A subscription to JoVE is required to view this content. Sign in or start your free trial.
A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene
* These authors contributed equally
In This Article
Summary
An accurate and robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in the Fragile X mental retardation-1 gene facilitates molecular diagnosis and screening of Fragile X syndrome and Fragile X-related disorders with shorter turn-around time and investment in equipment.
Abstract
Fragile X syndrome (FXS) and associated disorders are caused by expansion of the cytosine-guanine-guanine (CGG) trinucleotide repeat in the 5’ untranslated region (UTR) of the Fragile X mental retardation-1 (FMR1) gene promoter. Conventionally, capillary electrophoresis fragment analysis on a genetic analyzer is used for the sizing of the CGG repeats of FMR1, but additional Southern blot analysis is required for exact measurement when the repeat number is higher than 200. Here, we present an accurate and robust polymerase chain reaction (PCR)-based method for quantification of the CGG repeats of FMR1. The first step of this test is PCR amplification of the repeat sequences in the 5’UTR of the FMR1 promoter using a Fragile X PCR kit, followed by purification of the PCR products and fragment sizing on a microfluidic capillary electrophoresis instrument, and subsequent interpretation of the number of CGG repeats by referencing standards with known repeats using the analysis software. This PCR-based assay is reproducible and capable of identifying the full range of CGG repeats of FMR1 promoters, including those with a repeat number of more than 200 (classified as full mutation), 55 to 200 (premutation), 46 to 54 (intermediate), and 10 to 45 (normal). It is a cost-effective method that facilitates classification of the FXS and Fragile X-associated disorders with robustness and rapid reporting time.
Introduction
Fragile X syndrome (FXS) and Fragile X associated disorders, e.g., tremor and ataxia syndrome (FX-TAS), and primary ovarian insufficiency (FX-POI) are mainly caused by cytosine-guanine-guanine (CGG) trinucleotide repeat expansion in the 5’ untranslated region (UTR) of the Fragile X mental retardation-1 (FMR1) gene on Xq27.31,2. The FMR1 encoded protein (FMRP) is a polyribosome-associated RNA-binding protein that functions in neuronal development and synaptic plasticity by regulating alternative splicing, stability, and dendritic transport of mRNA or modulating synthesis of partial posts....
Protocol
Ethical approval was granted by the Joint Chinese University of Hong Kong―New Territories East Cluster Clinical Research Ethics Committee (Reference Number: 2013.055)
1. PCR amplification
- Prior to starting, remove PCR buffer mix, sample diluent and DNA samples (both test and reference DNA) (see the Table of Materials) from the -20 °C freezer and keep them at room temperature for 20–30 min to make sure all reagents and DNA are fully thawed. Vortex a.......
Representative Results
The sizing results of the premutation female reference sample (NA20240, repeat sizes of 30 and 80) and the full mutation female reference sample (NA20239, repeat sizes of 20 and 200) are shown in Figure 1A and Figure 1B, respectively. Typically, two marker peaks (lower marker 50 base pairs [bp] and upper marker 10,380 bp) are included in the fragment size profile. There is usually a primer complex peak with a size of nearly 95 bp. Through the reference sample, a.......
Discussion
FXS is the second most common cause of intellectual impairment after trisomy 21, accounting for nearly one-half of X-linked mental retardation30, which may affect approximately 1 in 4,000 males and 1 in 8,000 females. More importantly, nearly 1 in 250–1,000 females carry a premutation, and this frequency is 1 in 250–1,600 in males26,31,32,33. Since the risk o.......
Acknowledgements
This research was supported by grants from NSFC Emergency Management Project (Grant No. 81741004), the National Natural Science Foundation of China (Grant No. 81860272), the Major Research Plan of the Provincial Science and Technology Foundation of Guangxi (Grant No. AB16380219), the China Postdoctoral Science Foundation Grant (Grant No. 2018M630993), and the Guangxi Natural Science Foundation (Grant No. 2018GXNSFAA281067).
