A subscription to JoVE is required to view this content. Sign in or start your free trial.
Here, we describe a combined flow cytometric cell sorting and low-input, next-generation library construction protocol designed to produce high-quality, whole-exome data from the Hodgkin Reed-Sternberg (HRS) cells of classical Hodgkin lymphoma (CHL).
The Hodgkin Reed-Sternberg cells of classical Hodgkin lymphoma are sparsely distributed within a background of inflammatory lymphocytes and typically comprise less than 1% of the tumor mass. Material derived from bulk tumor contains tumor content at a concentration insufficient for characterization. Therefore, fluorescence activated cell sorting using eight antibodies, as well as side- and forward-scatter, is described here as a method of rapidly separating and concentrating with high purity thousands of HRS cells from the tumor for subsequent study. At the same time, because standard protocols for exome sequencing typically require 100-1,000 ng of input DNA, which is often too high, even with flow sorting, we also provide an optimized, low-input library construction protocol capable of producing high-quality data from as little as 10 ng of input DNA. This combination is capable of producing next-generation libraries suitable for hybridization capture of whole-exome baits or more focused targeted panels, as desired. Exome sequencing of the HRS cells, when compared against healthy intratumor T or B cells, can identify somatic alterations, including mutations, insertions and deletions, and copy number alterations. These findings elucidate the molecular biology of HRS cells and may reveal avenues for targeted drug treatments.
Advancements in cancer genomics as a result of next-generation sequencing have led to significant breakthroughs in the identification of therapeutic targets and in prognostication for many hematologic and non-hematologic neoplasms. New individualized treatment strategies based on specific genomic alterations are rapidly being introduced in many tumor types (reviewed in references1,2). Despite significant progress in lymphoma genomics, the genome of the neoplastic HRS cells in classical Hodgkin lymphoma (CHL) had been underexplored. The investigations have been hampered by the scarcity of neoplastic HRS cells w....
1. Tissue Processing and Freezing
A bioanalyzer plot should be taken after library amplification and 0.8x bead cleanup. One should see a "normal-like" distribution of fragment sizes in the desired range (Figure 2a). Deviations from this shape, such as a visible "shoulder" in the curve, indicate the presence of a high or low molecular weight artifact. For example, Figure 2b-2d shows examples of libraries containing visible artifact.......
Future applications or directions after mastering this technique
This work allows for exome sequencing from samples containing at least 10 ng of DNA. In the clinical context, this limit excludes most fine-needle aspiration samples due to insufficient material, but it includes adequate core biopsies and excisional biopsy samples. This will enable the acquisition of data from a larger set of possible samples.
Critical steps within the protocol.......
The authors have nothing to disclose.
The development of this project method was funded by the Department of Pathology and Laboratory Medicine of Weill Cornell Medical College. We acknowledge the Tri-Institutional Training Program in Computational Biology and Medicine for partial funding. We would like to thank the scientists who shared their time and knowledge with us, especially Maryke Appel; Dan Burgess; Iwanka Kozarewa; Chad Locklear; and everyone from the Weill Cornell Medical College Genomics Core Facility, including Jenny Zhang, Xiaobo (Shawn) Liang, Dong Xu, Wei Zhang, Huimin Shang, Tatiana Batson, and Tuo Zhang.
