Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma

Summary

Here, we describe a combined flow cytometric cell sorting and low-input, next-generation library construction protocol designed to produce high-quality, whole-exome data from the Hodgkin Reed-Sternberg (HRS) cells of classical Hodgkin lymphoma (CHL).

Abstract

The Hodgkin Reed-Sternberg cells of classical Hodgkin lymphoma are sparsely distributed within a background of inflammatory lymphocytes and typically comprise less than 1% of the tumor mass. Material derived from bulk tumor contains tumor content at a concentration insufficient for characterization. Therefore, fluorescence activated cell sorting using eight antibodies, as well as side- and forward-scatter, is described here as a method of rapidly separating and concentrating with high purity thousands of HRS cells from the tumor for subsequent study. At the same time, because standard protocols for exome sequencing typically require 100-1,000 ng of input DNA, which is often too high, even with flow sorting, we also provide an optimized, low-input library construction protocol capable of producing high-quality data from as little as 10 ng of input DNA. This combination is capable of producing next-generation libraries suitable for hybridization capture of whole-exome baits or more focused targeted panels, as desired. Exome sequencing of the HRS cells, when compared against healthy intratumor T or B cells, can identify somatic alterations, including mutations, insertions and deletions, and copy number alterations. These findings elucidate the molecular biology of HRS cells and may reveal avenues for targeted drug treatments.

Introduction

Advancements in cancer genomics as a result of next-generation sequencing have led to significant breakthroughs in the identification of therapeutic targets and in prognostication for many hematologic and non-hematologic neoplasms. New individualized treatment strategies based on specific genomic alterations are rapidly being introduced in many tumor types (reviewed in references^1,2). Despite significant progress in lymphoma genomics, the genome of the neoplastic HRS cells in classical Hodgkin lymphoma (CHL) had been underexplored. The investigations have been hampered by the scarcity of neoplastic HRS cells w....

Protocol

1. Tissue Processing and Freezing

1. Collect lymph node tissue in phosphate-buffered saline (PBS) or Roswell Park Memorial Institute medium (RPMI) and process within 24 h of collection. Transfer excised lymph node tissue⁹ to a Petri dish containing 10 mL of RPMI with 2% fetal calf serum (FCS) and finely mince it with a fresh scalpel blade. Use the back of a 10-mL syringe plunger to further grind/dissociate the tissue.
2. Transfer the liquid to a 50-mL conical tube through a 100
   .......

Discussion

Future applications or directions after mastering this technique

This work allows for exome sequencing from samples containing at least 10 ng of DNA. In the clinical context, this limit excludes most fine-needle aspiration samples due to insufficient material, but it includes adequate core biopsies and excisional biopsy samples. This will enable the acquisition of data from a larger set of possible samples.

Critical steps within the protocol.......

Materials

Name	Company	Catalog Number	Comments
Petri or Cell Culture Dish (sterile)
RPMI-1640 Media	Roswell Park Memorial Institute
Fetal Calf Serum (FCS), (heat inactivated)
Freezing Media (RPMI, 20% FCS, 10% dimethylsulfoxide (DMSO))-make fresh and keep sterile
RPMI with 2% FCS (make fresh or store for up to 1 month)
scalpel with fresh blade
10 ml syringe (no needle)
Cryogenic vials
50 ml conical centrifuge tubes, force
Centrifuge			capable of handling 50 ml conical centrifuge tubes and providing 400g
Hepes buffer(1M, cell culture grade)
phosphate buffered saline (PBS)
Pluoronic-F68	Thermo-Fisher	24040-032
DNAase-I	Sigma-Aldrich, St. Louis, MO	D4527-10KU	store as 5mg/ml in RPMI in -200C
Bovine Serum Albumin (BSA)
Sort Media (PBS+2%BSA+25mM HEPES+ Pluoronic –F68 (1X))
CD64-FITC (22)	Beckman Coulter, Miami, FL		20 uL suggested starting volume; Titering is suggested
CD30-PE (BerH83)	BD Biosciences, San Jose, CA		20 uL suggested starting volume; Titering is suggested
CD5-ECD (BL1a)	Beckman Coulter, Miami, FL		10 uL suggested starting volume; Titering is suggested
CD40-PerCP-eFluor 710 (1C10)	Ebiosciences, San Diego, CA		5 uL suggested starting volume; Titering is suggested
CD20-PC7 (B9E9)	Beckman Coulter, Miami, FL		10 uL suggested starting volume; Titering is suggested
CD15-APC (HI98)	BD Biosciences, San Jose, CA		20 uL suggested starting volume; Titering is suggested
CD45 APC-H7 (2D1)	BD Biosciences, San Jose, CA		Can be substituted with 10 uL suggested volume of CD45-Krome Orange (J.33, Beckman Coulter); Titering is suggested
CD95-Pacific Blue (DX2)	Life Technologies, Grand Island, NY		5 uL suggested starting volume; Titering is suggested
CD2 (5 μg; clone RPA-2.10)	Biolegend, San Diego, CA		For optional protocol; Titering is suggested
CD54 (10 μg; clone 84H10)	Serotec, Oxford, United Kingdom		For optional protocol; Titering is suggested
CD58 (10 μg; clone TS2/9)	eBioscience, San Diego, CA		For optional protocol; Titering is suggested
LFA-1 (12 μg; clone MHM23)	Novus Biologicals, Littleton, CO		For optional protocol; Titering is suggested
BD CS&T Beads	BD Biosciences, San Jose, CA
BD Accudrop Beads	BD Biosciences, San Jose, CA
BC Versa Comp antibody capture beads	Beckman Coulter, Miami, FL		Compensation Beads
BD-FACS ARIA special research order instrument using 5 lasers	BD Biosciences, San Jose, CA		any BD-FACS aria with capabilities to detect the fluorochromes in the antibody panel should be sufficient
Wizard	Promega	A2360
10 mM Tris-Cl buffer	NA
Qubit dsDNA HS Assay kit	Life Technologies, Carlsbad, CA
S2 Sonicator	Covaris, Woburn, MA		Alternatives may be substituted
microTUBE	Covaris, Woburn, MA
Low-Throughput Library Preparation Kit	Kapa Biosystems, Wilmington, MA	KK8221
Sybr Green	Sigma-Aldrich, St. Louis, MO	S9430
Agencourt AMPure XP Beads	Beckman Coulter, Miami, FL
Bioanalyzer	Agilent Technologies, Santa Clara, CA
SeqCap EZ Exome v.3.0	Roche Nimblegen	6465684001
HiSeq	Illumina
TruSeq-style Universal adapter	Integrated DNA Technologies (IDT), Coralville, Iowa		HPLC purification; AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T
TruSeq-style index adapter	Integrated DNA Technologies (IDT), Coralville, Iowa		HPLC purification; /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
TruSeq-style PCR primer 1	Integrated DNA Technologies (IDT), Coralville, Iowa		AATGATACGGCGACCACCGAGA
TruSeq-style PCR primer 2	Integrated DNA Technologies (IDT), Coralville, Iowa		CAAGCAGAAGACGGCATACGAG
Nuclease Free Duplex Buffer	Integrated DNA Technologies (IDT), Coralville, Iowa
BD FACSDIVA software	BD Biosciences, San Jose, CA
BD Falcon Tubes	BD Biosciences, San Jose, CA
BD Flow Tubes	BD Biosciences, San Jose, CA