A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
Bacteriophages (phages), viruses that infect bacteria, are an integral component of the gut microbiome. Though these symbiotic inhabitants drive bacterial fitness and population dynamics, little is understood about how they impact gut homeostasis and disease. This protocol studies isolated T4 phages within a mouse model, adaptable to other phage-bacterial pairs.
Bacteriophages (phages) are viruses that infect bacteria with species- and strain-level specificity and are the most abundant biological entities across all known ecosystems. Within bacterial communities, such as those found in the gut microbiota, phages are implicated in regulating microbiota population dynamics and driving bacterial evolution. There has been renewed interest in phage research in the last decade, in part due to the host-specific killing capabilities of lytic phages, which offer a promising tool to counter the increasing threat of antimicrobial resistant bacteria. Furthermore, recent studies demonstrating that phages adhere to intestinal mucus suggest they may have a protective role in preventing bacterial invasion into the underlying epithelium. Importantly, like bacterial microbiomes, disrupted phageomes have been associated with worsened outcomes in diseases such as inflammatory bowel disease. Previous studies have demonstrated that phages can modulate the microbiome of animals and humans through fecal filtrate transplants, benefiting the host's health. With this recent wave of research comes the necessity to establish and standardize protocols for studying phages in the context of the gut microbiome. This protocol provides a set of procedures to study isolated T4 phages and their bacterial host, Escherichia coli, in the context of the murine gastrointestinal tract. The methods described here outline how to start from a phage lysate, administer it to mice and assess effects on bacterial host and phage levels. This protocol can be modified and applied to other phage-bacterial pairs and provides a starting point for studying host-phage dynamics in vivo.
Bacteriophages, or phages, are viruses that infect and kill bacteria with species and strain-level specificity1. Phages play important roles within complex bacterial communities such as the gut microbiota, where they have been implicated in regulating population dynamics and driving bacterial fitness2. Throughout the last decade, there has been renewed interest in phage research owing to the rise of antimicrobial resistant pathogens3, and the potential for phage therapy as an alternative treatment strategy. In recent years, lytic phage cocktails have been used intravenously with some success in serious, antibiotic-resistant bacterial septic infections in humans3,4. Oral phage therapy has also been proposed as a potential alternative to antibiotics to treat intestinal infections and inflammation. Furthermore, phages have been implicated in the success of fecal filtrate transplants (FFT), which are fecal microbiota preparations that have been filtered to remove bacteria, in the treatment of recurrent Clostridioides difficile infection (rCDI)5,6, inflammatory bowel disorders (IBD)7,8 and necrotizing enterocolitis in pre-term pigs9. Given these results, it is important to consider interactions both between phages and the gut microbiota, and phages and the mammalian host, as the addition of novel phages into a preexisting community may have indirect effects on the community as a whole, and not only its target bacteria2,10.
The study of phage interactions with their target bacteria in vitro has proven useful for understanding the mechanisms and impacts of phage and bacteria interactions in the gut. In this setting, it has been shown that Escherichia coli-specific T4 phages of the order Caudovirales require immunoglobulin (Ig)-like domains located within highly antigenic outer capsid (Hoc) proteins on the virion surface to adhere to intestinal mucus11. Additionally, transwell assays have shown that T4 phages are capable of interacting with epithelial cell cultures and translocating through cell layers by macropinocytosis12,13. These results support the hypothesis that phages can interact with their metazoan host, even though they are incapable of infecting eukaryotic cells. These models, while useful, lack the full range of complex interactions that occur in a gut ecosystem that are required for a comprehensive exploration of the tripartite interaction between phages, bacteria and the metazoan host.
Mouse models are an important tool for investigating phages within complex environments. A desirable application of phage administration is as an alternative strategy to treat antimicrobial resistant infections or pathobionts associated with chronic inflammatory diseases, including IBD. However, emerging literature suggests that phage behavior in vitro does not fully represent in vivo functions. Buttimer et al.14 demonstrated that a phage cocktail was able to deplete the targeted bacteria in a simplified human microbiota consortium in vitro, but could not be replicated in vivo in gnotobiotic mice colonized with the same bacteria-phage consortium. Furthermore, in a conventional mouse microbiome, T7 phage led to selective depletion of its target gut bacteria, although gradual recovery was observed over time, indicative of evolved resistance15. Other studies have demonstrated co-existence of orally administered phages and their target bacterial strains in vivo2,16. Indeed, beyond phage/bacteria co-existence, phage administration led to widespread changes in overall microbiota community composition and function2,16. This is relevant in disease settings as several studies have found associations between increased relative abundance of Caudovirales and IBD7,8,17 that were independent of changes in bacterial abundance7. It remains unknown whether this is a driver or consequence of disease pathogenesis.
The historic focus of phage investigation has been around the relationship between a phage and its target bacterium. However, it is also important to consider potential interactions between phage and the mucosa, epithelium, and immune system of the metazoan host. These interactions all play an important role in the overall response to intestinal phage infection. To demonstrate this, phages have been studied using germ-free (GF) mice to elucidate their impact on the immune system without interference by the microbiota8. In this system, phage nucleic acids were detected by Toll-like receptors (TLRs) located within endosomes of phagocytic immune cells (macrophages and dendritic cells). This activated downstream signaling and stimulated T cell dependent production of interferon (IFN)-γ8 or type I IFNs18. Moreover, Fluckiger et al.19 implicated memory CD8+ T cells in the recognition of phage-encoded (prophage) antigens, which resulted in T cell cross-reactivity with tumor antigens, resulting in reduced tumor burden. Finally, phage-specific antibody production has been documented in mouse studies where phages were delivered to animal models in a continual manner through drinking water8,20, or by repeated oral gavage over several months20, demonstrating the capacity for phage proteins to promote humoral immune responses. Although these modes of phage inoculation allow for optimal and continual priming of the immune system, they may not represent the naturally occurring interactions between phages and the intestinal environment, nor the kinetics of orally applied phage therapy. Thus far, a limited number of studies have examined the interactions of phage with a single bacterial species in monocolonized mouse models21. However, monocolonized mice proved critical in deciphering microbe-specific effects of individual species on gastrointestinal (GI) tract and immune development22,23,24, and they may yet prove useful in understanding tripartite interactions between phages, their target bacteria, and the metazoan host.
Excitingly, there is still much to learn about the interactions between intestinal phage and gut commensal bacteria, as well as the interactions that occur between the metazoan host and the phages that reside within it. This protocol provides a set of procedures to study isolated T4 phage and its bacterial counterpart, E. coli (K-12, BW25113), using a gnotobiotic mouse model. These standardized procedures also provide a foundation for optimizing other phage/bacteria dyads by adapting the growth parameters to the pairs of interest. The methods described here outline: (1) Preparation of T4 phage and vehicle lysates for oral gavage of mice; (2) Oral administration of T4 phage to E. coli monocolonized gnotobiotic mice; (3) Monitoring T4 phage levels in mouse feces and tissues over time.
For the representative results presented here, purified T4 phage lysates were propagated from phage bank stocks maintained by the Rohwer Lab. The Phage-on-Tap method for propagating T4 phage was adapted25, as referenced in this protocol. The method yields high titer, endotoxin-low phage stocks within three days. Utilizing this approach, 10 mL of ≥ 1010 plaque forming units (pfu)/mL of T4 phage with < 0.5 endotoxin units (EU)/mL were routinely collected. The recommended endotoxin levels for oral or intravenous administration into mice are ≤ 20 EU/mL and ≤ 5 EU/kg/h (or 0.1 EU administered over 1 h for a 20 g mouse), respectively, making this a suitable method of phage preparation for in vivo inoculation. All phage stocks were stored at 4 °C in saline magnesium (SM) phage buffer (recipe provided in step 1.1.5.1). E. coli was cultivated in LB media. For various phage-bacteria pairs, diverse culture media and growth conditions may be adapted from this protocol. Phages can also be sourced from the environment, such as wastewater, marine water, soil and intestinal contents and can be isolated and purified as per Sambrook and Russell26 prior to preparation using the appropriate growth and propagation conditions for each phage-host pair of interest25. Alternatively, phages can be obtained from commercial sources (see Table of Materials) or from phage banks.
