A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene

Summary

An accurate and robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in the Fragile X mental retardation-1 gene facilitates molecular diagnosis and screening of Fragile X syndrome and Fragile X-related disorders with shorter turn-around time and investment in equipment.

Abstract

Fragile X syndrome (FXS) and associated disorders are caused by expansion of the cytosine-guanine-guanine (CGG) trinucleotide repeat in the 5’ untranslated region (UTR) of the Fragile X mental retardation-1 (FMR1) gene promoter. Conventionally, capillary electrophoresis fragment analysis on a genetic analyzer is used for the sizing of the CGG repeats of FMR1, but additional Southern blot analysis is required for exact measurement when the repeat number is higher than 200. Here, we present an accurate and robust polymerase chain reaction (PCR)-based method for quantification of the CGG repeats of FMR1. The first step of this test is PCR amplification of the repeat sequences in the 5’UTR of the FMR1 promoter using a Fragile X PCR kit, followed by purification of the PCR products and fragment sizing on a microfluidic capillary electrophoresis instrument, and subsequent interpretation of the number of CGG repeats by referencing standards with known repeats using the analysis software. This PCR-based assay is reproducible and capable of identifying the full range of CGG repeats of FMR1 promoters, including those with a repeat number of more than 200 (classified as full mutation), 55 to 200 (premutation), 46 to 54 (intermediate), and 10 to 45 (normal). It is a cost-effective method that facilitates classification of the FXS and Fragile X-associated disorders with robustness and rapid reporting time.

Introduction

Fragile X syndrome (FXS) and Fragile X associated disorders, e.g., tremor and ataxia syndrome (FX-TAS), and primary ovarian insufficiency (FX-POI) are mainly caused by cytosine-guanine-guanine (CGG) trinucleotide repeat expansion in the 5’ untranslated region (UTR) of the Fragile X mental retardation-1 (FMR1) gene on Xq27.3^1,2. The FMR1 encoded protein (FMRP) is a polyribosome-associated RNA-binding protein that functions in neuronal development and synaptic plasticity by regulating alternative splicing, stability, and dendritic transport of mRNA or modulating synthesis of partial posts....

Protocol

Ethical approval was granted by the Joint Chinese University of Hong Kong―New Territories East Cluster Clinical Research Ethics Committee (Reference Number: 2013.055)

1. PCR amplification

1. Prior to starting, remove PCR buffer mix, sample diluent and DNA samples (both test and reference DNA) (see the Table of Materials) from the -20 °C freezer and keep them at room temperature for 20–30 min to make sure all reagents and DNA are fully thawed. Vortex and briefly spin down before use.
2. Measure the concentration of the DNA samples using a spectrophotometer (see Table of Materials

Results

The sizing results of the premutation female reference sample (NA20240, repeat sizes of 30 and 80) and the full mutation female reference sample (NA20239, repeat sizes of 20 and 200) are shown in Figure 1A and Figure 1B, respectively. Typically, two marker peaks (lower marker 50 base pairs [bp] and upper marker 10,380 bp) are included in the fragment size profile. There is usually a primer complex peak with a size of nearly 95 bp. Through the reference sample, a.......

Discussion

FXS is the second most common cause of intellectual impairment after trisomy 21, accounting for nearly one-half of X-linked mental retardation³⁰, which may affect approximately 1 in 4,000 males and 1 in 8,000 females. More importantly, nearly 1 in 250–1,000 females carry a premutation, and this frequency is 1 in 250–1,600 in males^26,31,32,33. Since the risk o.......

Materials

Name	Company	Catalog Number	Comments
Agilent 2100 Bioanalyzer instrument: 0.2 mL PCR tubes	Axygen	PCR-02D-C
Agilent 2100 Bioanalyzer instrument: 1X TE buffer, pH 8.0, Rnase-free	Ambion	AM9849
Agilent 2100 Bioanalyzer instrument: 2100 Bioanalyzer instrument	Agilent	G2939AA
Agilent 2100 Bioanalyzer instrument: 96-well PCR Plate	Thermo Fisher	AB0800
Agilent 2100 Bioanalyzer instrument: Electrode cartridge	Agilent		Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: IKA vortex mixer	Agilent		Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: Sizing software 2100 Expert software	Agilent		Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: Test chips	Agilent		Supplies equipment of the 2100 Bioanayzer instrument
Agilent DNA 7500 kit	Agilent	5067-1506	For Fragment sizing
Agilent DNA 7500 kit: DNA 7500 Ladder (yellow cap)	Agilent		In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA 7500 Markers (green cap)	Agilent		In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA chips	Agilent		In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA Dye Concentrate (blue cap)	Agilent		In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA Gel Matrix Vial (red cap)	Agilent		In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Electrode Cleaner	Agilent		In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Spin Filter	Agilent		Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Syringe	Agilent		Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)
Chip priming station	Agilent	5065-4401	Supplies equipment of the 2100 Bioanayzer instrument
Cubee Mini-centrifuge	GeneReach	aqbd-i
Filter plate vacuum Manifold: MultiScreenHTS Vacuum Manifold	Merck Millipore	MSVMHTS00	Vacuum instrument for Filter plate vacuum Manifold for PCR product purification
Filter plate vacuum Manifold: Silicone stopper	Merck Millipore	XX2004718	Filter plate vacuum Manifold
Filter plate vacuum Manifold: Vacuum pump	Merck Millipore	WP6122050	Filter plate vacuum Manifold
Filter plate vacuum Manifold: Waste collection vessel	Merck Millipore	XX1004705	Filter plate vacuum Manifold
FragilEase Fragile X PCR kit	PerkinElmer	3101-0010	For PCR amplification
FragilEase Fragile X PCR kit: Sample Diluent	PerkinElmer		In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )
FragilEase PCR Buffer mix	PerkinElmer		In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ), containing primers. Primer sequences: TCAGGCGCTCAGCTCCGTTTCGGTTTCA (forward) FAM-AAGCGCCATTGGAGCCCCGCACTTCC (reverse)
FragilEase Polymerase	PerkinElmer		In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )
FraXsoft analysis software	PerkinElmer
NanoDrop ND-2000 Spectrophotometer	Thermo Fisher
Paper towels
PCR clean up plate: NucleoFast 96 PCR plate	MACHEREY-NAGEL	743100
reference DNA sample	Coriell	NA20240 & NA20239
S1000 96-well Thermal Cycler	Bio-Rad	1852196	This can be replaced by other Thermal Cyclers (eg. Veriti™ 96-Well Thermal Cycler, Applied Biosystems, catalog number: 4375786)
TriNEST Incubator/Shaker instrument	PerkinElmer	1296-0050
UltraPure DNase/RNase-Free Distilled Water	Life Technologies	10977015	For 2100 Bioanalyzer electrode cleaning
Vortex-Genie 2	Scientific Industries	SI-0256 (Model G560E)	Conventional vortex mixer