....Materials
| Name | Company | Catalog Number | Comments |
| Agilent 2100 Bioanalyzer instrument: 0.2 mL PCR tubes | Axygen | PCR-02D-C | |
| Agilent 2100 Bioanalyzer instrument: 1X TE buffer, pH 8.0, Rnase-free | Ambion | AM9849 | |
| Agilent 2100 Bioanalyzer instrument: 2100 Bioanalyzer instrument | Agilent | G2939AA | |
| Agilent 2100 Bioanalyzer instrument: 96-well PCR Plate | Thermo Fisher | AB0800 | |
| Agilent 2100 Bioanalyzer instrument: Electrode cartridge | Agilent | Supplies equipment of the 2100 Bioanayzer instrument | |
| Agilent 2100 Bioanalyzer instrument: IKA vortex mixer | Agilent | Supplies equipment of the 2100 Bioanayzer instrument | |
| Agilent 2100 Bioanalyzer instrument: Sizing software 2100 Expert software | Agilent | Supplies equipment of the 2100 Bioanayzer instrument | |
| Agilent 2100 Bioanalyzer instrument: Test chips | Agilent | Supplies equipment of the 2100 Bioanayzer instrument | |
| Agilent DNA 7500 kit | Agilent | 5067-1506 | For Fragment sizing |
| Agilent DNA 7500 kit: DNA 7500 Ladder (yellow cap) | Agilent | In kit: Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: DNA 7500 Markers (green cap) | Agilent | In kit: Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: DNA chips | Agilent | In kit: Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: DNA Dye Concentrate (blue cap) | Agilent | In kit: Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: DNA Gel Matrix Vial (red cap) | Agilent | In kit: Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: Electrode Cleaner | Agilent | In kit: Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: Spin Filter | Agilent | Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: Syringe | Agilent | Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Chip priming station | Agilent | 5065-4401 | Supplies equipment of the 2100 Bioanayzer instrument |
| Cubee Mini-centrifuge | GeneReach | aqbd-i | |
| Filter plate vacuum Manifold: MultiScreenHTS Vacuum Manifold | Merck Millipore | MSVMHTS00 | Vacuum instrument for Filter plate vacuum Manifold for PCR product purification |
| Filter plate vacuum Manifold: Silicone stopper | Merck Millipore | XX2004718 | Filter plate vacuum Manifold |
| Filter plate vacuum Manifold: Vacuum pump | Merck Millipore | WP6122050 | Filter plate vacuum Manifold |
| Filter plate vacuum Manifold: Waste collection vessel | Merck Millipore | XX1004705 | Filter plate vacuum Manifold |
| FragilEase Fragile X PCR kit | PerkinElmer | 3101-0010 | For PCR amplification |
| FragilEase Fragile X PCR kit: Sample Diluent | PerkinElmer | In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ) | |
| FragilEase PCR Buffer mix | PerkinElmer | In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ), containing primers. Primer sequences: TCAGGCGCTCAGCTCCGTTTCGGTTTCA (forward) FAM-AAGCGCCATTGGAGCCCCGCACTTCC (reverse) | |
| FragilEase Polymerase | PerkinElmer | In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ) | |
| FraXsoft analysis software | PerkinElmer | ||
| NanoDrop ND-2000 Spectrophotometer | Thermo Fisher | ||
| Paper towels | |||
| PCR clean up plate: NucleoFast 96 PCR plate | MACHEREY-NAGEL | 743100 | |
| reference DNA sample | Coriell | NA20240 & NA20239 | |
| S1000 96-well Thermal Cycler | Bio-Rad | 1852196 | This can be replaced by other Thermal Cyclers (eg. Veriti™ 96-Well Thermal Cycler, Applied Biosystems, catalog number: 4375786) |
| TriNEST Incubator/Shaker instrument | PerkinElmer | 1296-0050 | |
| UltraPure DNase/RNase-Free Distilled Water | Life Technologies | 10977015 | For 2100 Bioanalyzer electrode cleaning |
| Vortex-Genie 2 | Scientific Industries | SI-0256 (Model G560E) | Conventional vortex mixer |
References
- Verkerk, A. J., et al. Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell. 65, 905-914 (1991).
- Fu, Y. H., et al.
This article has been published
Video Coming Soon
ABOUT JoVE
Copyright © 2024 MyJoVE Corporation. All rights reserved