Biz Aimee Myers ve teknik beceri ve yardım için Esi Quayson teşekkür ederim. Bu çalışma NSF 0216310 ve GIVAUDAN Inc hibe (NER) tarafından kısmen desteklenmiştir.

1. İnsan Mantar şeklinde Tat papilla Alınması <ol><li> Kavisli yay microscissors kullanılarak dilin ön kısmının dorsal yüzeyi 4-8 insan mantarbiçim tat papilla çıkarın. </li><li> Hemen bir izolasyon çözeltisi içine yerleştirme (26 mM NaHCO 3, 2,5 mM NaH 2 PO 4, 20 mM glükoz, 65 mM NaCl, 20 mM KCI, ve 1 mM EDTA nükleaz serbest su içinde çözülür ve steril filtre). </li></ol> 2. İnsan Mantar şeklinde Tat papilla Sindirim İnsan mantarbiçim tat hücresi papilla küçük farklılıklar ile iki farklı enzimatik sindirimi protokolleri kullanarak dissosiye olabilir. <ol><li> Pronaz (1 mg / ml, Sigma Aldrich) ve elastaz (1 mg / ml Sigma Aldrich) 30-45 dak (protokol 1) için oda sıcaklığında ile izole çözelti içinde inkübe mantarbiçim papilla. </li><li> Kollajenaz tip I (Worthington den 550 U / ml) ile inkübe mantarbiçim papilla + elastaz (10 Wort U / mL,için hington) 35 2 ml kalsiyum ücretsiz Ringer çözüm + tripsin inhibitörü (Worthington 0.9 mg / ml) ° 30 dakika ve% 95 O 2 /% 5 CO 2 nazik oksijenlenme için sirkülasyon C su banyosu. (Alternatif yöntem sindirim, protokol 2) </li><li> Inkübasyondan sonra, zil ile papilla yıkayın ve 10 kez yangın parlatılmış cam Pasteur pipeti ile papilla öğütmek. </li><li> RT 2500 rpm&#39;de 3 dakika için santrifüjleyin ve izolasyon çözüm kaldırmak ve tat hücre kültürü ortamında 1 ml ekleyin. </li><li> Cam tabak içine sindirmek mantarbiçim papilla aktarın. </li><li> Cerrahi jilet ile nazikçe mantarbiçim papilla parçalara ayır. </li><li> Sıçan kuyruğu kollajen tip-1 kaplı coverslip üzerine klonlama silindir içine disseke papilla 250 ul ekleyin. </li><li> Her oyuğuna tat hücre kültür aracı maddesi 1 ml ilave edilir. </li></ol> 3. İnsan Mantar şeklinde Lezzet papilla hücrelerinin Kültürleme <ol><li> Nemlendirilmiş bir içinde 36 ° C&#39;de inkübe plakasıinkübatör% 5 CO 2 içeren. </li><li> Tam medyum birinci değişim öncesinde 2 gün süreyle bozulmamış bir inkübatörde yerleştirin. 1 ila 3 gün içinde açıkça görünür olmasa da tadı hücreler sonunda, kaplamalı coverslip bağlanacaktır. </li><li> Tamamen plaka ve ortamdan klonlama silindir çıkarın ve her kuyuya tat hücresi orta 1 ml ekleyin. </li><li> Her ortamda 6-7 gün 1/3 &#39;değiştirin. Daha sık ve / veya tamamen orta değiştirmeyin. </li><li> Her gün mikroskop altında hücre büyümesini kontrol edin. Yeni hücrelerin çoğu hücre kümeleri altında büyür. Hücre kümeleri genellikle kültür 2-3 hafta yeni oluşturulan hücreler ayrıldıktan sonra ayırın. </li><li> Bir kez klonlama silindirin% 40-50 tat hücreleri genişleyen kaplı, 36 2-3 dakika w / v tripsin / EDTA% 0.25 kullanarak hücrelerin trypsinize ° C </li><li> 15 ml&#39;lik tüplere kuyu hücreleri transferi, oda sıcaklığında 5 dakika boyunca 3000 rpm&#39;de santrifüj tat hücre kültür aracı maddesi ilave 3 hacimleribelgelendiğinden. </li><li> Tat hücresi orta 1 ml süpernatan ve Pastör pipetiyle hücreleri çıkarın. </li></ol> 4. İnsan Mantar şeklinde Lezzet papilla hücrelerinin yayılması <ol><li> T25 plaka içine hücreleri aktarın ve tat hücresi orta (pasaj 0) 4 ml ekleyin. 36 nemlendirilmiş bir inkübatör ° C CO 2% 5 içeren hücrelere koruyun. </li><li> Kültürlü tat hücrelerinin% 100 izdiham ulaşana kadar her ortamda 6-7 gün 1/3 &#39;değiştirin. Bu zamanda, hücre hasat etmek tat sağlamak için, steril bir kez PBS ile yıkayıp sonra hücreler 36 az 2-3 dakika boyunca% 0.25 w / v tripsin / EDTA kullanılarak hücrelerin ° C. trypsinize </li><li> Yukarıda tarif edildiği gibi santrifüjünden sonra taze T-75 şişeler (pasaj 1) için tam bir tat hücresi, orta ve transfer hücrelerde yeniden süspanse. </li><li> Her ortamda 6-7 gün 1/3 &#39;değiştirin. Daha sık ve / veya tamamen orta değiştirmeyin. </li><li> Hücrelerinin% 100&#39;e yakın izdiham ulaştığınızda 4.3 ve 4.4 adımı yineleyin. Bir şişe içinde 1:04 T75 seyreltme daha fazla için hücreler ayrılırzamanla hücrelerinin büyümesini sürdürmek için yeterli. </li></ol> 5.. Kültürlü İnsan Mantar şeklinde Tat papilla hücreleri Donma ve Çözülme <ol><li> Temel tat hücrelerinin stokları dondurmak için, tripsinizasyon sonra (adım 4.2), 3 ml tam tat hücresi, orta ve steril 15 ml konik santrifüj tüplerine transfer hücreleri ekleyin. Oda sıcaklığında 5 dakika boyunca 2500 rpm&#39;de santrifüje. </li><li> Dikkatle% 95 Fetal Bovine serum (FBS) ve% 5 DMSO içeren dondurma orta uygun hacmi süpernatan ve yavaşça Pastör pipetiyle hücreleri çıkarmak. </li><li> Etiketli, steril cryovials, kapağı sıkıca ve izopropanol içeren bir dondurma kap içinde yere hücreleri aktarın. Önceden sıvı azot ile süresiz aktarılması için en az bir gün için -80 ° C dondurucu içine yerleştirin. </li><li> 37 donmuş primer insan mantarbiçim tadı papilla hücrelerinin, yer bir şişe çözülmeyi ° C su banyosuna kadar laminer akış hücre kültürü çalışırken, sadece (yaklaşık 1 dakika) çözülmüşbaşlık. </li><li> Steril bir 15 ml konik santrifüj tüpüne hücreleri ve dondurma orta aktarın ve tat hücre kültürü ortamında 5 ml ekleyin. </li><li> Oda sıcaklığında 5 dakika boyunca 2500 rpm&#39;de santrifüje hücreleri. Dikkatle tam tat hücre kültürü, orta ve steril bir T-25 doku kültürü şişesi için transferi ile süpernatant, hafifçe Pastör pipetiyle hücreleri atın. </li><li> 4-3 Adım göre kültürü hücre devam etmektedir. </li></ol> 6. Temsilcisi Sonuçlar Kültüründe tat biyopsileri büyümeye girişimleri zaman% 90 başarılı olmuştur. Biyopsi ve ayrışma birkaç gün sonra, hücreler tipik ayrışma işlemden sonra kalan disseke mantarbiçim doku parçaları dışarıya doğru büyür ve göç etmeye başladılar. Tek tek hücrelerin kaplama (Şekil 1A) sonra 24-48 saat görünür olmasına rağmen, hücreler bazen kızı hücreleri (Şekil 1B) üreten, en fazla bağlı hücre kümeleri altında 2-3 hafta için büyüdü. Biyopsikültüründe 4 hafta içinde 8000 hücreleri - ing 4-8 insan mantarbiçim papilla, birincil insan mantarbiçim tat papilla hücrelerinin ilk izole yaklaşık 2000 ulaşır. Ek 3-4 hafta süre ile T25 hücre kültür şişeleri (pasaj 0) genişleme (Şekil 1C) adapte kültürü insan mantarbiçim tat papilla hücrelerine sahip neden olacaktır. Birincil insan mantarbiçim tadı papilla hücrelerinin daha fazla 3-4 hafta (Şekil 1D) içinde geçit-1 ile en az bir milyon hücre yukarı verim kültür genişletilebilir. İlköğretim tat hücrelerinin fazla 8 pasajları için büyümeye devam edecektir. Kültüründe kültüre insan mantarbiçim tat papilla hücrelerinin kültür morfolojisi duyusal hücreleri ile benzer olmuştur daha önce tarif 11,12 .. En kültürlü insan mantarbiçim tadı papilla hücrelerinin kadar 15-30 gün ya da bir veya daha fazla işlem olmadan hücre gövdelerinin orijinal kompakt görünümünü korumuştur. Onlar izdiham kültür ce en ulaştı sonraLLS polarize-uzun görünüşü vardı. Olgun tat hücreleri birkaç farklı histolojik alt ve sergi tat hücresi belirli özellikler oluşur. İşte bu kültürler içindeki hücrelerin olgun tat hücrelerinin karakteristik birçok moleküler ve fizyolojik özellikleri görüntüler olduğunu göstermektedir. Gustducin ve fosfolipaz C - β2, (PLC-β2) mRNA ters transkriptaz-polimeraz zincir reaksiyonu ve sıralama (Şekil 2) ile teyit ürünleri tarafından tespit edildi. Gustducin ve PLC-β2 ekspresyon immunocytochemically tip II-benzeri hücreleri (B ve D, sırasıyla Şekil 3) varlığını gösteren tespit edildi. Yaygınlığı ve gustducin ve PLC-β2 hücre sinyal yolları ve hücre tiplerini yansıtan tam in vivo görülen yansıtmamaktadır göreceli ifade kalıpları. Bir tat tomurcuğu içinde farklı hücre tiplerinin nispi dağıtımı yöneten faktörler bilinmemektedir ve kültür koşullarında çoğaltılmış olabilir. Bu nedenle, b<html> kültür hücreleri ve in vivo meslektaşları manipüle ve izlenebilir koşullar altında, moleküler düzeyde bu özelliklerin düzenlenmesi incelemek için bir fırsat arasındaki benzerlikleri ve farklılıkları oth. Bir model sistemi için önemli bir kriter ilgili fonksiyonel özelliklerinin bulunmasıdır. Kültür hücreler de çeşitli tat uyaranlara (Şekil 4) uygun konsantrasyonları yanıt olarak hücre içi kalsiyum güçlü artışlar sergiledi. Bu çalışmalarda, tatlı ve acı uyaranlara depolarizasyon karşılık gelebilir hücre içi kalsiyum artışı ortaya çıkarmak. Bu tat hücreleri gibi kültürlü hücrelerin özellikleri burada tarif model sistem iletim yollarının ve insan tat hücrelerin rejeneratif kapasitesinin ileri çalışmalar için değerli bir varlık olacağını iddia etmek destekliyoruz. fig1.jpg &quot;/&gt; Şekil 1. Eklenti ve kültürlü insan mantarbiçim tat papilla hücrelerinin morfolojisi. Kollajen tip-1 kaplı plakalar üzerinde yetiştirilen Birincil insan mantarbiçim tadı papilla hücre kültürleri 2 gün (A) sonra görüntülendi. İnsan mantarbiçim tat papilla hücrelerini yavru hücrelere yol göründü bağlı hücre kümeleri altında 4 hafta için büyüdü. Hücreler tipik olarak dört hafta (B) içinde birleştiği büyümüş ve (C ve D) hasat ve sırasıyla yeniden tohumlama gün sonra 2 ve 4 hafta temsil eder. Kültür hücrelerinin en az 8 ay boyunca büyümeye devam etti. Ölçek bar = 50 nm. Şekil 1, bir kısmı da Özdener ve sunuldu. ark. 10. <img alt="Şekil 2" src="/files/ftp_upload/3730/3730fig2.jpg" /> Şekil 2,. RT-PCR sonuçlar spesifik tat hücre belirteç mRNA&#39;lar (gustducin ve PLC-β2) varlığında göstermiştir. Kültürlü insan mantarbiçim hücrelerinden RNA revers transc olduRT-PCR (Invitrogen) için Superscript First Strand Synthesis Sistemi kullanılarak ribed ve gustducin ve PLC-β2 saptanması için özel olarak tasarlanmış olan primerler yükselterek PCR için kullanıldı. Primerler (Tablo 1) bir veya daha fazla intron yayılan seçilmiştir. Her mRNA geçişini 4 veya sıralama ile teyit beklenen boyutu amplifikasyon ürünleri ile 5, kültürlerinde insan mantarbiçim tat papilla hücrelerini tespit edildi. Özgül mRNA hiçbir genomik DNA kirlenme gösteren ters transkriptaz olmadan kontrol deneyleri saptanmadı. PCR ürünlerinin% 2 agaroz jeli üzerine ayrıldı ve jel üzerinde, amplifiye ürün bir ustura ile çıkarıldı. DNA QIAquick Jel Ekstraksiyon Kiti (Qiagen) kullanılarak jelden ekstrakte edildi. PCR ürünleri Pennsylvania Sıralama tesislerinin Üniversitesi dizilenmisti.r. C-PCR ve C-RT sırasıyla, PCR ve Reverse Transcriptase için kontrol deneyleri vardır. Şekil 2, bir kısmı da Özdener ve sunuldu. ark. <sup&gt; 10. <img alt="Şekil 3" src="/files/ftp_upload/3730/3730fig3.jpg" /> Şekil 3. Kültürlü insan mantarbiçim tadı papilla hücrelerinin geçişini 4 veya 5 İmmünoboyama tat hücresi biyolojik varlığını gösterdi. Cultured insan mantarbiçim tat papilla hücreleri (5 günlük) 4 ° C&#39;de gece boyunca (Tablo 2) 4% paraformaldehit ile sabitlenir ve primer antikor ile birlikte inkübe edildi Görüntüler bir Leica TCS-SP2 konfokal lazer tarama mikroskobu ile elde edildi. Yaklaşık olarak, kültür mantarbiçim tat papilla hücreleri% 60 gustducin (B) ve β2 PLC-(D) ile% 20-30 etiketli edildi. Tekabül eden hücrelerin iletim görüntüleri (A ve C) gösterilmektedir. Denetimler için, antikor spesifik immunglobulin ile immünboyama nonspesifik immün reaktivitesi (veriler gösterilmemiştir) olmadığını göstermiştir. Ölçek bar = 50 nm. BölümŞekil 3, aynı zamanda Özdener et sunulmuştur. ark. 10. <img alt="Şekil 4" src="/files/ftp_upload/3730/3730fig4.jpg" /> Geçit 4 veya 5 Şekil 4. Kültüre insan mantarbiçim tadı papilla hücrelerinin farklı uyaranlara yanıt verir. Kültürlü insan mantarbiçim tat papilla hücrelerinin (4-5 günlük) 1mM Fura-2 AM (Molecular Probes) ve 10 mg / ml Pluronic F 127 (Molecular Probes) yüklendi. Kültürlü insan mantarbiçim tat papilla hücrelerinin hücre içi kalsiyum düzeyi ([Ca 2 +] i) değişiklikler standart manuel görüntüleme teknikleri kullanılarak ölçüldü. Hücreleri 340 nm ve 380 nm eksitasyon dalga boylarında ters bir floresan mikroskop ve 510 nm de bir bant geçiren filtre tarafından belirlenen emisyon dalgaboyu kullanılarak görüntülenmiştir. Gerekirse uyaranlara Banyo çözeltisi içinde çözülür ve daha sonra pH değeri yeniden ayarlanması ve osmolarite edildi. Kültürlü insan mantarbiçim tadı papilla hücrelerinin tatlı ve acı uyaranlara cevap verdi. Graphs [Ca 2] ile temsil yanıtları göstermek için maruz (A) denatonyum (2 mM), (B) Sucralose (1 mM) içinde tek tek hücrelerin in i seviyeleri. Her eser tek tek hücreleri temsil eder. <table border="1"><tbody><tr><td> Gen </td><td> Dizi </td><td colspan="2"> PCR koşulları </td><td> Beklenen boyutu (Bp) </td><td> Referans </td></tr><tr><td> β-Aktin </td><td> GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG </td><td> 7 dakika 45 sn 45 sn 45 sn 7 dakika </td><td> 95 94 53 72 72 </td><td> 234 </td><td> NM_001101.3 </td></tr><tr><td> Gustducin </td><td> TCTGGGTATGTGCCAAATGA GGCCCAGTGTATTCTGGAAA </td><td> 7 dakika 45 sn 45 sn 45 sn 7 dakika </td><td> 95 94 53 72 72 </td><td> 386 </td><td> NM_001102386 </td></tr><tr><td> PLC-β2 </td><td> GTCACCTGAAGGCATGGTCT TTAAAGGCGCTTTCTGCAAT </td><td> 3 dakika 30 sn 30 sn 60 sn 7 dakika </td><td> 95 94 53 72 72 </td><td> 333 </td><td> NM_004573 </td></tr></tbody></table> Tablo 1. Tat spesifik molekülleri saptamak için kullanılan primerler ve koşulları. <table border="1"><tbody><tr><td> Primer antikor </td><td> Kaynak </td><td> Ana </td><td> Seyreltme </td><td> İkincil Antikor </td><td> Kaynak </td><td> Ana </td&gt; <td> Seyreltme </td></tr><tr><td> Gustducin </td><td> Santacruz </td><td> Tavşan </td><td> 1:500 </td><td> Anti-tavşan IgG Alexa 633 </td><td> Molecular Probes </td><td> Keçi </td><td> 1:500 </td></tr><tr><td> PLC-β 2 </td><td> Santacruz </td><td> Tavşan </td><td> 1:500 </td><td> Anti-tavşan IgG Alexa 633 </td><td> Molecular Probes </td><td> Keçi </td><td> 1:500 </td></tr></tbody></table> Tablo 2. Antikorlar spesifik molekül tespit ifadesi için kullanılabilir.

<ol>
	<li>Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ+cultures+of+embryonic+rat+tongue+support+tongue+and+gustatory+papilla+morphogenesis+in+vitro+without+intact+sensory+ganglia.">Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia.</a> J. Comp. Neurol. 377, 324-340 (1997).</li><li>Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain+difference+in+amiloride-sensitivity+of+salt-induced+responses+in+mouse+non-dissociated+taste+cells.">Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells.</a> Neurosci. Lett. 277, 13-16 (1999).</li><li>Caicedo, A., Jafri, M. S., Roper, S. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+Ca2++imaging+reveals+neurotransmitter+receptors+for+glutamate+in+taste+receptor+cells.">In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells.</a> J. Neurosci. 20, 7978-7985 (2000).</li><li>Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+method+to+obtain+cells+of+taste+buds+from+fungiform+papillae+of+mice.">A reliable method to obtain cells of taste buds from fungiform papillae of mice.</a> Acta Histochem. 112, 107-112 (2010).</li><li>Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+isolating+and+patch-clamping+single+mammalian+taste+receptor+cells.">A method for isolating and patch-clamping single mammalian taste receptor cells.</a> Brain Res. 503, 326-329 (1989).</li><li>Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+culture+of+rat+taste+bud+cells+that+retain+molecular+markers+for+taste+buds+and+permit+functional+expression+of+foreign+genes.">Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes.</a> Neuroscience. 106, 217-225 (2001).</li><li>Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+rat+taste+buds+in+primary+culture.">Maintenance of rat taste buds in primary culture.</a> Chem. Senses. 26, 861-873 (2001).</li><li>Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+lineage+relationships+in+taste+buds.">Analysis of cell lineage relationships in taste buds.</a> J. Neurosci. 22, 4522-4529 (2002).</li><li>Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+long-term+maintenance+of+rat+taste+cells+in+culture.">Characterization and long-term maintenance of rat taste cells in culture.</a> Chem. Senses. 31, 279-290 (2006).</li><li>Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Human+Fungiform+Papillae+Cells+in+Culture.">Characterization of Human Fungiform Papillae Cells in Culture.</a> Chem. Senses. 36, 601-612 (2011).</li><li>Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characteristics+of+odorant+elicited+calcium+changes+in+cultured+human+olfactory+neurons.">Characteristics of odorant elicited calcium changes in cultured human olfactory neurons.</a> J. Neurosci. Res. 62, 737-749 (2000).</li><li>Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+culture+of+neuronal+cells+from+adult+human+olfactory+epithelium.">Continuous culture of neuronal cells from adult human olfactory epithelium.</a> J. Mol. Neurosci. 3, 137-146 (1992).</li><li>Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomal+comparison+of+human+dermal+lymphatic+endothelial+cells+ex+vivo+and+in+vitro.">Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro.</a> Physiol. Genomics. 17, 179-192 (2007).</li><li>Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+neural+stem+cells+from+mesenchymal+stemcells:+evidence+for+a+bipotential+stem+cell+population.">Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population.</a> Stem Cells Dev. 17, 1109-1121 (2008).</li><li>Sandow, S. L., Grayson, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limits+of+isolation+and+culture:+intact+vascular+endothelium+and+BKCa.">Limits of isolation and culture: intact vascular endothelium and BKCa.</a> Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).</li></ol>

Çıkar çatışması ilan etti.

Biz 12 aylık bir dönemi kapsayan, 8 üzerinden geçişler için insan mantarbiçim tat papilla elde edilen hücrelerin korumuştur. Bu kültürler bunlar tat reseptör hücrelerinin anahtar moleküler ve fizyolojik özelliklerine ilave olarak, olgun tat hücre tipleri birkaç belirteçler ifade burada aşama için in vitro olgunlaşması birçoğu yeni hücreler, üretir. Varlığı gustducin-ve PLC-β2 kültürlü hücrelerin alt gruplarında immünoreaktivite bu sonuç ile tutarlıdır. En önemlisi, bazı ...

<table border="1"><tbody><tr><td> Reaktif Adı </td><td> Şirket </td></tr><tr><td> MCDB 123 </td><td> Sigma-Aldrich </td></tr><tr><td> Iscove en DMEM Orta </td><td> Mediatech </td></tr><tr><td> Elastaz </td><td> Sigma-Aldrich </td></tr><tr><td> Pronazın D </td><td> Sigma-Aldrich </td></tr><tr><td> Elastaz </td><td> Worthington </td></tr><tr><td> Soya fasulyesi tripsin inhibitörü </td><td> Worthington </td></tr><tr><td> Kollajenaz tip 1 </td><td> Worthington </td></tr><tr><td> Fare kuyruk kolajeni tipi 1 </td><td> BD Bilimleri </td></tr><tr><td> Fura-2 AM </td><td> Molecular Probes </td></tr><tr><td> RT-PCR için Superscript First Strand Synthesis Sistemi </td><td> Invitrogen </td></tr><tr><td> Leica TCS SP2 Spektral Konfokal Mikroskop </td><td> Leica Microsystems Inc </td&gt; </tr><tr><td> Discovery-1 görüntüleme istasyonu ve Metamorph yazılım </td><td> Molecular Devices </td></tr><tr><td> Küçük ince uçlu pens ve ekstra ince yay makas </td><td> Güzel Bilim Araçları </td></tr></tbody></table>

isolation and culture of human fungiform taste papillae cells

Tat hücreleri gıdaların içerdiği basit uyaranlara ve karmaşık kimyasal moleküllerin geniş bir algılama izin özgü histolojik, moleküler ve fizyolojik özelliklere sahip, son derece uzmanlaşmış bulunmaktadır. İnsan, bireysel mantarbiçim papillada sıfırdan 20 kadar tat tomurcukları ihtiva etmektedir. Birden çok hücre döngüsü için kültür tat papilla hücrelerini korumak için yeteneği bu eşsiz duyusal hücrelerin, moleküler rejeneratif ve fonksiyonel özellikleri tanımlamak için önemli faydası olacaktır ancak kültür, insan tat hücreleri için oluşturulmuş protokol vardır. Tat hücrelerinin daha önceki çalışmalarda primer kültür, kemirgenler gelen eksplant kültürleri, ya da doku dilimleri 1,2,3,4 yarı sağlam tat tomurcukları taze olarak izole edilen hücreler kullanılarak yapılmıştır. Bu preparatlar, her avantajlara sahip olmakla birlikte, uzun dönem kültürlerin gelişimi, özellikle tat hücre proliferasyonu ve yönün çalışmaları için, önemli avantajlar sağladığı olacaktırentiation. Bizimki de dahil olmak üzere çeşitli gruplar, tat hücre kültürü modellerin geliştirilmesi ve kurulması ilgi olmuştur. Kültür tat hücreleri girişimleri, 3-5 d 5,6,7,8 ötesinde genellikle kalıcı değildir hücreleri ile sınırlı canlılığı bildirdin. Biz son zamanlarda kemirgen tat hücrelerinin 9 genişletilmiş kültürü için başarılı bir yöntem bildirdi. Biz burada ilk kez izole insan mantarbiçim tadı papilla hücrelerinin in vitro kültür sistemi bir kurulması için rapor. Biyopsi ile elde edilen insan mantarbiçim papilla hücreleri başarıyla canlılık kaybı olmadan daha sekiz pasajlar (12 ay) için kültüre edildi. Hücreler olgun tat hücrelerinin karakteristik birçok moleküler ve fizyolojik özellikleri görüntülenir. Gustducin ve fosfolipaz C β2, (PLC-β2) mRNA ters transkriptaz-polimeraz zincir reaksiyonu ile birçok hücre tespit ve sıralama tarafından teyit edildi. İmmünositokimya analizi bora varlığını göstermiştirKültüre tat hücrelerinde ducin ve PLC-β2 ifade. Kültürlü insan mantarbiçim hücreleri de tat reseptörleri ve sinyal yolunun en azından bazı mevcut olduğunu gösteren birçok tat uyaran Uygun konsantrasyonlarda yanıt olarak hücre içi kalsiyum artış sergiledi. Bu sonuçlar yeterli yetişkin insanlardan tat hücreleri oluşturulur ve en az sekiz geçişleri için muhafaza edilebilir olduğunu göstermektedir. Hücrelerin çoğu bir model tat sistemi olarak kullanımı desteklemek için yetişkin tadı epitelden akut izole hücrelerin fizyolojik ve biyokimyasal özelliklerini korurlar. Bu sistem, in vitro hazırlanmasında bir memeli tat reseptör hücrelerin proliferasyonu, farklılaşması ve işlevi ile ilgili işlemlerin çalışmalara sağlayacaktır. Insan mantarbiçim hücre kültürü oluşturulması için kullanılan İnsan mantarbiçim tadı papilla incelendi araştırma protokolleri altında uygun bilgilendirilmiş onam sonrasında araştırma için hibe edildive İDD komitesi tarafından onaylandı. Protokolü (# 0934) Schulman Associates Kurumsal Değerlendirme Kurulu Inc, Cincinnati, OH tarafından onaylandı. Aşağıda yazılı bir protokol Özdener ark yayınlanan parametreleri dayanmaktadır. 2011 10.

Watch this Scientific Journal Video about Isolation and Culture of Human Fungiform Taste Papillae Cells at JoVE.com

Isolation and Culture of Human Fungiform Taste Papillae Cells

Biz insan mantarbiçim tat papilla hücrelerinin uzun süreli kültürlerde izole edilmesi ve sürdürülmesi için tekrarlanabilir bir protokol geliştirmeyi amaçladık. Biyopsi ile elde edilen insan mantarbiçim papilla hücreleri başarıyla canlılık kaybı olmadan daha sekiz pasajlar (12 ay) için kültüre edildi.

İnsan Mantar şeklinde Lezzet papilla hücrelerinin izolasyonu ve Kültürü

Taste cells are highly specialized, with unique histological, molecular and physiological characteristics that permit detection of a wide range of simple ...

isolation-and-culture-of-human-fungiform-taste-papillae-cells

Research

JoVE Journal

Neuroscience

14.3K Görüntüleme.  Monell Chemical Senses Center. Biz insan mantarbiçim tat papilla hücrelerinin uzun süreli kültürlerde izole edilmesi ve sürdürülmesi için tekrarlanabilir bir protokol geliştirmeyi amaçladık. Biyopsi ile elde edilen insan mantarbiçim papilla hücreleri başarıyla canlılık kaybı olmadan daha sekiz pasajlar (12 ay) için kültüre edildi.

Video: Isolation and Culture of Human Fungiform Taste Papillae Cells

Isolation and Culture of Neural Crest Stem Cells from Human Hair Follicles

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a well-characterized niche for adult stem cells1. This segment of the outer root sheath contains a number of different types of stem cells, including epithelial stem cells2, melanocyte stem cells3 and neural crest like stem cells4-7. Hair follicles represent an accessible and rich source for different types of human stem cells. We and others have isolated neural crest stem cells (NCSCs) from human fetal and adult hair follicles4,5. These human stem cells are label-retaining cells and are capable of self-renewal through asymmetric cell division in vitro. They express immature neural crest cell markers but not differentiation markers. Our expression profiling study showed that they share a similar gene expression pattern with murine skin immature neural crest cells. They exhibit clonal multipotency that can give rise to myogenic, melanocytic, and neuronal cell lineages after in vitro clonal single cell culture. Differentiated cells not only acquire lineage-specific markers but also demonstrate appropriate functions in ex vivo conditions. In addition, these NCSCs show differentiation potential toward mesenchymal lineages. Differentiated neuronal cells can persist in mouse brain and retain neuronal differentiation markers. It has been shown that hair follicle derived NCSCs can help nerve regrowth, and they improve motor function in mice transplanted with these stem cells following transecting spinal cord injury8. Furthermore, peripheral nerves have been repaired with stem cell grafts9, and implantation of skin-derived precursor cells adjacent to crushed sciatic nerves has resulted in remyelination10. Therefore, the hair follicle/skin derived NCSCs have already shown promising results for regenerative therapy in preclinical models.
Somatic cell reprogramming to induced pluripotent stem (iPS) cells has shown enormous potential for regenerative medicine. However, there are still many issues with iPS cells, particularly the long term effect of oncogene/virus integration and potential tumorigenicity of pluripotent stem cells have not been adequately addressed. There are still many hurdles to be overcome before iPS cells can be used for regenerative medicine. Whereas the adult stem cells are known to be safe and they have been used clinically for many years, such as bone marrow transplant. Many patients have already benefited from the treatment. Autologous adult stem cells are still preferred cells for transplantation. Therefore, the readily accessible and expandable adult stem cells in human skin/hair follicles are a valuable source for regenerative medicine.

This article presents a robust protocol for isolation and culture of neural crest stem cells from human hair follicles.

İnsan Saç köklerinin arasından Sinir Crest Kök Hücre İzolasyonu ve Kültür

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a ...

Nörobilim

Isolation and Expansion of Human Glioblastoma Multiforme Tumor Cells Using the Neurosphere Assay

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in glioblastoma mutliforme (GBM), is to identify and isolate tumor initiating cell population(s) to investigate their role in tumor formation, progression, and recurrence. Understanding tumor initiating cell populations will provide clues to finding effective therapeutic approaches for these tumors. The neurosphere assay (NSA) due to its simplicity and reproducibility has been used as the method of choice for isolation and propagation of many of this tumor cells. This protocol demonstrates the neurosphere culture method to isolate and expand stem-like cells in surgically resected human GBM tumor tissue. The procedures include an initial chemical digestion and mechanical dissociation of tumor tissue, and subsequently plating the resulting single cell suspension in NSA culture. After 7-10 days, primary neurospheres of 150-200 &mu;m in diameter can be observed and are ready for further passaging and expansion.

This video protocol demonstrates the isolation and expansion of stem like cells from surgically resected human glioblastoma mutliforme (GBM) tumor tissue using the neurosphere assay culture method.

Neurosphere Testi İnsan Glioblastoma Multiforme Tümör Hücreleri İzolasyon ve Genişleme

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in ...

Isolation and Culture of Hippocampal Neurons from Prenatal Mice

Primary cultures of rat and murine hippocampal neurons are widely used to reveal cellular mechanisms in neurobiology. By isolating and growing individual neurons, researchers are able to analyze properties related to cellular trafficking, cellular structure and individual protein localization using a variety of biochemical techniques. Results from such experiments are critical for testing theories addressing the neural basis of memory and learning. However, unambiguous results from these forms of experiments are predicated on the ability to grow neuronal cultures with minimum contamination by other brain cell types. In this protocol, we use specific media designed for neuron growth and careful dissection of embryonic hippocampal tissue to optimize growth of healthy neurons while minimizing contaminating cell types (i.e. astrocytes). Embryonic mouse hippocampal tissue can be more difficult to isolate than similar rodent tissue due to the size of the sample for dissection. We show detailed dissection techniques of hippocampus from embryonic day 19 (E19) mouse pups. Once hippocampal tissue is isolated, gentle dissociation of neuronal cells is achieved with a dilute concentration of trypsin and mechanical disruption designed to separate cells from connective tissue while providing minimum damage to individual cells. A detailed description of how to prepare pipettes to be used in the disruption is included. Optimal plating densities are provided for immuno-fluorescence protocols to maximize successful cell culture. The protocol provides a fast (approximately 2 hr) and efficient technique for the culture of neuronal cells from mouse hippocampal tissue.

We provide a protocol for the culture of highly purified hippocampal neurons from prenatal mouse brains without the use of a feeder glial cell layer.

Prenatal Fareler gelen Hipokampal Nöronlar izolasyonu ve Kültürü

Primary cultures of rat and murine hippocampal neurons are widely used to reveal cellular mechanisms in neurobiology. By isolating and growing individual ...

Isolation and Culture of Rat Embryonic Neural Cells: A Quick Protocol

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied successfully to the isolation of mouse and human primary neurons and neural progenitors. Dissociated neurons are maintained in serum-free medium up to several weeks. These cultures can be used for nucleofection, immunocytochemistry, nucleic acids preparation, as well as electrophysiology. Older neuronal cultures can also be transfected with a good efficiency rate by lentiviral transduction and, less efficiently, with calcium phosphate or lipid-based methods such as lipofectamine.

We describe a rapid methodology to isolate and culture hippocampal and cortical neurons from rodent embryos. This protocol allows us to perform experiments in which nearly pure neuronal cultures are required.

Sıçan Embriyonik Nöral Hücre İzolasyonu ve Kültür: Bir Hızlı Protokol

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied ...

Isolation and Culture of Neural Crest Cells from Embryonic Murine Neural Tube

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to mesenchymal transition (EMT) and migrates throughout the embryo, giving rise to diverse cell types 1-3. NC also has the unique ability to influence the differentiation and maturation of target organs4-6. When explanted in vitro, NC progenitors undergo self-renewal, migrate and differentiate into a variety of tissue types including neurons, glia, smooth muscle cells, cartilage and bone. 
NC multipotency was first described from explants of the avian neural tube7-9. In vitro isolation of NC cells facilitates the study of NC dynamics including proliferation, migration, and multipotency. Further work in the avian and rat systems demonstrated that explanted NC cells retain their NC potential when transplanted back into the embryo10-13. Because these inherent cellular properties are preserved in explanted NC progenitors, the neural tube explant assay provides an attractive option for studying the NC in vitro. 
To attain a better understanding of the mammalian NC, many methods have been employed to isolate NC populations. NC-derived progenitors can be cultured from post-migratory locations in both the embryo and adult to study the dynamics of post-migratory NC progenitors11,14-20, however isolation of NC progenitors as they emigrate from the neural tube provides optimal preservation of NC cell potential and migratory properties13,21,22. Some protocols employ fluorescence activated cell sorting (FACS) to isolate a NC population enriched for particular progenitors11,13,14,17. However, when starting with early stage embryos, cell numbers adequate for analyses are difficult to obtain with FACS, complicating the isolation of early NC populations from individual embryos. Here, we describe an approach that does not rely on FACS and results in an approximately 96% pure NC population based on a Wnt1-Cre activated lineage reporter23. 
The method presented here is adapted from protocols optimized for the culture of rat NC11,13. The advantages of this protocol compared to previous methods are that 1) the cells are not grown on a feeder layer, 2) FACS is not required to obtain a relatively pure NC population, 3) premigratory NC cells are isolated and 4) results are easily quantified. Furthermore, this protocol can be used for isolation of NC from any mutant mouse model, facilitating the study of NC characteristics with different genetic manipulations. The limitation of this approach is that the NC is removed from the context of the embryo, which is known to influence the survival, migration and differentiation of the NC2,24-28.

Isolation of embryonic neural crest from the neural tube facilitates the use of in vitro methods for studying migration, self-renewal, and multipotency of neural crest.

Embriyonik Mürin Nöral Tüp çıkan sinirsel Crest Hücre İzolasyonu ve Kültür

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to ...

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Fare Kortikal astrositlerde İzolasyon ve Kültür

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Embriyonik ön beyin gelen Endotel Hücreleri İzolasyon ve Kültürü

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Denver Papillae Protocol for Objective Analysis of Fungiform Papillae

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure consistent scoring between scorers. This protocol builds off of a need that has arisen from the last two decades of taste research using FP as a proxy for taste pore density. FP density has historically been analyzed using Miller &#38; Reedy&#8217;s 1990 characterizations of their morphology: round, stained lighter, large, and elevated. In this work, the authors forewarned that stricter definitions of FP morphology needed to be outlined. Despite this call to action, follow up literature has been scarce, with most studies continuing to cite Miller &#38; Reedy&#8217;s original work. Consequently, FP density reports have been highly variable and, combined with small sample sizes, may contribute to the discrepant conclusions on the role of FP in taste sensitivity. The Genetics of Taste Lab explored this apparent inconsistency in counting and found that scorers were individually prioritizing the importance of these characteristics differently and had no guidance for when a papilla had some, but not all, of the reported qualities of FP. The result of this subjectivity is highly variable FP counts of the same tongue image. The Denver Papillae Protocol has been developed to remedy this consequence through use of a dichotomous key that further defines and prioritizes the importance of the characteristics put forth by Miller &#38; Reedy. The proposed method could help create a standard way to quantify FP for researchers in the field of taste and nutritional studies.

Here we present a protocol to measure fungiform papilla density from digital photographs. This method builds prioritization and objective characteristic metrics into the original descriptive work on fungiform papillae by Miller &#38; Reedy (1990).

Mantar şeklinde papilla Amaç Analizi Denver Papilla Protokolü

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure ...

Isolation and Culture of Adult Neural Stem Cells from the Mouse Subcallosal Zone

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation into three types of cells: neurons, astrocytes, and oligodendrocytes. Identifying aNSC-derived regions and characterizing the aNSC properties are critical for the potential use of aNSCs and for the elucidation of their role in neural regeneration. The subcallosal zone (SCZ), located between white matter and the hippocampus, has recently been reported to contain aNSCs and continuously give rise to neuroblasts. A low percentage of aNSCs from the SCZ is differentiated into neurons; most cells are differentiated into glial cells, such as oligodendrocytes and astrocytes. These cells are suggested to have a therapeutic potential for traumatic cortical injury. This protocol describes in detail the process to generate SCZ-aNSCs from an adult mouse brain. A brain matrix with intervals of 1 mm is used to obtain the SCZ-containing coronal slices and to precisely dissect the SCZ from the whole brain. The SCZ sections are initially subjected to a neurosphere culture. A well-developed culture system allows for the verification of their characteristics and can increase research on NSCs. A neurosphere culture system provides a useful tool for determining proliferation and collecting the genuine NSCs. A monolayer culture is also an in vitro system to assay proliferation and differentiation. Significantly, this culture system provides a more homogenous environment for NSCs than the neurosphere culture system. Thus, using a discrete brain region, these culture systems will be helpful for expanding our knowledge about aNSCs and their applications for therapeutic uses.

Establishing culture systems for the expansion of adult neural stem cells (aNSCs) allows for the examination and application of aNSCs for therapy. The subcallosal zone (SCZ) has recently been recognized as a novel neuroblast-forming region in adult mice. Here, methods for the isolation, expansion, and differentiation of SCZ-aNSCs are described.

Fare Subcallosal Zone İzolasyon ve Yetişkin Nöral Kök Hücre Kültürü

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation ...

Isolation and Culture of Embryonic Mouse Neural Stem Cells

Neural stem cells (NSCs) are multipotent and can give rise to the three major cell types of the central nervous system (CNS). In vitro culture and expansion of NSCs provide a suitable source of cells for neuroscientists to study the function of neurons and glial cells along with their interactions. There are several reported techniques for the isolation of neural stem cells from adult or embryo mammalian brains. During the microsurgical operation to isolate NSCs from different regions of the embryonic CNS, it is very important to reduce the damage to the brain cells to obtain the highest ratio of live and expandable stem cells. A possible technique for stress reduction during isolation of these cells from the mouse embryo brain is the reduction of surgical time. Here, we demonstrate a developed technique for rapid isolation of these cells from the E13 mouse embryo ganglionic eminence. Surgical procedures include harvesting E13 mouse embryos from the uterus, cutting the frontal fontanelle of the embryo with a bent needle tip, extracting the brain from the skull, microdissection of the isolated brain to harvest the ganglionic eminence, dissociation of the harvested tissue in NSC medium to gain a single cell suspension, and finally plating cells in suspension culture to generate neurospheres.

Here, we introduce a novel microsurgical technique for the isolation of neural stem cells from the E13 mouse embryo ganglionic eminence.