....Name | Company | Catalog Number | Comments |
Petri or Cell Culture Dish (sterile) | |||
RPMI-1640 Media | Roswell Park Memorial Institute | ||
Fetal Calf Serum (FCS), (heat inactivated) | |||
Freezing Media (RPMI, 20% FCS, 10% dimethylsulfoxide (DMSO))-make fresh and keep sterile | |||
RPMI with 2% FCS (make fresh or store for up to 1 month) | |||
scalpel with fresh blade | |||
10 ml syringe (no needle) | |||
Cryogenic vials | |||
50 ml conical centrifuge tubes, force | |||
Centrifuge | capable of handling 50 ml conical centrifuge tubes and providing 400g | ||
Hepes buffer(1M, cell culture grade) | |||
phosphate buffered saline (PBS) | |||
Pluoronic-F68 | Thermo-Fisher | 24040-032 | |
DNAase-I | Sigma-Aldrich, St. Louis, MO | D4527-10KU | store as 5mg/ml in RPMI in -200C |
Bovine Serum Albumin (BSA) | |||
Sort Media (PBS+2%BSA+25mM HEPES+ Pluoronic –F68 (1X)) | |||
CD64-FITC (22) | Beckman Coulter, Miami, FL | 20 uL suggested starting volume; Titering is suggested | |
CD30-PE (BerH83) | BD Biosciences, San Jose, CA | 20 uL suggested starting volume; Titering is suggested | |
CD5-ECD (BL1a) | Beckman Coulter, Miami, FL | 10 uL suggested starting volume; Titering is suggested | |
CD40-PerCP-eFluor 710 (1C10) | Ebiosciences, San Diego, CA | 5 uL suggested starting volume; Titering is suggested | |
CD20-PC7 (B9E9) | Beckman Coulter, Miami, FL | 10 uL suggested starting volume; Titering is suggested | |
CD15-APC (HI98) | BD Biosciences, San Jose, CA | 20 uL suggested starting volume; Titering is suggested | |
CD45 APC-H7 (2D1) | BD Biosciences, San Jose, CA | Can be substituted with 10 uL suggested volume of CD45-Krome Orange (J.33, Beckman Coulter); Titering is suggested | |
CD95-Pacific Blue (DX2) | Life Technologies, Grand Island, NY | 5 uL suggested starting volume; Titering is suggested | |
CD2 (5 μg; clone RPA-2.10) | Biolegend, San Diego, CA | For optional protocol; Titering is suggested | |
CD54 (10 μg; clone 84H10) | Serotec, Oxford, United Kingdom | For optional protocol; Titering is suggested | |
CD58 (10 μg; clone TS2/9) | eBioscience, San Diego, CA | For optional protocol; Titering is suggested | |
LFA-1 (12 μg; clone MHM23) | Novus Biologicals, Littleton, CO | For optional protocol; Titering is suggested | |
BD CS&T Beads | BD Biosciences, San Jose, CA | ||
BD Accudrop Beads | BD Biosciences, San Jose, CA | ||
BC Versa Comp antibody capture beads | Beckman Coulter, Miami, FL | Compensation Beads | |
BD-FACS ARIA special research order instrument using 5 lasers | BD Biosciences, San Jose, CA | any BD-FACS aria with capabilities to detect the fluorochromes in the antibody panel should be sufficient | |
Wizard | Promega | A2360 | |
10 mM Tris-Cl buffer | NA | ||
Qubit dsDNA HS Assay kit | Life Technologies, Carlsbad, CA | ||
S2 Sonicator | Covaris, Woburn, MA | Alternatives may be substituted | |
microTUBE | Covaris, Woburn, MA | ||
Low-Throughput Library Preparation Kit | Kapa Biosystems, Wilmington, MA | KK8221 | |
Sybr Green | Sigma-Aldrich, St. Louis, MO | S9430 | |
Agencourt AMPure XP Beads | Beckman Coulter, Miami, FL | ||
Bioanalyzer | Agilent Technologies, Santa Clara, CA | ||
SeqCap EZ Exome v.3.0 | Roche Nimblegen | 6465684001 | |
HiSeq | Illumina | ||
TruSeq-style Universal adapter | Integrated DNA Technologies (IDT), Coralville, Iowa | HPLC purification; AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T | |
TruSeq-style index adapter | Integrated DNA Technologies (IDT), Coralville, Iowa | HPLC purification; /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG | |
TruSeq-style PCR primer 1 | Integrated DNA Technologies (IDT), Coralville, Iowa | AATGATACGGCGACCACCGAGA | |
TruSeq-style PCR primer 2 | Integrated DNA Technologies (IDT), Coralville, Iowa | CAAGCAGAAGACGGCATACGAG | |
Nuclease Free Duplex Buffer | Integrated DNA Technologies (IDT), Coralville, Iowa | ||
BD FACSDIVA software | BD Biosciences, San Jose, CA | ||
BD Falcon Tubes | BD Biosciences, San Jose, CA | ||
BD Flow Tubes | BD Biosciences, San Jose, CA |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved