Nós gostaríamos de homenagear o falecido Dr. Paul H. Patterson por suas contribuições para o progresso do modelo MIA, autismo e pesquisa da esquizofrenia. Nós reconhecemos Sarkis K. Mazmanian por seu grande apoio a este protocolo; Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni, e Leslie A. Neumann de assistência administrativa; Ali Khoshnan e Jan C. Ko para a assistência sobre as filmagens; Elaine Y. Hsiao e Natalia Malkova para os seus conselhos na indução MIA; Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandoval, e Natalie A. Verduzco para a sua criação de animais especialista. Este trabalho foi financiado pelo NIH Award Conte Center (NIH 5P50MH086383-04, de Paul H. Patterson); Autism Speaks (# 7670, a Paul H. Patterson); Fundação Simons (# 322839, com Sarkis K. Mazmanian); NIH Training Grant (NIH / NRSA T32GM07616 de K.-HC); Caltech Verão Graduação Research Fellowship (SURF) (para ZY); Amgen Scholars Programa no Caltech (para ZY); e pós-doutorado frConselho om National Science, Taiwan (NSC 101-2917-I-564-039, para W.-LW).

Todos os protocolos foram realizados sob a aprovação do California Institute of Comité Cuidados e Uso de Animais Institucional Tecnologia (IACUC). 1. Preparação para Pairs cronometrado-acasalamento <ol><li> Use pelo menos 6 barragens para experimentos comportamentais e 3 para análise da expressão gênica. NOTA: Use o dobro do número de ratos fêmeas estimados, já que apenas cerca de 50% dos ratos será conectado a partir da cronometrado-acasalamento. </li><li> Use ratos fêmea com nenhum gravidez antes e, 8-16 semanas de idade. NOTA: os ratos fêmeas que tenham exposição sexual antes de camundongos machos, mas não foram grávida são aceitáveis. </li><li> Casa a ratos fêmea juntos e colocar as gaiolas ao lado do outro, a fim de sincronizar o ciclo estral. Use uma gaiola de ratos padrão com uma altura de mais de 5,5 polegadas e um piso interior 75 polegada quadrada para permitir habitação de 5 ratos adultos. Etiquetar cada rato fêmea utilizando um soco orelha. </li></ol> 2. Configurando cronometrado-mating Pair <ol><li> Configure o cronometrado-acasalamento 0-2 horas antes do ciclo escuro começa. Coloque dois ratos fêmeas em cada gaiola. Retire os ratos e pesá-los individualmente. Registe o peso do corpo de cada ratinho fêmea. </li><li> Coloque um rato macho em cada gaiola com as duas fêmeas de camundongo. Use trio de acoplamento para minimizar o efeito paterno confundindo. </li></ol> 3. Vaginal bujão de verificação (E0.5) <ol><li> Verifique a fêmea ratos 0-4 horas após o ciclo escuro termina. Levante cuidadosamente o rato fêmea da base da cauda e permitir que o mouse para pegar a grade de arame, gaiola superior, ou a borda gaiola. </li><li> Procurar sinais de plugue vaginal: plugue vaginal é uma massa esbranquiçada visível na abertura vaginal. Se a ficha não é óbvio, insira suavemente uma ponteira 200 mL na abertura vaginal. Resistência de coagulação confirma formação de um tampão vaginal. Verifique o plugue vaginal uma vez por dia. NOTA: plugue Vaginal é apenas uma indicação de que a cópula ocorreu e, portanto, não ggravidez ARANTIA. rolhão vaginal podem ser difíceis de identificar, em determinadas estirpes de murganhos. Procure a ajuda de um cuidador ratos experiente para aumentar a precisão da identificação plugue. </li><li> Mova os ratos ligados a uma nova gaiola e grupo abrigá-los. Definir o dia da aparição plugue vaginal como embrionária 0,5 dia (E0.5). </li></ol> 4. Na E10.5-11.5, verificar se a gravidez <ol><li> Levante cuidadosamente a base da cauda e permitir que o mouse para pegar a grade de arame, gaiola superior, ou a borda gaiola. Observe a área do abdômen para verificar se há sinais de gravidez, por exemplo, uma protuberância no abdômen (Figura 1). NOTA: O sinal de gravidez é sempre mais óbvio à E11.5 do que em E10.5. </li><li> Pesar os ratinhos para verificar a gravidez. O ratinho grávida geralmente pesa cerca de 20% mais pesados ​​em E10.5 e 30% mais pesados ​​em E12.5 em comparação com um ratinho não grávidas (Figura 2). Única casa os ratos grávidas em gaiolas limpas. </li></ol> 5. 20 mg /kg de poli (I: C) Preparação <ol><li> Use pelo menos 6 barragens por grupo para experimentos comportamentais e 3 por grupo para análise de expressão de genes. Prepara-se o valor correspondente de poli (I: C). </li><li> Pesa-se o poli (I: C) de pó num tubo de 50 ml para fazer uma concentração final de 40 mg / ml. A fim de minimizar e padronizar o stress causado pelo volume de injecção, injectar 5 ul de poli (I: C) por cada grama de peso corporal do rato (5 mL / g, ou 5 ml / kg). Para induzir a MIA, que injectar 20 mg de poli (I: C) por kg. NOTA: A concentração de poli (I: C) é necessária (20 mg / kg) / (5 ml / kg) = 4 mg / ml. Uma vez que a poli (I: C) em pó contém 10% de poli (I: C), é necessário fazer uma concentração final de ml de poli (4 mg / ml) /0.1= 40 mg / (I: C). CUIDADO: O poli (I: C) em pó é muito leve. Tenha cuidado para não perder qualquer pó durante a transferência da espátula para o tubo cônico. </li><li> Adicionar o volume correspondente de cloreto de sódio a 0,9% (solução salina) para a banheira cónicae e fechar a tampa. Dissolve-se o pó por laminagem suavemente a gota de solução salina através da poli (I: C) de pó até a solução ficar clara. Centrifuga-se o tubo cónico a 800 xg durante 1 min (Figura 3C). Filtra-se o poli: solução por filtro de 0,22? M (I C). Transferir o poli: solução (I C) para um tubo de 