A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene

Summary

An accurate and robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in the Fragile X mental retardation-1 gene facilitates molecular diagnosis and screening of Fragile X syndrome and Fragile X-related disorders with shorter turn-around time and investment in equipment.

Abstract

Fragile X syndrome (FXS) and associated disorders are caused by expansion of the cytosine-guanine-guanine (CGG) trinucleotide repeat in the 5’ untranslated region (UTR) of the Fragile X mental retardation-1 (FMR1) gene promoter. Conventionally, capillary electrophoresis fragment analysis on a genetic analyzer is used for the sizing of the CGG repeats of FMR1, but additional Southern blot analysis is required for exact measurement when the repeat number is higher than 200. Here, we present an accurate and robust polymerase chain reaction (PCR)-based method for quantification of the CGG repeats of FMR1. The first step of this test is PCR amplification of the repeat sequences in the 5’UTR of the FMR1 promoter using a Fragile X PCR kit, followed by purification of the PCR products and fragment sizing on a microfluidic capillary electrophoresis instrument, and subsequent interpretation of the number of CGG repeats by referencing standards with known repeats using the analysis software. This PCR-based assay is reproducible and capable of identifying the full range of CGG repeats of FMR1 promoters, including those with a repeat number of more than 200 (classified as full mutation), 55 to 200 (premutation), 46 to 54 (intermediate), and 10 to 45 (normal). It is a cost-effective method that facilitates classification of the FXS and Fragile X-associated disorders with robustness and rapid reporting time.

Introduction

Fragile X syndrome (FXS) and Fragile X associated disorders, e.g., tremor and ataxia syndrome (FX-TAS), and primary ovarian insufficiency (FX-POI) are mainly caused by cytosine-guanine-guanine (CGG) trinucleotide repeat expansion in the 5’ untranslated region (UTR) of the Fragile X mental retardation-1 (FMR1) gene on Xq27.3^1,2. The FMR1 encoded protein (FMRP) is a polyribosome-associated RNA-binding protein that functions in neuronal development and synaptic plasticity by regulating alternative splicing, stability, and dendritic transport of mRNA or modulating synthesis of partial postsynaptic proteins^3,4,5,6,7.

The dynamic variation with a CGG repeat size of >200 is described as full mutation, which induces the aberrant hypermethylation and subsequent transcriptional silencing of the FMR1 promoter⁸. The resulting absence or lack of the FMRP protein disrupts normal neuronal development and causes FXS⁹, characterized by various clinical symptoms, including moderate to severe intellectual disability, developmental delay, hyperactive behaviors, poor contacts and autistic manifestations^10,11,12. The presentation in female FXS patients is generally milder than that in males. The CGG repeat size ranging from 55 to 200 and 45 to 54 are classified as premutation and intermediate status, respectively. Due to the high degree of instability, the CGG repeat size in a premutation or intermediate allele presumably expands when transmitted from parents to offspring^13,14. Thus, carriers with premutation alleles are at high risk of having children affected with FXS because of the repeat expansion, and in some cases, intermediate alleles can expand their repeat size to the full mutation range over two generations^15,16. Furthermore, males with premutation also convey increased risk of developing late-onset FX-TAS^17,18,19, while premutation females are predisposed for both FX-TAS and FX-POI^20,21,22. Recently, it has been reported that autistic spectrum disorders with developmental delay and problems in social behaviors are presented in children with premutation FMR1 alleles^23,24.

To determine the exact CGG repeat size is of great significance for classification and prediction of the FXS and Fragile X-associated disorders^25,26. Historically, the CGG repeat region-specific polymerase chain reaction (PCR) with fragment sizing plus Southern blot analysis have been the gold standard for molecular profiling of the FMR1 CGG repeat²⁷. However, traditional specific PCR is less sensitive to large premutations with more than 100 to 130 repeats and is incapable of amplifying full mutations^27,28. Furthermore, capillary electrophoresis on a traditional genetic analyzer for repeat sizing fails to detect FMR1 PCR products with more than 200 CGG repeats. The Southern blot analysis enables differentiation of a wider range of repeat size, from normal to full mutation repeat numbers, and has been widely used for confirming full mutations (in males) and differentiating heterozygous alleles with a full mutation from apparently homozygous alleles with normal repeat sizes (in females). However, the resolution for quantifying the repeats is limited. More importantly, this step-by-step testing strategy is labor-intensive, time-consuming, and cost-ineffective.

