse Transcriptase</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18080-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Mung Bean Nuclease</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0250S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Needle (18G, 20G)</td>
			<td style="width:275px;">BD</td>
			<td style="width:243px;">305196, 305175</td>
			<td>Biohazardous (Sharps waste)</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">NotI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0189S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Oligonucleotide</td>
			<td style="width:275px;">Integrated DNA Technologies</td>
			<td style="width:243px;">Custom Oligonucleotide Synthesis</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">PacI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0547S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">pBeloBAC11</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">ER2420S (E4154S)</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol (Buffer-Saturated)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15513-039</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Chloroform:Isoamyl Alcohol</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15593-031</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Guanidine Isothiocyanate</td>
			<td style="width:275px;">Life Technologies (Ambion)</td>
			<td style="width:243px;">10296-010</td>
			<td>Toxic, corrosive, and irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Pme I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0560S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Acetate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0698</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">RNase Inhibitor</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">10777-019</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">rNTP Set</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">27-2025-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sealable Polypropylene Tube (16 &#215; 76 mm)&#160;</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">342413</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SfiI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0123S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sma I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0141S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Acetate</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S2889</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Dodecyl Sulfate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0227</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Hydroxide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S5881</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SP6 RNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0207S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Spin Column (Plasmid Miniprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-11</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Syringe</td>
			<td style="width:275px;">HSW NORM-JECT</td>
			<td style="width:243px;">4200.000V0</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">T4 DNA Ligase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tris</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">tRNA (yeast)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15401-011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">XbaI&#160;</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0145S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2. Cell Culture</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Alpha Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">12561-049</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Conical Tube (50 mL)</td>
			<td style="width:275px;">VWR</td>
			<td style="width:243px;">21008-242</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Crystal Violet&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0775</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Culture Dish (150 mm)&#160;</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">93150&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cuvette (2-mm Gap)</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">450125&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Fetal Bovine Serum&#160;</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">16000-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Formaldehyde</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">F1635</td>
			<td>Toxic and carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glutamine</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25030-081</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">61100-061</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Penicillin/Streptomycin</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">15070-063</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P3911</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Phosphate Monobasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P9791</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Six-Well Plate</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">92006</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3014</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Phosphate Dibasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3264</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Trypsin-EDTA (0.25%)</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25200-056</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vitamins</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M6895</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">3. Equipment</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose Gel Electrophoresis System</td>
			<td style="width:275px;">Mupid</td>
			<td style="width:243px;">MPDEXU-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">CO2 Incubator</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">Heracell 150i</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Desktop Centrifuge&#160;</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">ST16R</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Electroporator</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">ECM 830</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Longwave Ultraviolet Lamps (Handheld)</td>
			<td style="width:275px;">UVP</td>
			<td style="width:243px;">UVGL-58</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tabletop Centrifuge</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">368826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Thermocycler</td>
			<td style="width:275px;">Life Technologies (Applied Biosystems)</td>
			<td style="width:243px;">GeneAmp PCR System 9700</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vortexer</td>
			<td style="width:275px;">Scientific Industries</td>
			<td style="width:243px;">G-560</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Water Bath</td>
			<td style="width:275px;">Jeio Tech</td>
			<td style="width:243px;">WB-10E</td>
			<td></td>
		</tr>
	</tbody>
</table>

bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

For all positive-strand RNA viruses, the reliability and efficiency of a reverse genetics system depend on the genetic stability of a cloned full-length cDNA, whose sequence is equivalent to the consensus sequence of viral genomic RNA.27 Figure 1 shows a five-step strategy for the construction of a full-length infectious cDNA as a BAC for JEV SA14-14-228: Step 1, purification of viral RNA from the cell culture supernatant of JEV-infected BHK-21 cells (Figure 1A); Step 2, synthesis of four overlapping cDNA amplicons (F1 to F4) spanning the whole viral genome (Figure 1B); Step 3, subcloning of each of the four contiguous cDNA fragments into a BAC vector, creating pBAC/F1 to pBAC/F4 (Figure 1C); Step 4, modification of the cloned cDNAs for in vitro run-off transcription with SP6 RNA polymerase, i.e., placing an SP6 promoter sequence immediately upstream of the viral 5&#39;-end (pBAC/F1SP6), eliminating a pre-existing internal Xba I site at nucleotide 9131 by introducing a silent point mutation, A9134&#8594;T (pBAC/F3KO), and inserting a new artificial Xba I run-off site immediately downstream of the viral 3&#39;-end (pBAC/F4RO) (Figure 1D); and Step 5, assembly of a full-length SA14-14-2 cDNA BAC, pBAC/SA14-14-2 (Figure 1E). Table 1 lists the oligonucleotides used in this cloning procedure.28
For the construction of a functional JEV cDNA, the first important step is the synthesis of the four overlapping cDNA fragments using the purified viral RNA as a template for RT-PCR. Figure 2 provides a representative result for the four RT-PCR products that were electrophoresed on a 0.8% agarose gel. This gel demonstrates clearly that a full-length JEV cDNA is amplified into four overlapping cDNA fragments. Occasionally, RT-PCR reactions might yield one or more additional virus-specific or nonspecific products that are mostly smaller than the expected product, because of the nonspecific annealing of primers during cDNA synthesis/amplification. On the other hand, little or no expected RT-PCR product would be amplified because of accidental RNase contamination during the viral RNA isolation or improper RT-PCR performance.
The next key step is the cloning and modification of a partial- or full-length JEV cDNA in BAC, which is a relatively straightforward procedure that uses standard recombinant DNA techniques.69 Figure 3 presents a representative outcome for the purification of the BAC clone containing a full-length cDNA of JEV SA14-14-2 by banding in a CsCl-EtBr gradient. In this experiment, after centrifugation for 16 hr at 401,700 &#215; g, two distinct bands, i.e., the E. coli chromosomal DNA above and the supercoiled BAC plasmid DNA below, are visible in the middle of the tube under long-wave ultraviolet light. A minimal volume (~400 &#181;l) of the lower BAC DNA band was carefully collected by poking a hole with a syringe on the side of the tube. Subsequently, the EtBr was extracted from the BAC DNA by butanol extraction, and the EtBr-free BAC DNA was concentrated by ethanol precipitation.
The final step is the determination of the specific infectivity of the synthetic RNAs transcribed in vitro from the full-length SA14-14-2 BAC (pBAC/SA14-14-2) after RNA transfection into permissive cells (Figure 4). This step involves three sequential steps: Step 1, linearization of the full-length SA14-14-2 cDNA at the 3&#39;-end of the viral genome (Figure 4A); Step 2, production of synthetic RNAs from the linearized cDNA by run-off transcription (Figure 4B); and Step 3, rescue of the recombinant viruses in BHK-21 cells transfected with the synthetic RNAs (Figure 4C). Experimentally, two independent clones of pBAC/SA14-14-2 were linearized with Xba I digestion and treated with MBN to remove the four-base 5&#39; overhang generated by the Xba I digestion. The linearized BACs were cleaned up by phenol-chloroform extraction, followed by ethanol precipitation. The linearization of the two purified BACs was demonstrated on a 0.8% agarose gel (Figure 5A). The phenol-chloroform extraction must be done carefully to ensure that the linearized BACs are RNase-free. Each of the two linearized BACs served as a cDNA template for run-off transcription using SP6 RNA polymerase in the presence of the m7G(5&#39;)ppp(5&#39;)A cap analog. The integrity of the synthetic RNAs was shown by running aliquots of the two transcription reaction mixtures on a 0.6% agarose gel, along with a reference 1 kb DNA ladder (Figure 5B). In this simple assay, the major prominent RNA band always migrated just below the 3 kb reference DNA band and appeared to be sharp. However, degraded RNA would have a smeared appearance on the same gel.
An infectious center assay is the gold standard for determining the specific infectivity of the synthetic RNAs. This assay was done by electroporating BHK-21 cells with RNA samples, seeding equal aliquots of the 10-fold serially diluted electroporated cells in 6-well plates containing na&#239;ve BHK-21 cells (3 &#215; 105 cells/well), and overlaying agarose onto the cell monolayers. After incubation for 4 days, surviving cells were fixed with formaldehyde and stained with a crystal violet solution to quantify the number of infectious centers (plaques), which corresponds to the number of infectious RNA molecules delivered into the cells (Figure 6A). Since the cDNA template used for in vitro transcription has been proven to be non-infectious,27 an aliquot of the transcription reaction mixture was directly used for electroporation. Electroporation is the preferred method for RNA transfection; alternatively, RNAs can be transfected by other methods using DEAE-dextran and cationic liposomes. RNA electroporation is very effective, but &#34;arcing&#34; of the electric pulse occurs rarely if salts are present in the electroporation reaction or if the electroporation cuvette is reused. The expression of viral proteins in RNA-transfected cells was examined by immunofluorescence assays using an anti-NS1 rabbit antiserum (Figure 6B). The production of viral particles accumulated in the supernatants of RNA-transfected cells was analyzed by plaque assays (Figure 6C). The results of these experiments show clearly that the cDNA-derived synthetic RNAs are infectious in permissive BHK-21 cells, generating a high titer of recombinant viruses.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Oligonucleotide</td>
			<td>Sequencea (5&#39; to 3&#39;)</td>
			<td>Positionb</td>
			<td>Polarity</td>
		</tr>
		<tr>
			<td>1RT</td>
			<td>TAGGGATCTGGGCGTTTCTG 
			GCAAAT</td>
			<td>2578&#8211;2603</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>1F</td>
			<td>aatcccgggAGAAGTTTATC 
			TGTGTGAACTT</td>
			<td>1&#8211;22</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>1R</td>
			<td>attgcggccgcCCACGTCGT 
			TGTGCACGAAGAT</td>
			<td>2532&#8211;2553</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>2RT</td>
			<td>TTCTGCCTACTCTGCCCCTC 
			CGTTGA</td>
			<td>5975&#8211;6000</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>2F</td>
			<td>aatcccgggTCAAGCTCAGT 
			GATGTTAACAT</td>
			<td>1800&#8211;1821</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>2R</td>
			<td>attgcggccgcGATGGGTTT 
			CCGAGGATGACTC</td>
			<td>5929&#8211;5950</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>3RT</td>
			<td>ACGGTCTTTCCTTCTGCTGC 
			AGGTCT</td>
			<td>9426&#8211;9451</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>3F</td>
			<td>aatcccgggGAGGATACATT 
			GCTACCAAGGT</td>
			<td>5500&#8211;5521</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>3R</td>
			<td>attgcggccgcGTAAGTCAG 
			TTCAATTATGGCT</td>
			<td>9380&#8211;9401</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>4RT</td>
			<td>AGATCCTGTGTTCTTCCTCA 
			CCACCA</td>
			<td>10952&#8211;10977</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>4F</td>
			<td>aatcccgggAGTGGAAGGCT 
			CAGGCGTCCAA</td>
			<td>9200&#8211;9221</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>4R</td>
			<td>attgcggccgcAGATCCTGT 
			GTTCTTCCTCACC</td>
			<td>10956&#8211;10977</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>SP6F</td>
			<td>cataccccgcgtattcccac 
			ta</td>
			<td></td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>SP6R</td>
			<td>ACAGATAAACTTCTctatag 
			tgtcccctaaa</td>
			<td>1&#8211;14</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>F1F</td>
			<td>aggggacactatagAGAAGT 
			TTATCTGTGTG</td>
			<td>1&#8211;17</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>F1R</td>
			<td>TGGATCATTGCCCATGGTAA 
			GCTTA</td>
			<td>638&#8211;662</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>X1F</td>
			<td>CGAATGGATCGCACAGTGTG 
			GAGAG</td>
			<td>8403&#8211;8427</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>X1R</td>
			<td>AAAGCTTCAAACTCAAGATA 
			CCGTGCTCC</td>
			<td>9120&#8211;9148</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>X2F</td>
			<td>GGAGCACGGTATCTTGAGTT 
			TGAAGCTTT</td>
			<td>9120&#8211;9148</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>X2R</td>
			<td>cacgtggacgagggcatgcc 
			tgcag</td>
			<td></td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>ROF</td>
			<td>CCAGGAGGACTGGGTTACCA 
			AAGCC</td>
			<td>10670&#8211;10694</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>ROR</td>
			<td>agggcggccgctctagAGAT 
			CCTGTGTTCTTCCTCACCAC</td>
			<td>10954&#8211;10977</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td colspan="4">aJEV sequences are shown in uppercase letters, and BAC sequences are indicated in lowercase letters. 
			bNucleotide position refers to the complete genome sequence of JEV SA14-14-2 (Genbank accession number JN604986).</td>
		</tr>
	</tbody>
</table>
Table 1: Oligonucleotides used for cDNA synthesis, PCR amplification, and BAC mutagenesis.
<img alt="Figure 1" src="/files/ftp_upload/53164/53164fig1.jpg" /> 
Figure 1.&#160;Strategy for the construction of a full-length cDNA of JEV SA14-14-2 as a BAC. (A) Isolation of viral RNA from JEV particles. Shown is a schematic diagram of the genomic RNA of JEV SA14-14-2. (B) Synthesis of four overlapping cDNA fragments (F1 to F4) covering the entire viral genome. (C) Subcloning of four overlapping cDNA fragments into a BAC vector, creating pBAC/F1 to pBAC/F4. (D) Modification of the cloned cDNAs for run-off transcription in vitro. pBAC/F1SP6 is a derivative of pBAC/F1 that contains the SP6 promoter sequence upstream of the viral 5&#39;-end. pBAC/F3KO is a derivative of pBAC/F3 that contains a silent point mutation (A9134&#8594;T, asterisk). pBAC/F4RO is a derivative of pBAC/F4 that contains an artificial Xba I run-off site downstream of the viral 3&#39;-end. (E) Assembly of a full-length SA14-14-2 BAC (pBAC/SA14-14-2). <a href="https://www.jove.com/files/ftp_upload/53164/53164fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/53164/53164fig2.jpg" /> 
Figure 2.&#160;Synthesis of four overlapping cDNA fragments (F1 to F4) spanning the full-length genomic RNA of JEV SA14-14-2. The four RT-PCR products are evaluated by electrophoresis in a 0.8% agarose gel. M, 1 kb DNA ladder. The expected sizes of the four cDNA fragments are indicated at the bottom of the gel image. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/53164/53164fig3.jpg" /> 
Figure 3.&#160;Purification of the BAC containing a full-length cDNA of JEV SA14-14-2. The BAC plasmid is isolated from E. coli DH10B by the SDS-alkaline lysis method and further purified by banding in a CsCl-EtBr gradient. Presented is an example of the CsCl-EtBr gradient using a 16 &#215; 76 mm sealable polypropylene tube. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/53164/53164fig4.jpg" /> 
Figure 4.&#160;Overview of the recovery of infectious viruses from a full-length JEV SA14-14-2 cDNA assembled in a BAC. (A) Linearization of the cDNA template. The full-length JEV BAC is cut with Xba I and treated with MBN. (B) Synthesis of the RNA transcripts. The linearized cDNA is transcribed by SP6 RNA polymerase in the presence of the m7G(5&#39;)ppp(5&#39;)A cap analog. (C) Recovery of the synthetic JEVs. The in vitro transcribed RNAs are transfected into BHK-21 cells by electroporation, which generates a high titer of synthetic virus. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/53164/53164fig5.jpg" /> 
Figure 5.&#160;Synthesis of the RNAs by in vitro transcription using a full-length JEV BAC as a cDNA template. (A) Generation of the linearized full-length JEV BAC, pBAC/SA14-14-2. Two independent clones of pBAC/SA14-14-2 (Cl.1 and Cl.2) are linearized by digestion with Xba I and subsequent treatment with MBN. The linearized BACs are examined by electrophoresis in a 0.8% agarose gel. (B) Production of the synthetic RNAs by run-off transcription. Each of the two linearized BACs is used as a template for SP6 RNA polymerase run-off transcription. Aliquots of the two transcription reactions are run on a 0.6% agarose gel. M, 1 kb DNA ladder. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" src="/files/ftp_upload/53164/53164fig6.jpg" /> 
Figure 6. Specific infectivity of the synthetic RNAs transcribed from a full-length JEV BAC and the recovery of synthetic virus. BHK-21 cells are mock-electroporated (Mock) or electroporated with the RNA transcripts derived from each of the two independent clones of the full-length JEV BAC (Cl.1 and Cl.2). (A) RNA infectivity. The cells are overlaid with agarose and stained with crystal violet at 4 days post-transfection. RNA infectivity is determined by infectious center assays to estimate the amount of infectious RNA electroporated into the cells (left panel). Also, representative images of infectious centers are shown (right panel). (B) Protein expression. The cells are cultured in 4-well chamber slides. Viral protein expression in RNA-electroporated cells at 20 hr post-transfection (hpt) is analyzed by immunofluorescence assays using a primary anti-NS1 rabbit antiserum and a secondary Cy3-conjugated goat anti-rabbit IgG (red). The nuclei are counterstained with 4&#39;,6-diamidino-2-phenylindole (blue). The immunofluorescence images are overlaid on their corresponding differential interference contrast images. (C) Virus yield. The cells are cultured in 150 mm culture dishes. The production of infectious virions accumulated in the culture supernatants of RNA-electroporated cells at 22 and 40 hpt is examined by plaque assays. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

Research

JoVE Journal

Immunology and Infection

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Genetic Manipulation in &Delta;ku80 Strains for Functional Genomic Analysis of Toxoplasma gondii

Genetic Manipulation in ÃƒÅ½Ã¢â‚¬Âku80 Strains for Functional Genomic Analysis of Toxoplasma gondii

Targeted genetic manipulation using homologous recombination is the method of choice for functional genomic analysis to obtain a detailed view of gene ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Electroporation of Functional Bacterial Effectors into Mammalian Cells

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...