1,5 ou 2 ml de microcentrífuga. Opcional: Use um espectrofotómetro para medir a razão entre o poli (I: C) 260/280 solução. Assegurar o rácio situa-se entre 1,54-1,82 (Figura 3) tal como descrito pelo fabricante. NOTA: A solução salina utilizada para dissolver o poli (I: C) em pó e servem como controlo de injecção deve ser de grau farmacêutico e estéril. </li></ol> 6. Saline ou poli (I: C) Injeção em E12.5 <ol><li> Pesar o rato na escala e colocá-lo de volta para a jaula. Utilize a seguinte fórmula para calcular o volume de injecção tanto para solução salina e poli (I: C) ratos: o peso corporal (g) multiplicados por 5 = volume de injecção desejado (ul). Use um insul 0,3 mlem seringa para elaborar o volume calculado de solução salina ou 20 mg / kg de poli (I: C), por exemplo, 150 mL de um rato 30 g. </li><li> Gentilmente pegar o mouse pela base da cauda e colocá-lo no topo da gaiola. Lidar com o mouse com cuidado para evitar efeitos de confusão induzida por stress. Inserir a agulha, bisel para cima, a aproximadamente 20 ° em relação ao rato para o centro dos seus dois bocais superiores (Figura 4), ​​e injectar o (I: C) solução salina ou solução de poli. NOTA: A agulha deve ser substituída para cada rato após a injeção. </li><li> Posicione o mouse de volta para sua gaiola. Coloque as gaiolas numa zona calma, de baixo sala de tráfego para evitar outros efeitos de confusão. </li></ol> 7. O Dia Depois de poli (I: C) Injeção (E13.5) <ol><li> Verificar os ratinhos injectados na manhã seguinte. Use uma escala para medir o peso corporal. NOTA: poli (I: C) injectados murganhos grávidas geralmente ganhar menos peso do que os murganhos injectados solução salina no dia após a injexão. </li><li> Não perturbe os ratos até que a prole nascem. </li></ol> 8. Medidor de MIA Offspring <ol><li> A fim de minimizar os efeitos de indução de MIA, siga as diretrizes listadas abaixo para medir o uso de MIA prole. <ol><li> Excluir as ninhadas de prematuro ou nascimento atrasado, ou se o tamanho da leitegada é menor do que 5. </li><li> Euthanize os filhotes excessivas de CO 2, se o tamanho da ninhada é maior do que 10. </li></ol></li></ol> 9. Opcional: Examine a resposta inflamatória aguda Após MIA <ol><li> Sacrificar a grávida ratos 3 horas após soro fisiológico ou poli (I: C) injecção utilizando o método descrito no protocolo aprovado-comité cuidados com os animais da instituição. NOTA: Deslocação cervical é muitas vezes preferido, uma vez que minimiza o efeito de CO drogas 2 / eutanásia sobre a barragem e do embrião. </li><li> Recolher o baço dos camundongos grávidas adultos e isolar a placenta e bra fetalno sob o microscópio estereoscópico. <ol><li> Para a coleta de baço, coloque o mouse sobre a placa de dissecação e pulverizar 70% de etanol na região abdominal dos ratos grávidas. Utilizar um par de tesouras estéreis para fazer um corte vertical, no centro da área abdominal abaixo da caixa torácica através da pele. </li><li> O baço fica no quadrante abdominal superior, esquerda. Use uma pinça para isolar o baço. Rolar o baço em limpadores tarefa delicada para remover o tecido adiposo em torno do órgão. Recolher cerca de 50 mg de tecido do baço e colocá-los individualmente em tubos de Eppendorf com 500 RNA ul estabilizar tampão ou TRIzol para evitar a degradação do ácido nucleico. Armazenar as amostras a -80 ° C até à sua utilização congelador. </li><li> Para a coleta de placenta, retire com cuidado os cornos uterinos do corpo. Coloque as trompas uterinas num prato de Petri cheio com solução salina tamponada com fosfato autoclavado (PBS) e deixar o prato em gelo. Use duas pinças para rasgar a parede uterina e expor o saco amniótico. <ol><li>Cuidadosamente usar a pinça para abrir o saco amniótico, sem danificar a placenta e o feto. Separa-se a placenta do feto e cortar o cordão umbilical tão perto quanto possível da placenta. Remover o saco amniótico detritos a partir da placenta. Coloque a placenta individualmente em tubos de Eppendorf com 500 ul de ARN estabilizar tampão ou Trizol. Armazenar a amostra a -80 ° C até à sua utilização congelador. </li></ol></li><li> Para a coleta de cérebro fetal, armazenar o feto no RNA estabilizar tampão do passo 9.2.2 até dissecção. Amole fora da membrana pial do ventrículo do cérebro utilizando fórceps delicados # 5 sob o microscópio estereoscópico. Remova cuidadosamente toda a membrana do cérebro fetal. Coloque os cérebros fetais individualmente em tubos de Eppendorf com 500 RNA ul estabilizar tampão ou TRIzol. Armazenar a amostra a -80 ° C até à sua utilização congelador. </li></ol></li><li> Extrai-se a ARN a partir do tecido e converter o ARN em ADNc. Analisar a expressão de genes IL6 no cDNA por real-time PCR. </li><li> Extrai-se a ARN dos tecidos, seguindo o protocolo de fabrico de TRIzol. Se os tecidos são armazenados no buffer de estabilização de ARN. Descongelar a amostra e girar o buffer. Transferir o tecido por ponta para outro eppendorf com 500 mL de TRIzol e continuar a extracção de ARN. </li><li> Utilizar um espectrofotómetro para determinar a concentração de, 260/280 e 260/230 razão do ARN. Certifique-se os índices são acima de 2,0. </li><li> Eliminar a contaminação de ADN do ARN por tratamento com ADNase I. mistura de 1 ug de ARN, 1 ul de tampão de reacção 10X, 1 ul de DNase isenta de RNase, e água isenta de nuclease para um volume final de 10 ul. Incubar a mistura principal a 37 ° C durante 30 min. Adicione 1 solução DNase parada ul para terminar a reacção. Incubar a mistura a 65 ° C durante 10 min. </li><li> Reverter transcrever o RNA para cDNA. Usar 20 reacções ul, e até 1 ug de ARN total por reacção. Misture 4 l de 5x tampão de transcrição reversa (RT) mistura de reacção, 1 ul reverse transcriptase, 11 ul de molde de ARN após tratamento com ADNase I e 4 ul livre de nuclease H2O para fazer uma solução final de 20 ul. Programar as condições termociclador para RT. Uma condição genérica incluem: Passo 1: 25 ° C durante 5 min; Passo 2: 42 ° C durante 30 min; Passo 3: 85 ° C durante 5 min; Passo 4: manter a 4 ° C. Dilui-se o ADNc de 5 vezes. Para armazenagem a curto prazo, armazenar o ADNc a 4 ° C. Para armazenamento a longo prazo, congelar o cDNA a -20 ° C. </li><li> Analisar a expressão do gene IL6 no cDNA por PCR em tempo real e normalizar a expressão do gene IL-6 para a p-actina a expressão do gene. <ol><li> Faça uma mistura mestre para IL6 e detecção de β-actina. Usar 25 ul de reacção, a mistura principal para cada gene inclui 12,5 uL da mistura de SYBR Verde, 0,5 ul de 10 mM iniciador directo, 0,5 ul de 10 pM e iniciador inverso 6,5 ul livre de nuclease H 2 O. </li><li> Coloque 5 jul 5x diluída cDNA umt o fundo do poço da placa de reacção óptica de 96 poços. Pipetar 20 ul de mistura principal para cada poço, para fazer uma de 25 uL finais mistura de PCR. Triplicado, cada gene para cada amostra. Selar a placa usando película adesiva óptica. Girar a placa a 800 xg durante 3 min a 4 ° C, utilizar o programa standard de PCR em tempo real: Passo 1: 50 ° C durante 2 min; Passo 2: 95 ° C durante 10 min; Passo 3: 40 ciclos de 95 ° C durante 15 segundos e a temperatura de 60 ° C durante 1 min. Adicionar uma etapa adicional para a curva de dissociação. </li></ol></li></ol> 10. Examine as anormalidades comportamentais em Offspring MIA Adulto (opcional): <ol><li> Execute os testes de comportamento nas idades de 8-12 semanas. Mudar a cama gaiola de pelo menos 3 dias antes do teste. Aclimatar os ratos ao ambiente de teste comportamental, pelo menos, 30 min antes do teste. </li><li> Para a inibição pré-pulso (PPI), restringir os ratos no cilindro de plexiglass com um sensor piezo-elétrico debaixo dela. Aclimatar os ratos ao PPIcâmara por 5 min. Expor os ratos com 6 ensaios de 120 dB de ruído branco (sobressalto). </li><li> Em seguida, expor os ratos com misturas randomizados de 14 ensaios de ruído de fundo, 14 ensaios de sobressalto, 14 ensaios de pré-pulso 5 dB (5 dB maior do que o ruído de fundo) + Startle (PPI5), e 14 ensaios de pré-pulso de 15 dB (15 dB mais elevados do que o ruído de fundo + Startle (PPI15). </li><li> Em média, a resposta de sobressalto para os primeiros 6 ensaios de 120 ensaios dB. Em média, a resposta de sobressalto para os outros estímulos individuais. Converter o valor para a inibição pré-pulso por (Startle - PPI5 ou PPI15) / Startle. </li><li> Para o teste de campo aberto, coloque o mouse no canto de uma arena praça aberta (50 x 50 x 50 cm 3). Grave a trajetória do rato durante 10 min através de uma câmera montada no teto. Definir o centro de como a zona central (17 x 17 cm2) na arena. Quantificar a distância percorrida, entradas de fuso centro, eo tempo passado na zona centro manualmente ou por software de análise automática baseada em imagem. </li&gt; <li> Para o teste de enterramento mármore, aclimatar o mouse para uma gaiola de teste com cinco centímetros de profundidade comprimido, roupas de cama de pinho, limpo Aspen para 10 min. Devolver o mouse para a sua homecage. Delicadamente, coloque 20 azul marinho 1,5 cm de diâmetro bolinhas de vidro na forma de 4 x 5 arranjo. Coloque o mouse de volta para a jaula de teste com berlindes para 10 min. Conte os mármores que tem sido enterrados no período de testes de 10 min. </li></ol> 11. Examine a neuropatologia cerebelar em Offspring MIA Adulto (opcional): <ol><li> Eutanásia do salina e MIA filhos adultos pelo anestésico. Perfundir o rato com 50 ml de PBS e, subsequentemente, 50 ml de 4% de paraformaldeído através do sistema cardiovascular. </li><li> Remover cuidadosamente o cérebro e pós- fixarem o cérebro em paraformaldeído a 4% durante a noite a 4 ° C. Lavar o cérebro com PBS três vezes, e armazenar o cérebro em PBS com 0,02% de azida de sódio num frigorífico a 4 ° C até à sua utilização. NOTA: O cérebro fixadas posteriormente pode ser armazenado em PBS com 0,02% de SODazida ium na geladeira por até um mês. </li><li> Seção do cérebro em 50 mm fatias finas sagital utilizando vibratome. Recolher as seções do cérebro usando um pincel macio. Terminar a actividade da peroxidase endógena por incubação das secções em peróxido de hidrogénio a 0,6% durante 30 min à temperatura ambiente. </li><li> Incubam-se as secções em anticorpo anti-calbindina diluído no tampão de bloqueio (soro de cabra a 10% com 0,1% de Triton X-100 e 0,02% de azida de sódio em PBS) durante a noite à temperatura ambiente. Em seguida, incubar as secções na correspondente anticorpo secundário biotinilado diluído em tampão de bloqueio durante 2 horas à temperatura ambiente. </li><li> Incubam-se as secções em DH avidina - peroxidase de tampão H complexo biotinilado para detectar a biotina, durante 1 h à temperatura ambiente. Desenvolver as secções utilizando o substrato de peroxidase para visualizar o antigénio. Lavam-se as secções com PBS três vezes entre os passos. Montar as secções em lâminas de microscópio. Imagem as seções sob o microscópio. </li></ol&gt;