Access restricted. Please log in or start a trial to view this content.
All experiments were conducted in accordance with the guidelines established by the UBC Animal Care Committee and Biosafety Committee-approved protocols (A23-0113, B19-0038). Mice were housed at the University of British Columbia under pathogen-free conditions at the Center for Disease Modelling. C57BL/6 mice were bred within the facility in a sterile flexible film isolator, provided with sterile mouse diet, water, bedding, and nesting material. The mice were maintained on a 12 h day/night cycle. Experimental mice, both male and female, were age-matched within each experiment, ranging between 6 to 12 weeks of age and weighing 15-30 g for all experiments.
1. Preparation of phage and vehicle lysates for oral gavage into mice
2. Administration and monitoring of T4 phage in E. coli monocolonized mice
3. Monitoring T4 phage levels in vivo
NOTE: Once mice have been inoculated with phage, the concentration of both phages and target bacteria can be measured in fecal or tissue samples. This provides information on the kinetics of the phage infection and colonization dynamics of both organisms.
Access restricted. Please log in or start a trial to view this content.
To investigate the interactions between the T4 phage/E. coli dyad in the murine intestine, T4 phage and vehicle lysates were prepared, cleaned, and purified (Figure 1A). T4 phage lysates were titered by plaque assay and diluted to 2 x 107 pfu/mL (2 x 106 pfu/mouse) in SM buffer. Vehicle lysates were also titered to confirm no viable phage presence and diluted in the same volume of SM buffer as the T4 phage lysate. Endotoxin levels were quantified in diluted lys...
Access restricted. Please log in or start a trial to view this content.
The study of phages in the microbiome presents a significant challenge compared to their bacterial counterparts. Specifically, phages do not contain a conserved phylogenetic marker common to all phages akin to the 16S and 18S ribosomal subunits that allow for the ease in sequencing and identification of prokaryotic and eukaryotic species, respectively42. However, with advances in next generation sequencing approaches, including increasing read lengths, throughput and decreasing costs, comes the ra...
Access restricted. Please log in or start a trial to view this content.
The authors have nothing to disclose.
The authors acknowledge that the land they performed this research on is the traditional, ancestral, and unceded territory of the xwməθkwəy̓əm (Musqueam) Nation. The land it is situated on has always been a place of learning for the Musqueam people, who for millennia have passed on in their culture, history, and traditions from one generation to the next on this site. We encourage others to learn more about the native lands in which they live and work at https://native-land.ca. The authors acknowledge support from the Natural Sciences and Engineering Council of Canada (NSERC) Canadian Graduate Scholarships - Master's (N.P.), Michael Smith Health Research BC Trainee Award (RT-2023-3174, to MH), Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery Grants Program (RGPIN-2019-04591 to C.T., RGPIN-2016-04282 to LCO), Canadian Institute for Advanced Research / Humans and the Microbiome (FL-001253 Appt 3362, to C.T.), Michael Smith Foundation for Health Research Scholar Award (18239, to C.T.), Canadian Institutes for Health Research (PJT-159458 to LCO) and the Canadian Foundation for Innovation (34673 to LCO and 38277 to CT). We are grateful for technical support from the UBC Centre for Disease Modelling and ubcFLOW, which is supported by the UBC GREx Biological Resilience Initiative, and to members of the Osborne and Tropini labs for critical discussions and evaluation of the manuscript. Figure 1A and Figure 2A were created using Biorender.com.
Access restricted. Please log in or start a trial to view this content.
Name | Company | Catalog Number | Comments |
1-octanol (99%) | Thermofisher | CAAAA15977-AP | |
50 ml PES Steriflip Sterile Disposable Vacuum Filter Units | Millipore Sigma | SCGP00525 | |
Agarose (Low-EEO/Multi-Purpose/Molecular Biology Grade) | Fisher BioReagents | BP160-500 | |
Amicon® 100kDa Ultra-15 centrifugal filter device, Ultracel-100 | Millipore Sigma | UFC910008 | |
BD Microtainer® Tubes, SST | BD Medical | 365967 | |
Bioexclusion airtight cages (ISO cages) | Techiplast | 1245ISOCAGE | |
C1000 Touch™ Thermal Cycler with 96-Well Fast Reaction Module | BioRad | 1851196 | |
Calcium Chloride Dihydrate (White Crystals to Powder) | Fisher BioReagents | BP510-500 | |
Cap Locks For 1.5ML Tube 100/pk | Andwin Scientific | 16812612 | |
Chloroform (Ethanol as Preservative/Certified ACS) | Fisher | C298-500 | |
Copper coated steel beads (4.5 mm) | Crosman Corporation | 0767 | |
DNeasy Blood & Tissue Kit (50) | Thermo Scientific | 69504 | |
DreamTaq Green PCR Master Mix (2X) | Thermo Scientific | K1081 | |
Ethylenediaminetetraacetic acid (EDTA) disodium salt solution, for molecular biology, 0.5 M in H2O | Sigma Aldrich | E7889 | |
Fisher BioReagents™ Agar, Powder / Flakes, Fisher BioReagents™ | Fisher Bioreagents | BP1423-500 | |
Fisher BioReagents™ Microbiology Media: LB Broth (Powder) - Lennox | Fisher Bioreagents | BP1427-500 | |
GeneRuler 100 bp DNA Ladder | Thermo Scientific | SM0241 | |
Green FastMix® qPCR mix, 1250 rxns | QuantaBio | 95072-012 | |
HEPA filters for isocage lids, AUTOCLAVABLE H14 FILTERS FOR ISO LINE- IRRADIATED | Techiplast | UISOHEPAXTBOX-300 | |
Magnesium sulfate heptahydrate | Fisher BioReagents | BP213-1 | |
MaxQ 6000 Incubated Shaker | Thermo Scientific | 8354-30-0009 | |
Microbiology Media: LB Broth (Powder) - Lennox | Fisher BioReagents | BP1427-500 | |
Microcentrifuge Tubes with Locking Snap Cap, 2ml | Fisher | 14-666-315 | |
Parafilm sealing film | Bemis | PM-996 | |
Phage stocks | Carolina Biological Supply | n/a | |
PicoLab® Mouse Diet 20 EXT | LabDiet | 5R58 | |
Pierce™ Chromogenic Endotoxin Quant Kit | Thermo Scientific | A39552S | |
RNase A (17,500 U) | Qiagen | 19101 | |
RNase-free DNase Set | Qiagen | 79254 | |
Sodium Bicarbonate (Fine White Powder) | Fisher Chemical | BP328-500 | |
Sodium Chloride (Crystalline/Certified ACS) | Fisher Chemical | S271 | |
Sonicator (probe model CL-18; power source model FB50) | Fisher scentific | n/a | |
Sterile flexible film isolator | Class Biologically Clean | n/a | |
SYBR™ Safe DNA Gel Stain | Invitrogen | S33102 | |
T100 Thermal Cycler | BioRad | 1861096 | |
T4 phage primer, forward (CCACACATAGCGCGAGTATAA) | IDT | n/a | |
T4 phage primer, forward (GAAACTCGGTCAGGCTATCAA) | IDT | n/a | |
TissueLyser II | Qiagen | 85300 | |
Tris-HCl, 1M Solution, pH 8.0, Molecular Biology Grade, Ultrapure | Thermo Scientific | AAJ22638AE | |
Water, (DNASE, RNASE free) | Fisher BioReagents | BP2484100 |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved