A subscription to JoVE is required to view this content. Sign in or start your free trial.

In This Article

  • Summary
  • Abstract
  • Introduction
  • Protocol
  • Results
  • Discussion
  • Disclosures
  • Acknowledgements
  • Materials
  • References
  • Reprints and Permissions

Summary

An accurate and robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in the Fragile X mental retardation-1 gene facilitates molecular diagnosis and screening of Fragile X syndrome and Fragile X-related disorders with shorter turn-around time and investment in equipment.

Abstract

Fragile X syndrome (FXS) and associated disorders are caused by expansion of the cytosine-guanine-guanine (CGG) trinucleotide repeat in the 5’ untranslated region (UTR) of the Fragile X mental retardation-1 (FMR1) gene promoter. Conventionally, capillary electrophoresis fragment analysis on a genetic analyzer is used for the sizing of the CGG repeats of FMR1, but additional Southern blot analysis is required for exact measurement when the repeat number is higher than 200. Here, we present an accurate and robust polymerase chain reaction (PCR)-based method for quantification of the CGG repeats of FMR1. The first step of this test is PCR amplification of the repeat sequences in the 5’UTR of the FMR1 promoter using a Fragile X PCR kit, followed by purification of the PCR products and fragment sizing on a microfluidic capillary electrophoresis instrument, and subsequent interpretation of the number of CGG repeats by referencing standards with known repeats using the analysis software. This PCR-based assay is reproducible and capable of identifying the full range of CGG repeats of FMR1 promoters, including those with a repeat number of more than 200 (classified as full mutation), 55 to 200 (premutation), 46 to 54 (intermediate), and 10 to 45 (normal). It is a cost-effective method that facilitates classification of the FXS and Fragile X-associated disorders with robustness and rapid reporting time.

Introduction

Fragile X syndrome (FXS) and Fragile X associated disorders, e.g., tremor and ataxia syndrome (FX-TAS), and primary ovarian insufficiency (FX-POI) are mainly caused by cytosine-guanine-guanine (CGG) trinucleotide repeat expansion in the 5’ untranslated region (UTR) of the Fragile X mental retardation-1 (FMR1) gene on Xq27.31,2. The FMR1 encoded protein (FMRP) is a polyribosome-associated RNA-binding protein that functions in neuronal development and synaptic plasticity by regulating alternative splicing, stability, and dendritic transport of mRNA or modulating synthesis of partial posts....

Protocol

Ethical approval was granted by the Joint Chinese University of Hong Kong―New Territories East Cluster Clinical Research Ethics Committee (Reference Number: 2013.055)

1. PCR amplification

  1. Prior to starting, remove PCR buffer mix, sample diluent and DNA samples (both test and reference DNA) (see the Table of Materials) from the -20 °C freezer and keep them at room temperature for 20–30 min to make sure all reagents and DNA are fully thawed. Vortex and briefly spin down before use.
  2. Measure the concentration of the DNA samples using a spectrophotometer (see Table of Materials

Results

The sizing results of the premutation female reference sample (NA20240, repeat sizes of 30 and 80) and the full mutation female reference sample (NA20239, repeat sizes of 20 and 200) are shown in Figure 1A and Figure 1B, respectively. Typically, two marker peaks (lower marker 50 base pairs [bp] and upper marker 10,380 bp) are included in the fragment size profile. There is usually a primer complex peak with a size of nearly 95 bp. Through the reference sample, a.......

Discussion

FXS is the second most common cause of intellectual impairment after trisomy 21, accounting for nearly one-half of X-linked mental retardation30, which may affect approximately 1 in 4,000 males and 1 in 8,000 females. More importantly, nearly 1 in 250–1,000 females carry a premutation, and this frequency is 1 in 250–1,600 in males26,31,32,33. Since the risk o.......

Disclosures

The authors have nothing to disclose.