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

The authors have nothing to disclose.

indução MIA em diferentes janelas de tempo perturba diferentes eventos de desenvolvimento cerebral em roedores e, consequentemente, leva a anomalias comportamentais diferentes e neuropatologias na prole. Aqui, descrevemos um protocolo para induzir MIA em camundongos com poli (I: C) injecção a E12.5. Este método de indução MIA leva a comportamental, neurológica, imunológico, e anomalias gastrointestinais associados com o autismo e esquizofrenia na prole 8,10,11,16. É importante notar que, porque MIA ...

O conceito de ativação imune materna (MIA) tem origem nos estudos epidemiológicos sobre a associação da infecção materna com autismo e esquizofrenia 1. Devido à ausência de agentes patogénicos virais detectáveis ​​se replicar na placenta ou do cérebro fetal após a infecção viral materna 2,3, o efeito da infecção sobre a descendência é a hipótese de ser causadas pela activação do sistema imune materno, em vez do que os próprios agentes patogénicos . Para elucidar a relação de causa e efeito entre MIA e distúrbios psiquiátricos, injecção de quimicamente sintetizados, viral mímico dupla polyinosinic ARN de cadeia: ácido polycytidylic (poli (I: C)) em roedores grávida tem sido amplamente utilizado como modelo animal para a MIA 4,5. Poli (I: C) é reconhecida pelo receptor? Toll-like 3 (TLR3), e a administração sistémica de poli (I: C) induz-viral como a resposta inflamatória aguda. Um dos mecanismos pelos quais a poli (I: C) PRoduces anomalias comportamentais e neuropatologias na prole é por causando um desequilíbrio de citocinas pró-inflamatórias e anti no eixo materno-placentária-fetal 6. Vários grupos adotaram o modelo MIA para compreender a etiologia dos transtornos psiquiátricos 7, e devido aos diversos interesses entre grupos de pesquisa, vários pontos de tempo de ativação imune têm sido utilizados para alcançar diferentes perturbações no desenvolvimento do cérebro e comportamentos 7. O laboratório Paul H. Patterson no Califórnia Institute of Technology adota a estratégia de injecção de poli (I: C) em murganhos grávidas no dia embrionário 12,5 (E12.5), que demonstrou com sucesso que a MIA é capaz de induzir comportamental, neurológica, e alterações imunológicas na descendência que estão associados com a esquizofrenia e autismo 8-11. Nossas obras anteriores mostram que MIA prole apresentar anomalias comportamentais (por exemplo, impairmen sociaist, défice de comunicação, comportamentos repetitivos, comportamento de ansiedade-like, e latente déficit de inibição 8,10,12), imune desregulação e citocinas desequilíbrio 8,13,14, alteração da expressão do gene do cérebro fetal 15, perda de células de Purkinje no lóbulo VII do cerebelo 11, alteração de propriedades sinápticas no hipocampo 9, gene x interação ambiente 13, alteração da permeabilidade do intestino e intestino composição da microbiota 16. Além disso, as estratégias terapêuticas e profiláticas são também desenvolvido a partir deste sistema modelo 13,16,17. Ao induzir MIA em E12.5, outros mostraram que MIA produz ativação fetal microglial e alteração de desenvolvimento colinérgicos no cérebro anterior basal 18, cepa específica de interacção 19, anormalidades ultra-estruturais do cérebro sinaptossomais cerebral, mitocondriais respiratórias anormalidades cadeia hiperfunção, o downregulation das moléculas sinaptossomais cerebrais 17 ,comportamentos de tipo depressivo, déficit cognitivo e do hipocampo potenciação de longa duração (LTP) e déficit de neurogênese adulta 20. Aqui, nós fornecemos um método detalhado de como induzir MIA em E12.5 por poli (I: C), bem como os paradigmas de como aplicar este modelo para estudar a etiologia da esquizofrenia e autismo. É importante notar que a MIA é um factor de risco para uma variedade de distúrbios 4, e os seus resultados são extremamente sensíveis ao tempo e método de indução, bem como a criação de barragens grávidas. Como tal, mesmo pequenas inconsistências entre laboratórios muitas vezes resultam em baixa reprodutibilidade e / ou diferentes fenótipos na descendência. Nosso método é projetado especificamente para os interessados ​​em estudar MIA como um fator de risco ambiental para o autismo e esquizofrenia, e a descrição detalhada fornecida irá ajudar os pesquisadores a melhorar a reprodutibilidade dos seus dados.

<table><tbody><tr><td>Polyinosinic&amp;ndash;polycytidylic acid potassium salt</td><td>SIGMA</td><td>P9582</td><td></td></tr><tr><td>0.9% sodium chloride INJ. USP</td><td>HOSPIRA</td><td>NDC 0409-4888-10</td><td></td></tr><tr><td>MONOJECT insuline syrinage 3/10 ml 29 G x 1/2&quot;</td><td>COVIDIEN</td><td>8881600145</td><td></td></tr><tr><td>50 ml conical screw cap tubes</td><td>USA SCIENTIFIC</td><td>1500-1211</td><td></td></tr><tr><td>Nanodrop 1000 spectrophotometer</td><td>THERMO SCIENTIFIC</td><td>1000</td><td>Optional</td></tr><tr><td>Stereomicroscope</td><td>Wild Heerbrugg</td><td>M5A</td><td>Optional</td></tr><tr><td>Dumont #5 Forceps Inox Tip Size .10 X .06 mm</td><td>Roboz</td><td>RS-5045</td><td>Optional</td></tr><tr><td>RNAlater RNA stabilization reagent</td><td>Qiagen</td><td>76104</td><td>Optional</td></tr><tr><td>TRIzol reagent</td><td>Life Technologies</td><td>15596-026&amp;nbsp;</td><td>Optional</td></tr><tr><td>RQ1 Rnase-free DNase</td><td>Promega</td><td>M610A</td><td>Optional</td></tr><tr><td>iScript cDNA synthesis kit</td><td>Bio-Rad</td><td>170-8891</td><td>Optional</td></tr><tr><td>FastStart universal SYBR green master mix with ROX&amp;nbsp;</td><td>Roche</td><td>4913922001</td><td>Optional</td></tr><tr><td>Real-time PCR</td><td>ABI</td><td>7300</td><td>Optional</td></tr><tr><td>Primer: Il6 forward</td><td>Life Technologies</td><td>TAGTCCTTCCTACCCCAATTTCC</td><td>Optional</td></tr><tr><td>Primer: Il6 Reverse</td><td>Life Technologies</td><td>TTGGTCCTTAGCCACTCCTTC</td><td>Optional</td></tr><tr><td>Primer: beta-actin forward</td><td>Life Technologies</td><td>AGAGGGAAATCGTGCGTGAC</td><td>Optional</td></tr><tr><td>Primer: beta-actin Reverse</td><td>Life Technologies</td><td>CAATAGTGATGACCTGGCCGT</td><td>Optional</td></tr><tr><td>MicroAmp optical 96-well reaction plate</td><td>Life Technologies</td><td>4306737</td><td>Optionl</td></tr><tr><td>MicroAmp optical adhesive film&amp;nbsp;</td><td>Life Technologies</td><td>4311971</td><td>Optionl</td></tr><tr><td>EthoVision</td><td>Noldus</td><td>EthoVision</td><td>Optionl</td></tr><tr><td>SR-LAB apparatus (PPI)</td><td>San Diego Instruments&amp;nbsp;</td><td>SR-LAB</td><td>Optionl</td></tr><tr><td>Marbles</td><td>PENN-PLAX</td><td>Blue gem stones marbles</td><td>Optionl</td></tr><tr><td>Dulbecco&#039;s Phosphate-Buffered Saline (DPBS)</td><td>Life Technologies</td><td>21600-069</td><td>Optionl</td></tr><tr><td>Paraformaldehyde</td><td>MACRON</td><td>2621-59</td><td>Optionl</td></tr><tr><td>Vibratome</td><td>Leica</td><td>VT1000 S</td><td>Optionl</td></tr><tr><td>Sodium azide</td><td>Sigma</td><td>S2002</td><td>Optionl</td></tr><tr><td>Triton x-100</td><td>Sigma</td><td>X100</td><td>Optionl</td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma</td><td>18312</td><td>Optionl</td></tr><tr><td>Goat serum</td><td>Vector Laboratories</td><td>S-1000</td><td>Optionl</td></tr><tr><td>Rabbit anti-calbindin antibody</td><td>Abcam</td><td>ab11426</td><td>Optionl</td></tr><tr><td>Biotinlyated goat anti-rabbit IgGantibody</td><td>Vector Laboratories</td><td>BA-1000</td><td>Optionl</td></tr><tr><td>VECTASTAIN ABC Kit</td><td>Vector Laboratories</td><td>PK-4000</td><td>Optionl</td></tr></tbody></table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

<html> A injecção de 20 mg / kg de poli (I: C) em E12.5 pode evocar uma resposta inflamatória aguda no eixo materno-fetal e placentário-precipitar um efeito crónico para o desenvolvimento do cérebro e fenótipos comportamentais 12,13. Os níveis elevados de uma citocina pró-inflamatória, interleucina (IL) -6, é um indicador fiável da resposta inflamatória aguda após MIA. O tempo de pico para a expressão do gene IL6 na placenta e no cérebro fetal é de 3 h...

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Indução de Maternal Immune Activation em Ratos na Fase Mid-gestação com Viral Mimic poli (I: C)

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

induction-maternal-immune-activation-mice-at-mid-gestation-stage-with

Research

JoVE Journal

Immunology and Infection

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

18.2K visualizações.  California Institute of Technology. Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Vídeo: Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

A Mouse Model of in Utero Transplantation

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus. For example, in utero transplantation (IUT) of hematopoietic stem cells has been used to successfully treat patients with severe combined immunodeficiency.1,2 In several other conditions, however, IUT has been attempted without success.3 Given these mixed results, the availability of an efficient non-human model to study the biological sequelae of stem cell transplantation and gene therapy is critical to advance this field. We and others have used the mouse model of IUT to study factors affecting successful engraftment of in utero transplanted hematopoietic stem cells in both wild-type mice4-7 and those with genetic diseases.8,9 The fetal environment also offers considerable advantages for the success of in utero gene therapy. For example, the delivery of adenoviral10, adeno-associated viral10, retroviral11, and lentiviral vectors12,13 into the fetus has resulted in the transduction of multiple organs distant from the site of injection with long-term gene expression. in utero gene therapy may therefore be considered as a possible treatment strategy for single gene disorders such as muscular dystrophy or cystic fibrosis. Another potential advantage of IUT is the ability to induce immune tolerance to a specific antigen. As seen in mice with hemophilia, the introduction of Factor IX early in development results in tolerance to this protein.14 
In addition to its use in investigating potential human therapies, the mouse model of IUT can be a powerful tool to study basic questions in developmental and stem cell biology. For example, one can deliver various small molecules to induce or inhibit specific gene expression at defined gestational stages and manipulate developmental pathways. The impact of these alterations can be assessed at various timepoints after the initial transplantation. Furthermore, one can transplant pluripotent or lineage specific progenitor cells into the fetal environment to study stem cell differentiation in a non-irradiated and unperturbed host environment.
The mouse model of IUT has already provided numerous insights within the fields of immunology, and developmental and stem cell biology. In this video-based protocol, we describe a step-by-step approach to performing IUT in mouse fetuses and outline the critical steps and potential pitfalls of this technique.

A Mouse Model of in Utero Transplantation

The mouse model of in utero transplantation is a versatile tool that can be used to study the potential clinical applications of stem cell transplantation and gene therapy in the fetus. In this protocol, we present a general approach to performing this technique

Um modelo do rato de No Utero Transplante

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus.  For example, in ...

Medicina

Assessment of Maternal Vascular Remodeling During Pregnancy in the Mouse Uterus

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the maternal circulation. The maternal uterine vasculature needs to adapt to this temporary demand and the success of this arterial remodeling process has implications for fetal growth. Cells of the maternal immune system, especially natural killer (NK) cells, play a critical role in this process. Here we describe a method to assess the degree of remodeling of maternal spiral arteries during mouse pregnancy. Hematoxylin and eosin-stained tissue sections are scanned and the size of the vessels analysed. As a complementary validation method, we also present a qualitative assessment for the success of the remodeling process by immunohistochemical detection of smooth muscle actin (SMA), which normally disappears from within the arterial vascular media at mid-gestation. Together, these methods enable determination of an important parameter of the pregnancy phenotype. These results can be combined with other endpoints of mouse pregnancy to provide insight into the mechanisms underlying pregnancy-related complications.

This protocol describes a technique to assess changes in the maternal vasculature during pregnancy in mice. Using stereological methods, remodeling of the decidual spiral arteries is assessed quantitatively and the results confirmed qualitatively using immunohistochemistry.

Avaliação do Maternal Vascular Reformas durante a gravidez no mouse Útero

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the ...

Biologia do Desenvolvimento

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening pathogen in immune-compromised individuals. Upon congenital or neonatal infection, the virus can infect and replicate in the developing brain, which may induce severe neurological damage, including deafness and mental retardation. Despite the potential severity of the symptoms, the therapeutic options are limited by the unavailability of a vaccine and the absence of a specific antiviral therapy. Furthermore, a precise description of the molecular events occurring during infection of the central nervous system (CNS) is still lacking since observations mostly derive from the autopsy of infected children. Several animal models, such as rhesus macaque CMV, have been developed and provided important insights into CMV pathogenesis in the CNS. However, despite its evolutionary proximity with humans, this model was limited by the intracranial inoculation procedure used to infect the animals and consistently induce CNS infection. Furthermore, ethical considerations have promoted the development of alternative models, among which neonatal infection of newborn mice with mouse cytomegalovirus (MCMV) has recently led to significant advances. For instance, it was reported that intraperitoneal injection of MCMV to Balb/c neonates leads to infection of neurons and glial cells in specific areas of the brain. These findings suggested that experimental inoculation of mice might recapitulate the deficits induced by HCMV infection in children. Nevertheless, a dynamic analysis of MCMV infection of neonates is difficult to perform because classical methodology requires the sacrifice of a significant number of animals at different time points to analyze the viral burden and/or immune-related parameters. To circumvent this bottleneck and to enable future investigations of rare mutant animals, we applied in vivo imaging technology to perform a time-course analysis of the viral dissemination in the brain upon peripheral injection of a recombinant MCMV expressing luciferase to C57Bl/6 neonates.

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV) infection of neonates represents an important cause of mental retardation, yet the molecular events leading to virus-induced pathogenesis are still poorly understood. To investigate the dynamics of brain infection, we adapted whole-animal in vivo imaging to perform time-course analysis of neonates infected with a luciferase-recombinant virus.

Utilização de<em&gt; In vivo</em&gt; Imagem para monitorar a progressão da infecção pelo citomegalovírus Experimental Rato em recém-nascidos

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening  pathogen in immune-compromised individuals. Upon congenital or neonatal  infection, the virus ...

Imunologia e Infecção

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. Conversely, viruses have evolved intricate strategies to evade and exploit host immune signaling for survival and propagation. Viral immune evasion, entailing host defense and viral evasion, provides one of the most fascinating and dynamic interfaces to discern the host-virus interaction. These studies advance our understanding in innate immune regulation and pave our way to develop novel antiviral therapies.
Murine &#947;HV68 is a natural pathogen of murine rodents. &#947;HV68 infection of mice provides a tractable small animal model to examine the antiviral response to human KSHV and EBV of which perturbation of in vivo virus-host interactions is not applicable. Here we describe a protocol to determine the antiviral cytokine production. This protocol can be adapted to other viruses and signaling pathways.
Recently, we have discovered that &#947;HV68 hijacks MAVS and IKK&#946;, key innate immune signaling components downstream of the cytosolic RIG-I and MDA5, to abrogate NF&#922;B activation and antiviral cytokine production. Specifically, &#947;HV68 infection activates IKK&#946; and that activated IKK&#946; phosphorylates RelA to accelerate RelA degradation. As such, &#947;HV68 efficiently uncouples NF&#922;B activation from its upstream activated IKK&#946;, negating antiviral cytokine gene expression. This study elucidates an intricate strategy whereby the upstream innate immune activation is intercepted by a viral pathogen to nullify the immediate downstream transcriptional activation and evade antiviral cytokine production.

