Multiomics Analysis of TMEM200A as a Pan-Cancer Biomarker

Summary

Here, a protocol is presented in which multiple bioinformatic tools are combined to study the biological functions of TMEM200A in cancer. In addition, we also experimentally validate the bioinformatics predictions.

Abstract

The transmembrane protein, TMEM200A, is known to be associated with human cancers and immune infiltration. Here, we assessed the function of TMEM200A in common cancers by multiomics analysis and used in vitro cell cultures of gastric cells to verify the results. The expression of TMEM200A in several human cancer types was assessed using the RNA-seq data from the UCSC Xena database. Bioinformatic analysis revealed a potential role of TMEM200A as a diagnostic and prognostic biomarker.

Cultures of normal gastric and cancer cell lines were grown and TMEM200A was knocked down. The expression levels of TMEM200A were measured by using quantitative real-time polymerase chain reaction and western blotting. In vitro loss-of-function studies were then used to determine the roles of TMEM200A in the malignant behavior and tumor formation of gastric cancer (GC) cells. Western blots were used to assess the effect of the knockdown on epithelial-mesenchymal transition (EMT) and PI3K/AKT signaling pathway in GC. Bioinformatic analysis showed that TMEM200A was expressed at high levels in GC.

The proliferation of GC cells was inhibited by TMEM200A knockdown, which also decreased vimentin, N-cadherin, and Snai proteins, and inhibited AKT phosphorylation. The PI3K/AKT signaling pathway also appeared to be involved in TMEM200A-mediated regulation of GC development. The results presented here suggest that TMEM200A regulates the tumor microenvironment by affecting the EMT. TMEM200A may also affect EMT through PI3K/AKT signaling, thus influencing the tumor microenvironment. Therefore, in pan-cancers, especially GC, TMEM200A may be a potential biomarker and oncogene.

Introduction

Cancer has emerged as a persistent public health issue endangering human health globally¹due to its high morbidity and mortality rates worldwide, posing a heavy financial and medical burden to society². Significant advancements in cancer therapy have been achieved in recent years thanks to the discovery of cancer markers³, and researchers have developed novel diagnostic methods and new drugs to treat cancer. However, some patients with cancer still have poor prognoses because of factors such as medication resistance, side effects of drugs, and chemical sensitivity⁴. Therefo....

Protocol

1. The Cancer Genome Atlas (TCGA) database

NOTE: The Cancer Genome Atlas (TCGA) database contains the sequencing data of genes in different tumor tissues¹⁴. RNA-seq data in TCGA for the study of TMEM200A transcripts per part per million (TPM) formats were extracted from the UCSC Xena website¹⁵ (https://xenabrowser. net/datapages/) and log2 transformed for comparing the expressions between .......

Discussion

TMEM200A belongs to a family of TMEMs that is essential for cancer cells to proliferate³⁸. The variable expression of TMEM200A in different malignancies has received less attention, and a thorough pan-cancer investigation is lacking. However, evidence continues to accumulate, showing that the TMEM transmembrane protein family may be important in keeping cancer cells malignant through interactions with several proteins, for example, activation of TMEM16A Ca²⁺-activated .......

Materials

Name	Company	Catalog Number	Comments
Anti-AKT antibody	Proteintech Group, Inc	60203-2-Ig
Anti-E-cadherin antibody	Proteintech Group, Inc	20874-1-AP
anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody	Proteintech Group, Inc	10494-1-AP
Anti-N-cadherin antibody	Proteintech Group, Inc	22018-1-AP
Anti-P-AKT antibody	Proteintech Group, Inc	66444-1-Ig
Anti-snail antibody	Proteintech Group, Inc	13099-1-AP
Anti-Vimentin antibody	Proteintech Group, Inc	10366-1-AP
AxyPrepMultisourceTotalRNAMini- prep Kit	Suzhou Youyi Landi Biotechnology Co., Ltd	UEL-UE-MN-MS-RNA-50G
BCA Protein Assay Kit	Epizyme Biotech	ZJ101L
CCK-8 reagent	MedChemExpress	HY-K0301-500T
Fetal bovine serum (FBS)	CYAGEN BIOSCIENCES (GUANGZHOU) INC	FBSSR-01021
GAPDH primer	Sangon Biotech (Shanghai) Co., Ltd.		Forward primer (5’-3’): TGACATCAAGAAGGTG GTGAAGCAG; Reverse primer (5’-3’): GTGTCGCTGTTGAAG TCAGAGGAG
HighGene plus Transfection reagent	ABclonal	RM09014P
HRP-conjugated Affinipure Goat Anti-Mouse lgG (H+L)	Proteintech Group, Inc	SA00001-1
HRP-conjugated Affinipure Goat Anti-Rabbit lgG (H+L)	Proteintech Group, Inc	SA00001-2
Human gastric mucosal epithelial GES-1 cells	Guangzhou Cellcook Biotech Co.,Ltd.
Human STAD HGC-27 cells	Procell Life Science&Technology Co.,Ltd
Human STAD SGC-7901 cells	Procell Life Science&Technology Co.,Ltd
MonAmp SYBR Green qPCR Mix (None ROX)	Mona (Suzhou) Biotechnology Co., Ltd	MQ10101S
MonScript RTIII All-in-One Mix with dsDNase	Mona (Suzhou) Biotechnology Co., Ltd	MR05101M
Omni-ECL Femto Light Chemiluminescence Kit	Epizyme Biotech	SQ201
PAGE Gel Fast Preparationb Kit	Epizyme Biotech	PG111
Penicillin-streptomycin (Pen-Strep)	Beijing Solarbio Science & Technology Co.,Ltd	P1400-100
Polyvinylidene difluoride (PVDF) membrane	Merck KGaA	IPVH00010-1
Protein Free Rapid Blocking Buffer	Epizyme Biotech	PS108P
RIPA lysis solution	Beijing Solarbio Science & Technology Co., Ltd	R0010
RPMI 1640 complete medium	Thermo Fisher Scientific	C11875500BT
Skimmed milk	Campina: Elk
TBST buffer solution	Beijing Solarbio Science & Technology Co., Ltd	T1082
The protein loading buffer	Epizyme Biotech	LT101S
TMEM200A knockdown plasmid	MiaoLing Plasmid
TMEM200A primer	Sangon Biotech (Shanghai) Co., Ltd.		Forward primer (5’-3’): AAGGCGGTGTGGTGGTTCG; Reverse primer (5’-3’): GATTTTGGTCTCTTTGTCACGGTT
TMEM200A SiRNA1	MiaoLing Plasmid		Forward primer (5’-3’): ACAACTGATGATAAGACCAG; Reverse primer (5’-3’): TGTTGACTACTATTCTGGTC
TMEM200A SiRNA2	MiaoLing Plasmid		Forward primer (5’-3’): CGTGTGAATGTCAATGACTG; Reverse primer (5’-3’): GCACACTTACAGTTACTGAC
TMEM200A SiRNA3	MiaoLing Plasmid		Forward primer (5’-3’): ACAACCACAACATCTGCCCG; Reverse primer (5’-3’): TGTTGGTGTTGTAGACGGGC
Transmembrane protein 200A Antibody	Proteintech Group, Inc	48081-1
Equipment
CO2 cell culture incubator	Haier Group	PYXE-80IR
Electrophoresis instrument	Bio-RAD
Fluorescence quantitative PCR instrument	Bio-RAD
Gel Imaging System (Tanon 5200)	Tanon Science & Technology Co., Ltd	LAB-0002-0007-SHTN
Multifunctional Enzyme Labeler	Berthold