Acknowledgements

This research was supported by grants from NSFC Emergency Management Project (Grant No. 81741004), the National Natural Science Foundation of China (Grant No. 81860272), the Major Research Plan of the Provincial Science and Technology Foundation of Guangxi (Grant No. AB16380219), the China Postdoctoral Science Foundation Grant (Grant No. 2018M630993), and the Guangxi Natural Science Foundation (Grant No. 2018GXNSFAA281067).

....

Materials

NameCompanyCatalog NumberComments
Agilent 2100 Bioanalyzer instrument: 0.2 mL PCR tubesAxygenPCR-02D-C
Agilent 2100 Bioanalyzer instrument: 1X TE buffer, pH 8.0, Rnase-freeAmbionAM9849
Agilent 2100 Bioanalyzer instrument: 2100 Bioanalyzer instrumentAgilentG2939AA
Agilent 2100 Bioanalyzer instrument: 96-well PCR PlateThermo FisherAB0800
Agilent 2100 Bioanalyzer instrument: Electrode cartridgeAgilentSupplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: IKA vortex mixerAgilentSupplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: Sizing software 2100 Expert softwareAgilentSupplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: Test chipsAgilentSupplies equipment of the 2100 Bioanayzer instrument
Agilent DNA 7500 kitAgilent5067-1506For Fragment sizing
Agilent DNA 7500 kit: DNA 7500 Ladder (yellow cap)AgilentIn kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA 7500 Markers (green cap)AgilentIn kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA chipsAgilentIn kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA Dye Concentrate (blue cap)AgilentIn kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA Gel Matrix Vial (red cap)AgilentIn kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Electrode CleanerAgilentIn kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Spin FilterAgilentSupplies of Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: SyringeAgilentSupplies of Agilent DNA 7500 kit (catalog number: 5067-1506)
Chip priming stationAgilent5065-4401Supplies equipment of the 2100 Bioanayzer instrument
Cubee Mini-centrifugeGeneReachaqbd-i
Filter plate vacuum Manifold: MultiScreenHTS Vacuum ManifoldMerck MilliporeMSVMHTS00Vacuum instrument for Filter plate vacuum Manifold for PCR product purification
Filter plate vacuum Manifold: Silicone stopperMerck MilliporeXX2004718Filter plate vacuum Manifold
Filter plate vacuum Manifold: Vacuum pumpMerck MilliporeWP6122050Filter plate vacuum Manifold
Filter plate vacuum Manifold: Waste collection vesselMerck MilliporeXX1004705Filter plate vacuum Manifold
FragilEase Fragile X PCR kitPerkinElmer3101-0010For PCR amplification
FragilEase Fragile X PCR kit: Sample DiluentPerkinElmerIn kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )
FragilEase PCR Buffer mixPerkinElmerIn kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ), containing primers. Primer sequences: TCAGGCGCTCAGCTCCGTTTCGGTTTCA (forward)
FAM-AAGCGCCATTGGAGCCCCGCACTTCC (reverse)
FragilEase PolymerasePerkinElmerIn kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )
FraXsoft analysis softwarePerkinElmer
NanoDrop ND-2000 SpectrophotometerThermo Fisher
Paper towels
PCR clean up plate: NucleoFast 96 PCR plateMACHEREY-NAGEL743100
reference DNA sampleCoriellNA20240 & NA20239
S1000 96-well Thermal CyclerBio-Rad1852196This can be replaced by other Thermal Cyclers (eg. Veriti™ 96-Well Thermal Cycler, Applied Biosystems, catalog number: 4375786)
TriNEST Incubator/Shaker instrumentPerkinElmer1296-0050
UltraPure DNase/RNase-Free Distilled WaterLife Technologies10977015For 2100 Bioanalyzer electrode cleaning
Vortex-Genie 2Scientific IndustriesSI-0256 (Model G560E)Conventional vortex mixer

References

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Explore More Articles

Polymerase Chain ReactionPCR AssayFragile X SyndromeTrinucleotide RepeatsMolecular DiagnosisGenetic ScreeningFXS DisordersDNA Sample PreparationPCR Master MixThermocycler ProtocolTE BufferSample CleanupWeng ChuaPerkinElmer

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2025 MyJoVE Corporation. All rights reserved