We describe a protocol to measure the antiviral cytokine production in mice infected with a model herpesvirus, murine gamma herpesvirus 68 (&#947;HV68) that is closely-related to human Kaposi&#8217;s sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV). Utilizing genetically modified mouse strains and mouse embryonic fibroblasts (MEFs), we assessed the antiviral cytokine production both in vivo and ex vivo. &#8220;Reconstituting&#8221; the expression of innate immune components in knockout embryonic fibroblasts by lentiviral transduction, we further pinpoint specific innate immune molecules and dissect the key signaling events that differentially regulate the antiviral cytokine production.

Dissecando imunitário inatas Sinalização em Evasion Viral da produção de citocinas

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Mouse In Vivo Placental Targeted CRISPR Manipulation

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients and waste between the mother and fetus and the production and delivery of growth factors and hormones. Placental genetic manipulations in mice are critical for understanding the placenta's specific role in prenatal development. Placental-specific Cre-expressing transgenic mice have varying effectiveness, and other methods for placental gene manipulation can be useful alternatives. This paper describes a technique to directly alter placental gene expression using CRISPR gene manipulation, which can be used to modify the expression of targeted genes. Using a relatively advanced surgical approach, pregnant dams undergo a laparotomy on embryonic day 12.5 (E12.5), and a CRISPR plasmid is delivered by a glass micropipette into the individual placentas. The plasmid is immediately electroporated after each injection. After dam recovery, the placentas and embryos can continue development until assessment at a later time point. The evaluation of the placenta and offspring after the use of this technique can determine the role of time-specific placental function in development. This type of manipulation will allow for a better understanding of how placental genetics and function impact fetal growth and development in multiple disease contexts.

Mouse In Vivo Placental Targeted CRISPR Manipulation

Here we describe a time-specific method to effectively manipulate critical developmental pathways in the mouse placenta in vivo. This is performed through the injection and electroporation of CRISPR plasmids into the placentas of pregnant dams on embryonic day 12.5.

Mouse In Vivo Placental Alvo CRISPR Manipulação

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients ...

Genética

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing fetus. This tolerance is initiated during coitus, established during fecundation and implantation, and maintained throughout pregnancy. Active cellular and molecular mediators of maternal-fetal tolerance are enriched at the site of contact between fetal and maternal tissues, known as the maternal-fetal interface, which includes the placenta and the uterine and decidual tissues. This interface is comprised of stromal cells and infiltrating leukocytes, and their abundance and phenotypic characteristics change over the course of pregnancy. Infiltrating leukocytes at the maternal-fetal interface include neutrophils, macrophages, dendritic cells, mast cells, T cells, B cells, NK cells, and NKT cells that together create the local micro-environment that sustains pregnancy. An imbalance among these cells or any inappropriate alteration in their phenotypes is considered a mechanism of disease in pregnancy. Therefore, the study of leukocytes that infiltrate the maternal-fetal interface is essential in order to elucidate the immune mechanisms that lead to pregnancy-related complications. Described herein is a protocol that uses a combination of gentle mechanical dissociation followed by a robust enzymatic disaggregation with a proteolytic and collagenolytic enzymatic cocktail to isolate the infiltrating leukocytes from the murine tissues at the maternal-fetal interface. This protocol allows for the isolation of high numbers of viable leukocytes (&#62;70%) with sufficiently conserved antigenic and functional properties. Isolated leukocytes can then be analyzed by several techniques, including immunophenotyping, cell sorting, imaging, immunoblotting, mRNA expression, cell culture, and in vitro functional assays such as mixed leukocyte reactions, proliferation, or cytotoxicity assays.

Described herein is a protocol to isolate and analyze the infiltrating leukocytes of tissues at the maternal-fetal interface (uterus, decidua, and placenta) of mice. This protocol maintains the integrity of most cell surface markers and yields enough viable cells for downstream applications including flow cytometry analysis.

Isolamento de Leucócitos a partir de tecidos de murino na interface materno-fetal

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Intracerebroventricular and Intravascular Injection of Viral Particles and Fluorescent Microbeads into the Neonatal Brain

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the hematogenous route, which involves infection of the endothelial cells and pericytes of the brain. The second is the intracerebroventricular (ICV) route. Once within the central nervous system (CNS), viruses may spread to the subarachnoid space, meninges, and choroid plexus via the cerebrospinal fluid. In experimental models, the earliest stages of CNS viral distribution are not well characterized, and it is unclear whether only certain cells are initially infected. Here, we have analyzed the distribution of cytomegalovirus (CMV) particles during the acute phase of infection, termed primary viremia, following ICV or intravascular (IV) injection into the neonatal mouse brain. In the ICV injection model, 5 &#181;l of murine CMV (MCMV) or fluorescent microbeads were injected into the lateral ventricle at the midpoint between the ear and eye using a 10-&#181;l syringe with a 27 G needle. In the IV injection model, a 1-ml syringe with a 35 G needle was used. A transilluminator was used to visualize the superficial temporal (facial) vein of the neonatal mouse. We infused 50 &#181;l of MCMV or fluorescent microbeads into the superficial temporal vein. Brains were harvested at different time points post-injection. MCMV genomes were detected using the in situ hybridization method. Fluorescent microbeads or green fluorescent protein expressing recombinant MCMV particles were observed by fluorescent microscopy. These techniques can be applied to many other pathogens to investigate the pathogenesis of encephalitis.

Here, we describe a simple method of intracerebroventricular and intravascular injection of viral particles or fluorescent microbeads into the neonatal mouse brain. The localization pattern of the virus and nanoparticles could be detected by microscopic evaluation or by in situ hybridization.

Intracerebroventricular e intravascular A injeção de Viral partículas e fluorescentes microesferas no cérebro Neonatal

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the ...

Neurociência

C-section of Preclinical Animal Model of Chorioamnionitis Triggered by Group B Streptococcus (GBS)

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, termed chorioamnionitis. Chorioamnionitis exposes the developing fetus to a high risk of organ injuries, perinatal morbidity, and mortality, as well as life-long neurobehavioral impairments and other non-neurological developmental issues. The two most frequent subtypes of GBS isolates from maternal and fetal tissues are serotypes Ia (13%-23%) and III (25%-53%). Our lab has developed and characterized a rat model of GBS-induced chorioamnionitis to study subsequent impacts on the central nervous system of the developing fetus and to understand underlying mechanistic aspects. This article presents the design as well as uses of the preclinical rat model, which closely reproduces the hallmark of GBS-induced chorioamnionitis in humans. This article aims to help scientists reproduce the experimental design as well as to provide support through examples of troubleshooting. The present model may also contribute to potential discoveries through uncovering causes, mechanisms, and novel therapeutic avenues, which remain unsettled in many developmental impairments arising from chorioamnionitis. Furthermore, the use of this model may be extended to the studies of perinatal non-neurological common and severe morbidities affecting, for instance, the retina, bowel, lung, and kidney. The main interest of this research is in the field of GBS-induced fetal neurodevelopmental impairments such as cerebral palsy (CP), attention deficit hyperactivity disorder (ADHD), and autism spectrum disorder (ASD). The rationale supporting this model is presented in this article, followed by procedures and results.

C-section of Preclinical Animal Model of Chorioamnionitis Triggered by Group B Streptococcus GBS

The goal of this protocol is to describe a preclinical animal model of Group B Streptococcus (GBS)-induced chorioamnionitis. The study is designed to investigate mechanistic processes, potential causal links with developmental impairments, and finally to develop translational anti-inflammatory placento- and neuro-protective treatments.

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, ...

A Murine Model of Fetal Exposure to Maternal Inflammation to Study the Effects of Acute Chorioamnionitis on Newborn Intestinal Development

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing enterocolitis (NEC). However, a mechanistic link between these two conditions remains yet to be discovered. We have adopted a murine model of chorioamnionitis involving lipopolysaccharide (LPS)-induced fetal exposure to maternal inflammation (FEMI). This model of FEMI induces a sterile maternal, placental, and fetal inflammatory cascade, which is also present in many cases of clinical chorioamnionitis. Although models exist that utilize live bacteria and more accurately mimic the pathophysiology of an ascending infection resulting in chorioamnionitis, these methods may cause indirect effects on development of the immature intestinal tract and the associated developing microbiome. Using this protocol, we have demonstrated that LPS-induced FEMI results in a dose-dependent increase in pregnancy loss and preterm birth, as well as disruption of normal intestinal development in offspring. Further, we have demonstrated that FEMI significantly increases intestinal injury and serum cytokines in offspring, while simultaneously decreasing goblet and Paneth cells, both of which provide a first line of innate immunity against intestinal inflammation. Although a similar model of LPS-induced FEMI has been used to model the association between chorioamnionitis and subsequent abnormalities of the central nervous system, to our knowledge, this protocol is the first to attempt to elucidate a mechanistic link between chorioamnionitis and later perturbations in intestinal development as a potential link between chorioamnionitis and NEC.

We developed a model of chorioamnionitis to simulate fetal exposure to maternal inflammation (FEMI) without complications of live organisms to examine the effects of FEMI on development of the offspring&#8217;s intestinal tract. This allows for study of mechanistic causes for development of intestinal injury following chorioamnionitis.

Um modelo murino de exposição fetal à inflamação materna para estudar os efeitos da coioamnionite aguda no desenvolvimento intestinal recém-nascido

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing ...

Generating a Reproducible Model of Mid-Gestational Maternal Immune Activation using Poly(I:C) to Study Susceptibility and Resilience in Offspring

Maternal immune activation (MIA) during pregnancy is consistently linked to increased risk of neurodevelopmental and neuropsychiatric disorders in offspring. Animal models of MIA are used to test causality, investigate mechanisms, and develop diagnostics and treatments for these disorders. Despite their widespread use, many MIA models suffer from a lack of reproducibility and almost all ignore two important aspects of this risk factor: (i) many offspring are resilient to MIA, and (ii) susceptible offspring can exhibit distinct combinations of phenotypes. To increase reproducibility and model both susceptibility and resilience to MIA, the baseline immunoreactivity (BIR) of female mice before pregnancy is used to predict which pregnancies will result in either resilient offspring or offspring with defined behavioral and molecular abnormalities after exposure to MIA. Here, a detailed method of inducing MIA via intraperitoneal (i.p.) injection of the double stranded RNA (dsRNA) viral mimic poly(I:C) at 12.5 days of gestation is provided. This method induces an acute inflammatory response in the dam, which results in perturbations in brain development in mice that map onto similarly impacted domains in human psychiatric and neurodevelopmental disorders (NDDs).

Generating a Reproducible Model of Mid-Gestational Maternal Immune Activation using PolyI:C to Study Susceptibility and Resilience in Offspring

Maternal infection is a risk factor for neurodevelopmental disorders. Mouse models of maternal immune activation (MIA) may elucidate infection's impact on brain development and function. Here, general guidelines and a procedure are provided to produce reliably resilient and susceptible offspring exposed to MIA.

Gerando um Modelo Reprodutível de Ativação Imune Materna de Gestações Médias usando Poly(I:C) para Estudo de Suscetibilidade e Resiliência em Descendentes