Here, we present an accurate and robust PCR-based method for quantification of the CGG repeats of FMR1. The first step of this test is PCR amplification of the repeat sequences in the 5’UTR of the FMR1 promoter using Fragile X PCR kit. The PCR products are purified and fragment sizing is performed on a microfluidic capillary electrophoresis instrument, and subsequent interpretation of the number of CGG repeats using the analysis software by referencing standards with known repeats based on the rationale that PCR fragment length is directly proportional to the number of CGG repeats. The PCR system include reagents that facilitate the amplification of the highly GC-rich trinucleotide repeat region. This PCR-based assay is reproducible and capable of identifying all ranges of CGG repeats of FMR1 promoters. This is a cost-effective method that can find wide application in molecular diagnosis and screening of FXS and Fragile X-related disorders with less turn-around time and investment in equipment and thus, can be utilized in a broader spectrum of clinical laboratories.

Protocol

Ethical approval was granted by the Joint Chinese University of Hong Kong―New Territories East Cluster Clinical Research Ethics Committee (Reference Number: 2013.055)

1. PCR amplification

1. Prior to starting, remove PCR buffer mix, sample diluent and DNA samples (both test and reference DNA) (see the Table of Materials) from the -20 °C freezer and keep them at room temperature for 20–30 min to make sure all reagents and DNA are fully thawed. Vortex and briefly spin down before use.
2. Measure the concentration of the DNA samples using a spectrophotometer (see Table of Materials). The DNA concentration should be 25 ng/µL; dilute with sample diluent to the appropriate concentration if required.
   NOTE: The DNA should be extracted and purified to remove interfering substances, such as proteins and high salt concentrations. Non-degraded, high-quality DNA should be used for subsequent PCR amplification and analysis (A260/A280: 1.8–2.0 and A260/A230: >1.0).
3. Label wells of a PCR plate or 0.2 mL PCR tubes to identify reference and tested DNA samples.
4. Calculate the number of PCR reactions required for the test samples, 2 reference samples and negative control sample. Prepare PCR Master Mix by adding 15 µL of PCR buffer mix, 2.6 µL of sample diluent and 0.4 µL of polymerase for each reaction.
   NOTE: A negative control using sample diluent is essential to monitor the PCR performance. Prepare the PCR master mix at room temperature, do NOT pipette on ice. The PCR buffer mix is viscous. Mix the tube and then briefly spin down prior to use.
5. Vortex the PCR master mix from step 1.4 for 10–20 s and spin down. Slowly dispense 18 µL of the mixture into each well or tube.
6. Vortex and spin down the DNA samples. Pipette 2 µL of each DNA into the appropriate well or tube for a final PCR volume of 20 µL. Mix by pipetting up and down 5 times.
   NOTE: The total amount of DNA per reaction should be 50–100 ng. DNA amounts greater than 150 ng per 20 µL PCR reaction may result in a poor amplification of large repeat alleles. For lower concentrated DNAs, the amount of sample diluent in the PCR master mix can be replaced by DNA solution.
7. Seal the plate with adhesive plate sealer, or with tube caps.
8. Place the sealed PCR plate or tubes in the thermal cycler with heated lid. Run the program with the following settings: 95 °C for 5 min, followed by 25 cycles of denaturing at 98 °C for 35 s, annealing at 59 °C for 35 s, and extension at 72 °C for 4 min; a final step at 72 °C for 10 min. Hold the PCR products at 4 °C in the cycler until removal for further processing.
9. After PCR amplification, purify and analyze the products immediately, or store at +2 to +8 °C overnight. Alternatively, the product can be stored for up to 30 days at -30 to -16 °C.

2. Purification of the PCR Products

1. Preheat the incubator shaker to 65 °C.
2. For each PCR reaction, add 80 µL of 1x TE buffer (see the Table of Materials) to the 20 µL of each PCR product from section 1.
3. Transfer the sample mixture into a PCR clean-up plate (see Table of Materials) using a multichannel pipette.
4. Keep the plate uncovered and place it into the incubator shaker, and incubate at 65 °C while shaking at 1,200 rpm for 10 min.
5. After incubation, set the vacuum instrument at 250 mbar (or 25 kPa, 188 mmHg, 7.4 in Hg) and aspirate the solution through the filter for 15 min. Wells should have no liquid remaining.
6. Cool the incubator shaker down to 25 °C.
7. After the first aspiration, turn off the vacuum and add 50 µL of 1x TE buffer to each well. Do not mix. Aspirate the solution for 10 min using the vacuum settings in step 2.5.
8. Dry the bottom of the filter plate by pressing it firmly on a stack of paper towels.
9. Add 20 µL of 1x TE buffer into the bottom center of each well. Place the plate in the incubator shaker and incubate at 25 °C while shaking at 1,200 rpm for 5 min.
10. After incubation, transfer >15 µL of each purified PCR DNA from step 2.9 to a fresh 96-well PCR plate. The purified DNA can be analyzed directly, or alternatively can be stored at -30 to -16 °C until required.

3. Fragment Sizing of PCR Products

1. Prior to starting, allow DNA dye concentrate, DNA gel matrix, DNA marker, DNA ladder and purified DNA samples from step 2 to equilibrate to room temperature for 30 min.
2. Set up the priming station.
   1. Replace the syringe (see Table of Materials) when using a new batch of reagents.
   2. Adjust the base plate, and release the lever of the syringe clip and slide it up to the top position.
3. Start the sizing software (see Table of Materials) and prepare the gel-dye mix.
4. Vortex dye concentrate for 10 s and spin down. Add 25 μL of the dye to a gel matrix vial. Vortex the mixed solution well and spin down.
   1. Transfer the gel-dye mix to a spin filter. Place the spin filter in a microcentrifuge and spin for 10 min at room temperature at 1,500 x g ± 20%.
      NOTE: Protect the solution with dye from light and store at 4 °C after use. The gel-dye mix can be used for about 15 chips once prepared. Allow the gel-dye mix to equilibrate to room temperature for 30 min each time before use.
5. Load the gel-dye mix.
   1. Insert a new DNA chip on the priming station. Add 9 μL of gel-dye mix into the well marked with “G”. Please ensure the plunger is positioned at the 1 mL mark and then close the priming station.
   2. Press the syringe plunger down until it is held by the clip. Wait for exactly 30 s then release the clip. Wait for 5 s, and then slowly pull the plunger back to the 1 mL position.
   3. Open the priming station and add 9 μL of gel-dye mix into the wells marked with “G”.
6. Add 5 μL of marker into the well marked with the ladder symbol and also add 5 μL of marker into each of the 12 sample wells. Do not leave any wells empty.
7. Add 1 µL of DNA ladder into the well marked with the ladder symbol. Add 1 µL of PCR product (used wells) from step 3.1 or 1 µL of ultrapure water (unused wells) into each of the 12 sample wells. Put the chip horizontally in the adapter of vortex mixer and vortex for 1 min at the indicated setting (2,400 rpm).
8. Insert the chip in the bioanalyzer instrument and run the chip in the instrument within 5 min.
9. After the assay is complete, immediately remove the used chip from the instrument.
10. Slowly add 350 μL of deionized water into one of the wells of the electrode cleaner. Open the lid of the bioanalyzer and place the electrode cleaner into it. Close the lid and incubate for about 10 s. Open the lid and remove the electrode cleaner. Wait another 10 s to allow the water on the electrodes to evaporate and then close the lid.

4. Analyze the Fragment Sizing Results

NOTE: The reference samples should be amplified and analyzed by the same thermal cycler and bioanalyzer in the same batch with the unknown samples.

1. After the bioanalyzer run completes, export the peak data from each run as a .csv table file for subsequent analysis.
2. Start the analysis software and open the exported .csv peak table file from step 4.1.
3. Through the QC menu tab, review the regression line fitted to the four points (shown as blue diamonds on the plot) from the two reference samples. The R² value of the regression line should be >0.98 (typical values exceed 0.999).
4. Through the Results menu tab, check the repeat size of each sample whose fragment length(s) is automatically plotted against the linear regression standard curve derived from the reference samples. The software also provides the classification of each sample according to different guidelines.
5. Through the Export menu tab, export the result report for each sample with the repeat numbers and diagnostic classification, as well as a summary of sample information and QC report for each run.
   NOTE: Analysis software allows the use of custom classification guidelines, such as American College of Medical Genetics (ACMG) or Clinical Molecular Genetics Society/ European Society of Human Genetics (CMGS/ESHG) guidelines, as well as predefined classification criteria.

