T4 Bacteriophage and E. coli Interaction in the Murine Intestine: A Prototypical Model for Studying Host-Bacteriophage Dynamics In Vivo

Summary

Bacteriophages (phages), viruses that infect bacteria, are an integral component of the gut microbiome. Though these symbiotic inhabitants drive bacterial fitness and population dynamics, little is understood about how they impact gut homeostasis and disease. This protocol studies isolated T4 phages within a mouse model, adaptable to other phage-bacterial pairs.

Abstract

Bacteriophages (phages) are viruses that infect bacteria with species- and strain-level specificity and are the most abundant biological entities across all known ecosystems. Within bacterial communities, such as those found in the gut microbiota, phages are implicated in regulating microbiota population dynamics and driving bacterial evolution. There has been renewed interest in phage research in the last decade, in part due to the host-specific killing capabilities of lytic phages, which offer a promising tool to counter the increasing threat of antimicrobial resistant bacteria. Furthermore, recent studies demonstrating that phages adhere to intestinal mucus suggest they may have a protective role in preventing bacterial invasion into the underlying epithelium. Importantly, like bacterial microbiomes, disrupted phageomes have been associated with worsened outcomes in diseases such as inflammatory bowel disease. Previous studies have demonstrated that phages can modulate the microbiome of animals and humans through fecal filtrate transplants, benefiting the host's health. With this recent wave of research comes the necessity to establish and standardize protocols for studying phages in the context of the gut microbiome. This protocol provides a set of procedures to study isolated T4 phages and their bacterial host, Escherichia coli, in the context of the murine gastrointestinal tract. The methods described here outline how to start from a phage lysate, administer it to mice and assess effects on bacterial host and phage levels. This protocol can be modified and applied to other phage-bacterial pairs and provides a starting point for studying host-phage dynamics in vivo.

Introduction

Bacteriophages, or phages, are viruses that infect and kill bacteria with species and strain-level specificity¹. Phages play important roles within complex bacterial communities such as the gut microbiota, where they have been implicated in regulating population dynamics and driving bacterial fitness². Throughout the last decade, there has been renewed interest in phage research owing to the rise of antimicrobial resistant pathogens³, and the potential for phage therapy as an alternative treatment strategy. In recent years, lytic phage cocktails have been used intravenously with some success in se....

Protocol

All experiments were conducted in accordance with the guidelines established by the UBC Animal Care Committee and Biosafety Committee-approved protocols (A23-0113, B19-0038). Mice were housed at the University of British Columbia under pathogen-free conditions at the Center for Disease Modelling. C57BL/6 mice were bred within the facility in a sterile flexible film isolator, provided with sterile mouse diet, water, bedding, and nesting material. The mice were maintained on a 12 h day/night cycle. Experimental mice, both .......

Discussion

The study of phages in the microbiome presents a significant challenge compared to their bacterial counterparts. Specifically, phages do not contain a conserved phylogenetic marker common to all phages akin to the 16S and 18S ribosomal subunits that allow for the ease in sequencing and identification of prokaryotic and eukaryotic species, respectively⁴². However, with advances in next generation sequencing approaches, including increasing read lengths, throughput and decreasing costs, comes the ra.......

Materials

Name	Company	Catalog Number	Comments
1-octanol (99%)	Thermofisher	CAAAA15977-AP
50 ml PES Steriflip Sterile Disposable Vacuum Filter Units	Millipore Sigma	SCGP00525
Agarose (Low-EEO/Multi-Purpose/Molecular Biology Grade)	Fisher BioReagents	BP160-500
Amicon® 100kDa Ultra-15 centrifugal filter device, Ultracel-100	Millipore Sigma	UFC910008
BD Microtainer® Tubes, SST	BD Medical	365967
Bioexclusion airtight cages (ISO cages)	Techiplast	1245ISOCAGE
C1000 Touch™ Thermal Cycler with 96-Well Fast Reaction Module	BioRad	1851196
Calcium Chloride Dihydrate (White Crystals to Powder)	Fisher BioReagents	BP510-500
Cap Locks For 1.5ML Tube 100/pk	Andwin Scientific	16812612
Chloroform (Ethanol as Preservative/Certified ACS)	Fisher	C298-500
Copper coated steel beads (4.5 mm)	Crosman Corporation	0767
DNeasy Blood & Tissue Kit (50)	Thermo Scientific	69504
DreamTaq Green PCR Master Mix (2X)	Thermo Scientific	K1081
Ethylenediaminetetraacetic acid (EDTA) disodium salt solution, for molecular biology, 0.5 M in H2O	Sigma Aldrich	E7889
Fisher BioReagents™ Agar, Powder / Flakes, Fisher BioReagents™	Fisher Bioreagents	BP1423-500
Fisher BioReagents™ Microbiology Media: LB Broth (Powder) - Lennox	Fisher Bioreagents	BP1427-500
GeneRuler 100 bp DNA Ladder	Thermo Scientific	SM0241
Green FastMix® qPCR mix, 1250 rxns	QuantaBio	95072-012
HEPA filters for isocage lids, AUTOCLAVABLE H14 FILTERS FOR ISO LINE- IRRADIATED	Techiplast	UISOHEPAXTBOX-300
Magnesium sulfate heptahydrate	Fisher BioReagents	BP213-1
MaxQ 6000 Incubated Shaker	Thermo Scientific	8354-30-0009
Microbiology Media: LB Broth (Powder) - Lennox	Fisher BioReagents	BP1427-500
Microcentrifuge Tubes with Locking Snap Cap, 2ml	Fisher	14-666-315
Parafilm sealing film	Bemis	PM-996
Phage stocks	Carolina Biological Supply	n/a
PicoLab® Mouse Diet 20 EXT	LabDiet	5R58
Pierce™ Chromogenic Endotoxin Quant Kit	Thermo Scientific	A39552S
RNase A (17,500 U)	Qiagen	19101
RNase-free DNase Set	Qiagen	79254
Sodium Bicarbonate (Fine White Powder)	Fisher Chemical	BP328-500
Sodium Chloride (Crystalline/Certified ACS)	Fisher Chemical	S271
Sonicator (probe model CL-18; power source model FB50)	Fisher scentific	n/a
Sterile flexible film isolator	Class Biologically Clean	n/a
SYBR™ Safe DNA Gel Stain	Invitrogen	S33102
T100 Thermal Cycler	BioRad	1861096
T4 phage primer, forward (CCACACATAGCGCGAGTATAA)	IDT	n/a
T4 phage primer, forward (GAAACTCGGTCAGGCTATCAA)	IDT	n/a
TissueLyser II	Qiagen	85300
Tris-HCl, 1M Solution, pH 8.0, Molecular Biology Grade, Ultrapure	Thermo Scientific	AAJ22638AE
Water, (DNASE, RNASE free)	Fisher BioReagents	BP2484100