JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Genetics

Flow-sorting and Exome Sequencing of the Reed-Sternberg Cells of Classical Hodgkin Lymphoma

Published: June 10th, 2017

DOI:

10.3791/54399

1Innovation Laboratory, Center for Molecular Oncology, Memorial Sloan Kettering Cancer Center, 2Flow-Sorting Core Facility, Weill Cornell Medical College, 3Department of Laboratory Medicine, University of Washington, 4Department of Physiology and Biophysics, Institute for Computational Biomedicine, Weill Cornell Medical College, 5Department of Pathology and Laboratory Medicine, Weill Cornell Medical College, 6Department of Laboratory Medicine, Memorial Sloan Kettering Cancer Center

Here, we describe a combined flow cytometric cell sorting and low-input, next-generation library construction protocol designed to produce high-quality, whole-exome data from the Hodgkin Reed-Sternberg (HRS) cells of classical Hodgkin lymphoma (CHL).

The Hodgkin Reed-Sternberg cells of classical Hodgkin lymphoma are sparsely distributed within a background of inflammatory lymphocytes and typically comprise less than 1% of the tumor mass. Material derived from bulk tumor contains tumor content at a concentration insufficient for characterization. Therefore, fluorescence activated cell sorting using eight antibodies, as well as side- and forward-scatter, is described here as a method of rapidly separating and concentrating with high purity thousands of HRS cells from the tumor for subsequent study. At the same time, because standard protocols for exome sequencing typically require 100-1,000 ng of input DNA, which is often too high, even with flow sorting, we also provide an optimized, low-input library construction protocol capable of producing high-quality data from as little as 10 ng of input DNA. This combination is capable of producing next-generation libraries suitable for hybridization capture of whole-exome baits or more focused targeted panels, as desired. Exome sequencing of the HRS cells, when compared against healthy intratumor T or B cells, can identify somatic alterations, including mutations, insertions and deletions, and copy number alterations. These findings elucidate the molecular biology of HRS cells and may reveal avenues for targeted drug treatments.

Advancements in cancer genomics as a result of next-generation sequencing have led to significant breakthroughs in the identification of therapeutic targets and in prognostication for many hematologic and non-hematologic neoplasms. New individualized treatment strategies based on specific genomic alterations are rapidly being introduced in many tumor types (reviewed in references1,2). Despite significant progress in lymphoma genomics, the genome of the neoplastic HRS cells in classical Hodgkin lymphoma (CHL) had been underexplored. The investigations have been hampered by the scarcity of neoplastic HRS cells w....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

1. Tissue Processing and Freezing

  1. Collect lymph node tissue in phosphate-buffered saline (PBS) or Roswell Park Memorial Institute medium (RPMI) and process within 24 h of collection. Transfer excised lymph node tissue9 to a Petri dish containing 10 mL of RPMI with 2% fetal calf serum (FCS) and finely mince it with a fresh scalpel blade. Use the back of a 10-mL syringe plunger to further grind/dissociate the tissue.
  2. Transfer the liquid to a 50-mL conical tube through a 100 .......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

A bioanalyzer plot should be taken after library amplification and 0.8x bead cleanup. One should see a "normal-like" distribution of fragment sizes in the desired range (Figure 2a). Deviations from this shape, such as a visible "shoulder" in the curve, indicate the presence of a high or low molecular weight artifact. For example, Figure 2b-2d shows examples of libraries containing visible artifact.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Future applications or directions after mastering this technique

This work allows for exome sequencing from samples containing at least 10 ng of DNA. In the clinical context, this limit excludes most fine-needle aspiration samples due to insufficient material, but it includes adequate core biopsies and excisional biopsy samples. This will enable the acquisition of data from a larger set of possible samples.