Results

The sizing results of the premutation female reference sample (NA20240, repeat sizes of 30 and 80) and the full mutation female reference sample (NA20239, repeat sizes of 20 and 200) are shown in Figure 1A and Figure 1B, respectively. Typically, two marker peaks (lower marker 50 base pairs [bp] and upper marker 10,380 bp) are included in the fragment size profile. There is usually a primer complex peak with a size of nearly 95 bp. Through the reference sample, a...

Discussion

FXS is the second most common cause of intellectual impairment after trisomy 21, accounting for nearly one-half of X-linked mental retardation³⁰, which may affect approximately 1 in 4,000 males and 1 in 8,000 females. More importantly, nearly 1 in 250–1,000 females carry a premutation, and this frequency is 1 in 250–1,600 in males^26,31,32,33. Since the risk o...

Materials

Name	Company	Catalog Number	Comments
Agilent 2100 Bioanalyzer instrument: 0.2 mL PCR tubes	Axygen	PCR-02D-C
Agilent 2100 Bioanalyzer instrument: 1X TE buffer, pH 8.0, Rnase-free	Ambion	AM9849
Agilent 2100 Bioanalyzer instrument: 2100 Bioanalyzer instrument	Agilent	G2939AA
Agilent 2100 Bioanalyzer instrument: 96-well PCR Plate	Thermo Fisher	AB0800
Agilent 2100 Bioanalyzer instrument: Electrode cartridge	Agilent		Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: IKA vortex mixer	Agilent		Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: Sizing software 2100 Expert software	Agilent		Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: Test chips	Agilent		Supplies equipment of the 2100 Bioanayzer instrument
Agilent DNA 7500 kit	Agilent	5067-1506	For Fragment sizing
Agilent DNA 7500 kit: DNA 7500 Ladder (yellow cap)	Agilent		In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA 7500 Markers (green cap)	Agilent		In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA chips	Agilent		In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA Dye Concentrate (blue cap)	Agilent		In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA Gel Matrix Vial (red cap)	Agilent		In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Electrode Cleaner	Agilent		In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Spin Filter	Agilent		Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Syringe	Agilent		Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)
Chip priming station	Agilent	5065-4401	Supplies equipment of the 2100 Bioanayzer instrument
Cubee Mini-centrifuge	GeneReach	aqbd-i
Filter plate vacuum Manifold: MultiScreenHTS Vacuum Manifold	Merck Millipore	MSVMHTS00	Vacuum instrument for Filter plate vacuum Manifold for PCR product purification
Filter plate vacuum Manifold: Silicone stopper	Merck Millipore	XX2004718	Filter plate vacuum Manifold
Filter plate vacuum Manifold: Vacuum pump	Merck Millipore	WP6122050	Filter plate vacuum Manifold
Filter plate vacuum Manifold: Waste collection vessel	Merck Millipore	XX1004705	Filter plate vacuum Manifold
FragilEase Fragile X PCR kit	PerkinElmer	3101-0010	For PCR amplification
FragilEase Fragile X PCR kit: Sample Diluent	PerkinElmer		In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )
FragilEase PCR Buffer mix	PerkinElmer		In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ), containing primers. Primer sequences: TCAGGCGCTCAGCTCCGTTTCGGTTTCA (forward) FAM-AAGCGCCATTGGAGCCCCGCACTTCC (reverse)
FragilEase Polymerase	PerkinElmer		In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )
FraXsoft analysis software	PerkinElmer
NanoDrop ND-2000 Spectrophotometer	Thermo Fisher
Paper towels
PCR clean up plate: NucleoFast 96 PCR plate	MACHEREY-NAGEL	743100
reference DNA sample	Coriell	NA20240 & NA20239
S1000 96-well Thermal Cycler	Bio-Rad	1852196	This can be replaced by other Thermal Cyclers (eg. Veriti™ 96-Well Thermal Cycler, Applied Biosystems, catalog number: 4375786)
TriNEST Incubator/Shaker instrument	PerkinElmer	1296-0050
UltraPure DNase/RNase-Free Distilled Water	Life Technologies	10977015	For 2100 Bioanalyzer electrode cleaning
Vortex-Genie 2	Scientific Industries	SI-0256 (Model G560E)	Conventional vortex mixer