Critical steps within the protocol.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

The development of this project method was funded by the Department of Pathology and Laboratory Medicine of Weill Cornell Medical College. We acknowledge the Tri-Institutional Training Program in Computational Biology and Medicine for partial funding. We would like to thank the scientists who shared their time and knowledge with us, especially Maryke Appel; Dan Burgess; Iwanka Kozarewa; Chad Locklear; and everyone from the Weill Cornell Medical College Genomics Core Facility, including Jenny Zhang, Xiaobo (Shawn) Liang, Dong Xu, Wei Zhang, Huimin Shang, Tatiana Batson, and Tuo Zhang.

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
Petri or Cell Culture Dish (sterile)
RPMI-1640 Media Roswell Park Memorial Institute
Fetal Calf Serum (FCS), (heat inactivated)
Freezing Media (RPMI, 20% FCS, 10% dimethylsulfoxide (DMSO))-make fresh and keep sterile
RPMI with 2% FCS (make fresh or store for up to 1 month)
scalpel with fresh blade
10 ml syringe (no needle)
Cryogenic vials
50 ml conical centrifuge tubes, force
Centrifuge capable of handling 50 ml conical centrifuge tubes and providing 400g
Hepes buffer(1M, cell culture grade)
phosphate buffered saline (PBS)
Pluoronic-F68 Thermo-Fisher 24040-032
DNAase-I Sigma-Aldrich, St. Louis, MO D4527-10KU store as 5mg/ml in RPMI in -200C
Bovine Serum Albumin (BSA)
Sort Media (PBS+2%BSA+25mM HEPES+ Pluoronic –F68 (1X))
CD64-FITC (22) Beckman Coulter, Miami, FL 20 uL suggested starting volume; Titering is suggested
CD30-PE (BerH83) BD Biosciences, San Jose, CA 20 uL suggested starting volume; Titering is suggested
CD5-ECD (BL1a) Beckman Coulter, Miami, FL 10 uL suggested starting volume; Titering is suggested
CD40-PerCP-eFluor 710 (1C10) Ebiosciences, San Diego, CA 5 uL suggested starting volume; Titering is suggested
CD20-PC7 (B9E9) Beckman Coulter, Miami, FL 10 uL suggested starting volume; Titering is suggested
CD15-APC (HI98) BD Biosciences, San Jose, CA 20 uL suggested starting volume; Titering is suggested
CD45 APC-H7 (2D1) BD Biosciences, San Jose, CA Can be substituted with 10 uL suggested volume of CD45-Krome Orange (J.33, Beckman Coulter); Titering is suggested
CD95-Pacific Blue (DX2) Life Technologies, Grand Island, NY 5 uL suggested starting volume; Titering is suggested
CD2 (5 μg; clone RPA-2.10) Biolegend, San Diego, CA For optional protocol; Titering is suggested
CD54 (10 μg; clone 84H10) Serotec, Oxford, United Kingdom For optional protocol; Titering is suggested
CD58 (10 μg; clone TS2/9) eBioscience, San Diego, CA For optional protocol; Titering is suggested
LFA-1 (12 μg; clone MHM23) Novus Biologicals, Littleton, CO For optional protocol; Titering is suggested
BD CS&T Beads BD Biosciences, San Jose, CA
BD Accudrop Beads BD Biosciences, San Jose, CA
BC Versa Comp antibody capture beads Beckman Coulter, Miami, FL Compensation Beads
BD-FACS ARIA special research order instrument using 5 lasers BD Biosciences, San Jose, CA any BD-FACS aria with capabilities to detect the fluorochromes in the antibody panel should be sufficient
Wizard Promega A2360
10 mM Tris-Cl buffer NA
Qubit dsDNA HS Assay kit Life Technologies, Carlsbad, CA
S2 Sonicator Covaris, Woburn, MA Alternatives may be substituted
microTUBE Covaris, Woburn, MA
Low-Throughput Library Preparation Kit Kapa Biosystems, Wilmington, MA KK8221
Sybr Green Sigma-Aldrich, St. Louis, MO S9430
Agencourt AMPure XP Beads Beckman Coulter, Miami, FL
Bioanalyzer Agilent Technologies, Santa Clara, CA
SeqCap EZ Exome v.3.0 Roche Nimblegen 6465684001
HiSeq Illumina
TruSeq-style Universal adapter Integrated DNA Technologies (IDT), Coralville, Iowa HPLC purification; AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T
TruSeq-style index adapter Integrated DNA Technologies (IDT), Coralville, Iowa HPLC purification; /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
TruSeq-style PCR primer 1 Integrated DNA Technologies (IDT), Coralville, Iowa AATGATACGGCGACCACCGAGA
TruSeq-style PCR primer 2 Integrated DNA Technologies (IDT), Coralville, Iowa CAAGCAGAAGACGGCATACGAG
Nuclease Free Duplex Buffer Integrated DNA Technologies (IDT), Coralville, Iowa
BD FACSDIVA software BD Biosciences, San Jose, CA
BD Falcon Tubes BD Biosciences, San Jose, CA
BD Flow Tubes BD Biosciences, San Jose, CA

  1. Abrams, J. National Cancer Institute's Precision Medicine Initiatives for the new National Clinical Trials Network. American Society of Clinical Oncology educational book / ASCO. American Society of Clinical Oncology. Meeting. , 71-76 (2014).
  2. Gagan, J., Van Allen, E. M. Next-generation sequencing to guide cancer therapy. Genome medicine. 7, 80 (2015).
  3. Matsuki, E., Younes, A. Lymphomagenesis in Hodgkin lymphoma. Seminars in cancer biology. 34, 14-21 (2015).
  4. Fromm, J. R., Kussick, S. J., Wood, B. L. Identification and purification of classical Hodgkin cells from lymph nodes by flow cytometry and flow cytometric cell sorting. Am J Clin Pathol. 126 (5), 764-780 (2006).
  5. Fromm, J. R., Thomas, A., Wood, B. L. Flow cytometry can diagnose classical hodgkin lymphoma in lymph nodes with high sensitivity and specificity. Am J Clin Pathol. 131 (3), 322-332 (2009).
  6. Roshal, M., Wood, B. L., Fromm, J. R. Flow cytometric detection of the classical hodgkin lymphoma: clinical and research applications. Advances in hematology. 2011, 387034 (2011).
  7. Reichel, J., et al. Flow sorting and exome sequencing reveal the oncogenome of primary Hodgkin and Reed-Sternberg cells. Blood. 125 (7), 1061-1072 (2015).
  8. Kozarewa, I. A Modified Method for Whole Exome Resequencing from Minimal Amounts of Starting DNA. PLoS ONE. 7 (3), e32617 (2012).
  9. Brunicardi, F. C. . Schwartz's Principles of Surgery. , (2014).
  10. Kantor, A. B., Roederer, M. FACS analysis of leukocytes. Handbook of Experimental Immunology. 2, (1996).
  11. Sanders, M. E. Molecular pathways of adhesion in spontaneous rosetting of T-lymphocytes to the Hodgkin's cell line L428. Cancer Res. 48 (1), 37-40 (1988).
  12. Biosciences. . FACSAria II User's Guide. Part No. 644832, Revision A. , (2009).
  13. . Qubit 3.0 Fluorometer, Catalog Number Q33216 Available from: https://www.thermofisher.com/order/catalog/product/Q33216 (2017)
  14. Roche Nimblegen. . SeqCap EZ Library SR User's Guide ver. 4.1. , (2013).
  15. Li, H., Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 25 (14), 1754-1760 (2009).
  16. Li, H. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25 (16), 2078-2079 (2009).
  17. Saunders, C. T. Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs. Bioinformatics. 28 (14), 1811-1817 (2012).
  18. Cingolani, P., et al. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly (Austin). 6 (2), 80-92 (2012).
  19. Dobin, A. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 29 (1), 15-21 (2013).
  20. Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Briefings in bioinformatics. 14 (2), 178-192 (2013).
  21. . DNA copy number data analysis. v.R package version 1.34.0 Available from: https://omictools.com/dnacopy-tool (2013)

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved