Wir bedanken uns bei Aimee Myers und ESI Quayson für technische Kompetenz und Hilfe. Diese Arbeit wurde zum Teil durch NSF 0216310 und Givaudan Inc Zuschuss (NER) unterstützt.

1. Gewinnung von humanen pilzförmigen Papillen Geschmack <ol><li> Nehmen Sie vier Minuten vor acht Menschen pilzförmige Papillen Geschmack von der Dorsalfläche des vorderen Teils der Zunge mit gebogenen Feder Mikroschere. </li><li> Unmittelbar in eine isolierte Lösung (26 mM NaHCO 3, 2,5 mM NaH 2 PO 4, 20 mM Glucose, 65 mM NaCl, 20 mM KCl und 1 mM EDTA in der Nuclease-freiem Wasser und sterilfiltriert). </li></ol> 2. Menschliche pilzförmige Papillen Geschmack Verdauung Menschliche pilzförmige Papillen Geschmack Zelle getrennt werden kann mit zwei verschiedenen Protokollen enzymatische Verdauung mit kleinen Unterschieden. <ol><li> Inkubieren fungiformen Papillen in Isolation Lösung mit Pronase (1 mg / ml, Sigma Aldrich) und Elastase (1 mg / ml Sigma Aldrich) bei Raumtemperatur für 30-45 min (Protokoll 1). </li><li> Inkubieren fungiformen Papillen mit Kollagenase Typ I (550 U / mL, von Worthington) + Elastase (10 U / ml, von Würzehington) + Trypsin-Inhibitor (0,9 mg / mL, von Worthington) in 2 ml Kalzium Ringerlösung in 35 ° C Wasserbad mit Umwälzung für 30 Minuten und schonende Oxygenierung mit 95% O 2/5% CO 2. (Alternative Methode zur Verdauung, Protokoll 2) </li><li> Nach der Inkubation waschen Papillen mit Klingel und verreiben Sie die Papillen mit Feuer poliertes Glas Pasteur Pipette für 10-mal. </li><li> Zentrifugieren Sie es für 3 Minuten bei 2500 rpm bei RT und entfernen Isolation Lösung und 1 ml Geschmack Zellkulturmedium. </li><li> Übertragen verdaut fungiformen Papillen in Glasschale. </li><li> Sezieren fungiformen Papillen sanft mit chirurgischen Rasiermesser. </li><li> Fügen Sie 250 ul seziert Papillen in Klonen Zylinder auf Rattenschwanz Kollagen Typ-1 beschichteten Deckglas. </li><li> 1 ml der Geschmack Zellkulturmedium in jedes Well. </li></ol> 3. Kultivierung von humanen pilzförmigen Papillen Geschmack Cells <ol><li> Inkubieren Platte bei 36 ° C in einer befeuchtetenInkubator mit 5% CO 2. </li><li> Platzieren in einem Inkubator ungestört von 2 Tagen vor der ersten Änderung des Vollmedium. Geschmackszellen wird schließlich zu der beschichteten Deckgläschen zu binden, obwohl dies nicht deutlich sichtbar in 1 bis 3 Tagen. </li><li> Entfernen Sie das Klonen von Platten-und Zylinder-Medium komplett und 1 ml Geschmack Zellmedium in jedes Well. </li><li> Ersetzen 1/3 der mittleren alle 6-7 Tage. Ändern Sie nicht öfter Medium und / oder vollständig. </li><li> Überprüfen Sie das Zellwachstum unter dem Mikroskop jeden zweiten Tag. Die meisten der neuen Zellen wachsen unter Zellhaufen. Zellhaufen in der Regel nach 2-3 Wochen in Kultur Verlassen der neu generierten Zellen zu lösen. </li><li> Sobald 40-50% des Klonens Zylinder wird in den Ausbau der Geschmack Zellen bedeckt, trypsinieren Zellen mit 0,25% w / v Trypsin / EDTA für 2-3 Minuten bei 36 ° C </li><li> Übertragen Zellen aus Brunnen in 15 ml Röhrchen, fügen Sie 3 Bände des Geschmacks Zellkulturmedium durch Zentrifugation bei 3000 rpm für 5 Minuten bei Raumtemperatur folgtetur. </li><li> Überstand entfernen und Resuspendieren Sie die Zellen mit 1 ml Geschmack Zellmedium. </li></ol> 4. Propagation of Human pilzförmige Papillen Geschmack Cells <ol><li> Übertragen Sie Zellen in T25-Platte und 4 ml Geschmack Zellmedium (Passage 0). Pflegen Zellen bei 36 ° C in einem befeuchteten Inkubator mit 5% CO 2. </li><li> Ersetzen Sie 1/3 des Mediums alle 6-7 Tage bis zum kultivierten Zellen Geschmack 100% Konfluenz erreicht haben. Zu diesem Zeitpunkt, zu schmecken Zellen zu ernten aktivieren, waschen Sie die Zellen einmal mit sterilem PBS dann trypsinieren Zellen unter Verwendung von 0,25% w / v Trypsin / EDTA für 2-3 Minuten bei 36 ° C </li><li> Nach Zentrifugation wie oben beschrieben, um die ganze Geschmack Zellmedium und Transfer Zellen in frisches T-75 Flaschen (Kanal 1) zu resuspendieren. </li><li> Ersetzen 1/3 der mittleren alle 6-7 Tage. Ändern Sie nicht öfter Medium und / oder vollständig. </li><li> Wiederholen Sie Schritt 4,3 und 4,4, wenn die Zellen nahe bei 100% Konfluenz erreicht haben. Split-Zellen nicht mehr als 1:4-Verdünnung in einer T75-Flaschefür die Aufrechterhaltung eines angemessenen Wachstum der Zellen über die Zeit. </li></ol> 5. Einfrieren und Auftauen kultivierte menschliche Zellen pilzförmige Papillen Geschmack <ol><li> Um Bestände von primären Zellen einfrieren Geschmack, nach Trypsinierung (Schritt 4.2), 3 ml Geschmack komplette Zelle mittel-und Transfer-Zellen auf sterile 15 ml konischen Zentrifugenröhrchen. Zentrifugieren bei 2500 Upm für 5 min bei Raumtemperatur. </li><li> Entfernen Sie vorsichtig den Überstand und resuspendieren sanft Zellen mit entsprechenden Volumen Einfriermedium mit 95% fötalem Rinderserum (FBS) und 5% DMSO. </li><li> Übertragen Zellen zu kennzeichnen, sterile Kryoröhrchen, fest verschließen, und in einen Behälter, der das Einfrieren Isopropanol. Platz in eine -80 ° C Gefrierschrank für mindestens einen Tag vor der Übertragung auf unbestimmte Zeit zu flüssigem Stickstoff. </li><li> Um eine Flasche mit gefrorenem primären humanen pilzförmigen Papillen Geschmack Zellen, bei 37 ° C auftauen Wasserbad bis kurz aufgetaut (ca. 1 Minute), während der Arbeit in einer Laminar-Flow-ZellkulturKapuze. </li><li> Übertragen Zellen und Einfriermedium in ein steriles 15 ml konischen Zentrifugenröhrchen eingewogen und mit 5 ml Geschmack Zellkulturmedium. </li><li> Zentrifuge Zellen bei 2500 UpM für 5 min bei Raumtemperatur. Sorgfältig Überstand verwerfen, sanft Die Zellen mit vollständigem Geschmack Zellkulturmedium, und in ein steriles T-25 Zellkulturflasche. </li><li> Weiter zur Kultivierung von Zellen nach 3 bis 4 fort. </li></ol> 6. Repräsentative Ergebnisse Versuche, Geschmack Biopsien in Kultur zu züchten erfolgreich waren 90% der Zeit. Ein paar Tage nach Biopsie und Dissoziation, Zellen typischerweise begann zu wachsen und wandern nach außen von den Stücken seziert fungiformen Gewebe, die nach der Dissoziation Verfahren geblieben. Obwohl einzelne Zellen sichtbar waren 24-48 Stunden nach dem Ausstreichen (Abbildung 1A), wuchs Zellen für bis zu 2-3 Wochen unter angehängten Zellhaufen, gelegentlich Erzeugung Tochterzellen (Abbildung 1B). Von BiopsieIng. 08.04 menschlichen pilzförmige Papillen, erreichen erste Isolate von primären humanen pilzförmigen Papillen Geschmack Zellen etwa 2000 bis 8000 Zellen in 4 Wochen in Kultur. Expansion in T25-Zellkulturflaschen (Passage 0) für weitere 3-4 Wochen wird in mit menschlichen pilzförmige Papillen Geschmack Zellen in Kultur angepasst (Abbildung 1C) führen. Primäre humane pilzförmige Papillen Zellen Geschmack kann weiter ausgebaut werden, um nach oben in der Kultur von mindestens einer Million Zellen von Passage-1 in 3-4 Wochen (1D) zu ergeben. Primäre Zellen Geschmack wird sich weiterhin für mehr als 8 Stellen wachsen. Die Morphologie der kultivierten humanen pilzförmigen Papillen Geschmack Zellen in Kultur war ähnlich kultivierten Zellen chemosensorischen zuvor beschrieben 11,12 .. Die meisten kultivierten humanen pilzförmigen Papillen Geschmack Zellen behielten ihre ursprüngliche Erscheinungsbild der kompakten Zellkörper mit oder ohne einem oder mehreren Prozessen bis zu 15-30 Tage. Nachdem sie erreicht Zusammenfluss meisten der kultivierten ceLLS hatte eine polarisierte-gestreckter erscheinen. Ältere Geschmack Zellen bestehen aus mehreren verschiedenen histologischen Subtypen und Ausstellung Geschmack Zell-spezifische Funktionen. Hier zeigen wir, dass Zellen in diesen Kulturen viele molekulare und physiologische Merkmale charakteristisch für reife Geschmack Zellen anzuzeigen. Gustducin und Phospholipase C - β2, (PLC-β2) mRNA wurden durch reverse Transkriptase-Polymerase-Kettenreaktion und Produkte durch Sequenzierung (2) bestätigt, detektiert. Die Expression von Gustducin und PLC-β2 erkannt wurde immuncytochemisch, die das Vorhandensein von Typ-II-ähnlichen Zellen (Abbildung 3 B und D). Die Prävalenz und Muster der relativen Expression Gustducin und PLC-β2 reflektierenden Zelle Signalwege und Zelltypen nicht exakt widerspiegeln, dass in vivo gesehen. Die Faktoren, die die relative Verteilung der verschiedenen Zelltypen innerhalb eines Geschmacksknospe unbekannt sind, und dürfen nicht in den Kulturbedingungen repliziert werden. Daher ist b<html> oth die Ähnlichkeiten und Unterschiede zwischen den kultivierten Zellen und deren In-vivo-Pendants bieten die Gelegenheit, um die Regulation dieser Eigenschaften auf molekularer Ebene zu untersuchen, unter Bedingungen, die manipuliert und überwacht werden können. Ein wichtiges Kriterium für ein Modell-System ist das Vorhandensein von entsprechenden funktionellen Eigenschaften. Kultivierte Zellen zeigten auch robust Erhöhung des intrazellulären Calcium in Reaktion auf die entsprechenden Konzentrationen von mehreren Geschmacksreize (Abbildung 4). In diesen Studien hervorzurufen süßen und bitteren Reize eine Erhöhung der intrazellulären Calcium, die zu einer Depolarisation entsprechen kann. Diese Zell-ähnlichen Geschmack Eigenschaften der kultivierten Zellen stützen die Behauptung, dass das Modell, das wir beschreiben hier eine wertvolle Bereicherung für weitere Untersuchungen der Signaltransduktionswege und Regenerationsfähigkeit des menschlichen Geschmacks-Zellen sein. fig1.jpg &quot;/&gt; Abbildung 1. Anlage und Morphologie der kultivierten menschlichen Zellen pilzförmige Papillen Geschmack. Primäre humane pilzförmige Papillen Geschmack Zellkulturen auf Kollagen-Typ-1 beschichteten Platten gewachsen waren, wurden nach 2 Tagen (A) abgebildet. Menschliche pilzförmige Papillen Geschmack Zellen wuchsen für bis zu 4 Wochen unter angehängten Zellhaufen, die Anlass zu geben schien Tochterzellen. Die Zellen wuchsen in der Regel bis zur Konfluenz innerhalb von vier Wochen (B) und (C und D) repräsentiert Tag 2 und 4 Wochen nach der Ernte und reseeding bzw. Kultivierte Zellen weiterhin für mindestens 8 Monate wachsen. Maßstabsbalken = 50 nm auf. Ein Teil der Abbildung 1 wurde auch in Ozdener et. al. 10. <img alt="2" src="/files/ftp_upload/3730/3730fig2.jpg" /> Abbildung 2. RT-PCR-Ergebnisse zeigten das Vorhandensein von spezifischen Geschmack Biomarker Zelle mRNAs (Gustducin und PLC-β2,). Gesamt-RNA aus kultivierten menschlichen Zellen war fungiformen Reverse TRANSCribed unter Verwendung des Superscript First Strand Synthesis System für RT-PCR (Invitrogen) und für die PCR durch Verstärken mit spezifischen Primern zur Detektion von gustducin und PLC-β2 gestalten. Primer (Tabelle 1) wurden ausgewählt, um ein oder mehrere Introns umfassen. Jede mRNA wurde in kultivierten humanen pilzförmigen Geschmack Papillen Zellen aus Passage 4 oder 5 mit Amplifikationsprodukte der erwarteten Größe, nachgewiesen durch Sequenzierung bestätigt. Spezifische mRNA wurde in Kontrollversuchen ohne reverse Transkriptase was keine Kontaminationen mit genomischer DNA nachgewiesen werden. PCR-Produkte wurden auf 2% igen Agarosegelen getrennt und die amplifizierten Produkte wurden auf dem Gel mit einer Rasierklinge ausgeschnitten. DNA wurde aus dem Gel unter Verwendung des QIAquick Gel Extraction Kit (Qiagen) extrahiert. PCR-Produkte wurden an der University of Pennsylvania Sequencing Einrichtungen sequenziert. C-C-PCR und RT sind Kontrollversuche für die PCR und reverse Transkriptase, jeweils. Teil der 2 wurde auch in Ozdener et. al. <sup&gt; 10. <img alt="Abbildung 3" src="/files/ftp_upload/3730/3730fig3.jpg" /> Abbildung 3. Immunfärbung von kultivierten menschlichen Zellen pilzförmige Papillen Geschmack Passage 4 oder 5 zeigte Präsenz des Geschmacks Zelle Biomarkern. Kultivierte humane pilzförmige Papillen Geschmack Zellen (5 Tage alt) wurden mit 4% Paraformaldehyd fixiert, gewaschen und mit primären Antikörpern (Tabelle 2) über Nacht bei 4 ° C. Die Bilder wurden mit einem Leica TCS-SP2 konfokalen Laser-Scanning-Mikroskop erworben. Etwa, wurden 60% der kultivierten Geschmack pilzförmige Papillen Zellen mit Gustducin (B) und 20-30% mit PLC-β2 (D) gekennzeichnet. Getriebe Bilder entsprechender Zellen gezeigt (A und C). Zur Kontrolle Immunfärbung mit spezifischen Antikörper Immunglobulin zeigte die Abwesenheit von unspezifischen Immunreaktivität (Daten nicht gezeigt). Maßstabsbalken = 50 nm auf. Teilvon 3 wurde auch in Ozdener et. al. 10. <img alt="Abbildung 4" src="/files/ftp_upload/3730/3730fig4.jpg" /> 4. Kultivierte humane fungiformes Geschmack Papillen Zellen aus Passage 4 oder 5 auf verschiedene Stimuli zu reagieren. Kultivierte humane fungiformes Geschmack Papillen Zellen (4-5 Tage alt) wurden mit 1 mM Fura-2 AM (Molecular Probes) und 10 mg / ml Pluronic F127 (Molecular Probes) geladen. Veränderungen der intrazellulären Calcium-Spiegel ([Ca 2 +] i) in kultivierten menschlichen Zellen pilzförmige Papillen Geschmack wurden mittels Standard-Handbuch bildgebenden Verfahren. Die Zellen wurden unter Verwendung einer inversen Mikroskop bei Wellenlängen von 340 nm und 380 nm und einer Emissionswellenlänge von einem Bandpassfilter bei 510 nm zentriert eingestellt. Die Stimuli wurden in Bad gelöst und dann pH-Wert nachgestellt und die Osmolarität, wenn nötig. Kultivierte humane pilzförmige Papillen Geschmack Zellen reagierten auf süßen und bitteren Reize. Graphs veranschaulichen repräsentative Reaktionen [Ca 2 +] i-Ebenen in einzelnen Zellen während der Exposition gegenüber (A) Denatonium (2 mM), (B) Sucralose (1 mM). Jede einzelne Kurve stellt einzelne Zellen. <table border="1"><tbody><tr><td> Gen </td><td> Reihenfolge </td><td colspan="2"> PCR-Bedingung </td><td> Erwartete Größe (Bp) </td><td> Referenz </td></tr><tr><td> β-Aktin </td><td> GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG </td><td> 7 min 45 Sek. 45 Sek. 45 Sek. 7 min </td><td> 95 94 53 72 72 </td><td> 234 </td><td> NM_001101.3 </td></tr><tr><td> Gustducin </td><td> TCTGGGTATGTGCCAAATGA GGCCCAGTGTATTCTGGAAA </td><td> 7 min 45 Sek. 45 Sek. 45 Sek. 7 min </td><td> 95 94 53 72 72 </td><td> 386 </td><td> NM_001102386 </td></tr><tr><td> PLC-β2 </td><td> GTCACCTGAAGGCATGGTCT TTAAAGGCGCTTTCTGCAAT </td><td> 3 min 30 Sek. 30 Sek. 60 Sek. 7 min </td><td> 95 94 53 72 72 </td><td> 333 </td><td> NM_004573 </td></tr></tbody></table> Tabelle 1. Primer und Bedingungen zum Nachweis von spezifischen Molekülen Geschmack verwendet. <table border="1"><tbody><tr><td> Primärer Antikörper </td><td> Quelle </td><td> Gastgeber </td><td> Verdünnung </td><td> Sekundäre Antikörper </td><td> Quelle </td><td> Gastgeber </td&gt; <td> Verdünnung </td></tr><tr><td> Gustducin </td><td> SantaCruz </td><td> Kaninchen </td><td> 1:500 </td><td> Anti-Kaninchen-IgG-Alexa 633 </td><td> Molecular Probes </td><td> Ziege </td><td> 1:500 </td></tr><tr><td> PLC-β 2 </td><td> SantaCruz </td><td> Kaninchen </td><td> 1:500 </td><td> Anti-Kaninchen-IgG-Alexa 633 </td><td> Molecular Probes </td><td> Ziege </td><td> 1:500 </td></tr></tbody></table> Tabelle 2. Antikörper zum Nachweis der Expression von spezifischen Molekülen verwendet.

<ol>
	<li>Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ+cultures+of+embryonic+rat+tongue+support+tongue+and+gustatory+papilla+morphogenesis+in+vitro+without+intact+sensory+ganglia.">Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia.</a> J. Comp. Neurol. 377, 324-340 (1997).</li><li>Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain+difference+in+amiloride-sensitivity+of+salt-induced+responses+in+mouse+non-dissociated+taste+cells.">Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells.</a> Neurosci. Lett. 277, 13-16 (1999).</li><li>Caicedo, A., Jafri, M. S., Roper, S. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+Ca2++imaging+reveals+neurotransmitter+receptors+for+glutamate+in+taste+receptor+cells.">In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells.</a> J. Neurosci. 20, 7978-7985 (2000).</li><li>Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+method+to+obtain+cells+of+taste+buds+from+fungiform+papillae+of+mice.">A reliable method to obtain cells of taste buds from fungiform papillae of mice.</a> Acta Histochem. 112, 107-112 (2010).</li><li>Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+isolating+and+patch-clamping+single+mammalian+taste+receptor+cells.">A method for isolating and patch-clamping single mammalian taste receptor cells.</a> Brain Res. 503, 326-329 (1989).</li><li>Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+culture+of+rat+taste+bud+cells+that+retain+molecular+markers+for+taste+buds+and+permit+functional+expression+of+foreign+genes.">Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes.</a> Neuroscience. 106, 217-225 (2001).</li><li>Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+rat+taste+buds+in+primary+culture.">Maintenance of rat taste buds in primary culture.</a> Chem. Senses. 26, 861-873 (2001).</li><li>Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+lineage+relationships+in+taste+buds.">Analysis of cell lineage relationships in taste buds.</a> J. Neurosci. 22, 4522-4529 (2002).</li><li>Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+long-term+maintenance+of+rat+taste+cells+in+culture.">Characterization and long-term maintenance of rat taste cells in culture.</a> Chem. Senses. 31, 279-290 (2006).</li><li>Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Human+Fungiform+Papillae+Cells+in+Culture.">Characterization of Human Fungiform Papillae Cells in Culture.</a> Chem. Senses. 36, 601-612 (2011).</li><li>Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characteristics+of+odorant+elicited+calcium+changes+in+cultured+human+olfactory+neurons.">Characteristics of odorant elicited calcium changes in cultured human olfactory neurons.</a> J. Neurosci. Res. 62, 737-749 (2000).</li><li>Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+culture+of+neuronal+cells+from+adult+human+olfactory+epithelium.">Continuous culture of neuronal cells from adult human olfactory epithelium.</a> J. Mol. Neurosci. 3, 137-146 (1992).</li><li>Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomal+comparison+of+human+dermal+lymphatic+endothelial+cells+ex+vivo+and+in+vitro.">Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro.</a> Physiol. Genomics. 17, 179-192 (2007).</li><li>Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+neural+stem+cells+from+mesenchymal+stemcells:+evidence+for+a+bipotential+stem+cell+population.">Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population.</a> Stem Cells Dev. 17, 1109-1121 (2008).</li><li>Sandow, S. L., Grayson, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limits+of+isolation+and+culture:+intact+vascular+endothelium+and+BKCa.">Limits of isolation and culture: intact vascular endothelium and BKCa.</a> Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).</li></ol>

Keine Interessenskonflikte erklärt.

Wir haben Zellen aus menschlichen pilzförmige Papillen Geschmack für über 8 Passagen erhalten gepflegt, über einen Zeitraum von 12 Monaten. Diese Kulturen generieren neue Zellen, von denen viele in-vitro-Reifung auf die Bühne, wo sie mehrere Marker von reifen Geschmacksknospe Zelltypen, zum Ausdruck bringen zusätzlich zu den wichtigsten molekularen und physiologischen Eigenschaften der Geschmack Rezeptorzellen. Die Anwesenheit von Gustducin-und PLC-β2 Immunreaktivität in Teilmengen von kultivierten Zell...

<table border="1"><tbody><tr><td> Name des Reagenzes </td><td> Firma </td></tr><tr><td> MCDB 123 </td><td> Sigma-Aldrich </td></tr><tr><td> Iscove-DMEM-Medium </td><td> MediaTech </td></tr><tr><td> Elastase </td><td> Sigma-Aldrich </td></tr><tr><td> Pronase E </td><td> Sigma-Aldrich </td></tr><tr><td> Elastase </td><td> Worthington </td></tr><tr><td> Sojabohnen-Trypsininhibitor </td><td> Worthington </td></tr><tr><td> Collagenase Typ 1 </td><td> Worthington </td></tr><tr><td> Rattenschwanz-Collagen Typ 1 </td><td> BD Sciences </td></tr><tr><td> Fura-2 AM </td><td> Molecular Probes </td></tr><tr><td> Superscript First Strand Synthesis System für RT-PCR </td><td> Invitrogen </td></tr><tr><td> Leica TCS SP2 Spectral Konfokalmikroskop </td><td> Leica Microsystems Inc. </td&gt; </tr><tr><td> Discovery-Imaging-1-Station und Software Metamorph </td><td> Molecular Devices </td></tr><tr><td> Kleine feine Spitze Pinzette und Schere Frühjahr extra fein </td><td> Fine Science Tools </td></tr></tbody></table>

isolation and culture of human fungiform taste papillae cells

Geschmack Zellen sind hoch spezialisierte, mit einzigartigen histologischen, molekularen und physiologischen Eigenschaften, die den Nachweis einer Vielzahl von einfachen und komplexen Reize chemische Moleküle in Nahrungsmitteln enthalten ermöglichen. In der menschlichen, individuellen fungiformen Papillen enthalten von null bis zu 20 Geschmacksknospen. Es gibt keine festgelegten Protokoll zur Kultivierung von Zellen menschlichen Geschmack, obwohl die Fähigkeit, Geschmack Papillen Zellen in Kultur für mehrere Zyklen Zelle aufrechtzuerhalten wäre von großem Nutzen für die Charakterisierung der molekularen, regenerative und funktionellen Eigenschaften dieser einzigartigen Sinneszellen sein. Frühere Studien des Geschmacks-Zellen wurden unter Verwendung frisch isolierten Zellen in Primärkultur, Explantatkulturen von Nagern, oder semi-intakten Geschmacksnerven in Gewebeschnitten 1,2,3,4. Obwohl jedes dieser Präparate hat Vorteile, wäre die Entwicklung von langfristigen Kulturen erhebliche Vorteile zur Verfügung gestellt haben, insbesondere für Studien des Geschmacks Zellproliferation und verschierenzierung. Mehrere Gruppen, einschließlich der unsrigen, waren interessiert an der Entwicklung und Etablierung von Zellkultur-Modellen Geschmack. Die meisten Versuche, Kultur Geschmack Zellen haben begrenzte Lebensfähigkeit berichtet, die mit Zellen in der Regel nicht dauerhaft über 3-5 d 5,6,7,8. Vor kurzem berichteten wir auf ein erfolgreiches Verfahren für die verlängerte Kultur von Nagetier Geschmack Zellen 9. Wir berichten hier zum ersten Mal die Etablierung eines in vitro-Kultur-System für isolierte menschliche Zellen pilzförmige Papillen Geschmack. Zellen aus menschlichen fungiformen Papillen durch Biopsie gewonnen wurden erfolgreich in der Kultur mehr als acht Durchgängen (12 Monate) aufrecht erhalten, ohne Verlust der Lebensfähigkeit. Zellen zeigten viele molekulare und physiologische Merkmale charakteristisch für reife Geschmack Zellen. Gustducin und Phospholipase C β2, (PLC-β2) mRNA wurden in vielen Zellen durch reverse Transkriptase-Polymerase-Kettenreaktion festgestellt und bestätigt durch Sequenzierung. Immunzytochemie Analyse zeigte die Anwesenheit von Böducin und PLC-β2-Expression in kultivierten Zellen Geschmack. Kultivierte humane fungiformes Zellen zeigten auch Erhöhung des intrazellulären Calcium in Reaktion auf die entsprechenden Konzentrationen von mehreren Geschmacksreize anzeigt, dass Geschmacksrezeptoren und wenigstens einige der Signalwege vorhanden waren. Diese Ergebnisse zeigen, dass genügend Geschmack Zellen von erwachsenen Menschen erzeugt und aufrechterhalten werden für mindestens acht Passagen. Viele der Zellen behalten physiologischen und biochemischen Merkmale von akut isolierten Zellen aus dem erwachsenen Geschmack Epithel auf ihre Verwendung als Modell Geschmack zu unterstützen. Dieses System ermöglicht weitere Untersuchungen der Prozesse in der Proliferation, Differenzierung und Funktion von Säuger-Zellen-Rezeptor-Geschmack in einem In-vitro-Herstellung beteiligt. Menschliche pilzförmige Papillen Geschmack für den Aufbau menschlicher fungiformen Zellkultur verwendet wurden, für die Forschung nach einer ordnungsgemäßen Einwilligung unter Forschung Protokolle, die gespendet wurden bewertetund durch den IRB Ausschuss genehmigt. Das Protokoll (# 0934) wurde von Schulman Associates Institutional Review Board Inc., Cincinnati, OH genehmigt. Geschrieben Protokoll unten auf der veröffentlichten Parameter durch Ozdener et al basiert. 2011 10.

Watch this Scientific Journal Video about Isolation and Culture of Human Fungiform Taste Papillae Cells at JoVE.com

Isolation and Culture of Human Fungiform Taste Papillae Cells

Wir wollten eine reproduzierbare Protokoll für die Isolierung und die Pflege langfristiger Kulturen von humanen pilzförmigen Papillen Geschmack Zellen zu entwickeln. Zellen aus menschlichen fungiformen Papillen durch Biopsie gewonnen wurden erfolgreich in der Kultur mehr als acht Durchgängen (12 Monate) aufrecht erhalten, ohne Verlust der Lebensfähigkeit.

Isolierung und Kultivierung humaner Zellen pilzförmige Papillen Geschmack

Taste cells are highly specialized, with unique histological, molecular and physiological characteristics that permit detection of a wide range of simple ...

isolation-and-culture-of-human-fungiform-taste-papillae-cells

Research

JoVE Journal

Neuroscience

14.3K Aufrufe.  Monell Chemical Senses Center. Wir wollten eine reproduzierbare Protokoll für die Isolierung und die Pflege langfristiger Kulturen von humanen pilzförmigen Papillen Geschmack Zellen zu entwickeln. Zellen aus menschlichen fungiformen Papillen durch Biopsie gewonnen wurden erfolgreich in der Kultur mehr als acht Durchgängen (12 Monate) aufrecht erhalten, ohne Verlust der Lebensfähigkeit.

Serie: Isolation and Culture of Human Fungiform Taste Papillae Cells

Isolation and Culture of Neural Crest Stem Cells from Human Hair Follicles

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a well-characterized niche for adult stem cells1. This segment of the outer root sheath contains a number of different types of stem cells, including epithelial stem cells2, melanocyte stem cells3 and neural crest like stem cells4-7. Hair follicles represent an accessible and rich source for different types of human stem cells. We and others have isolated neural crest stem cells (NCSCs) from human fetal and adult hair follicles4,5. These human stem cells are label-retaining cells and are capable of self-renewal through asymmetric cell division in vitro. They express immature neural crest cell markers but not differentiation markers. Our expression profiling study showed that they share a similar gene expression pattern with murine skin immature neural crest cells. They exhibit clonal multipotency that can give rise to myogenic, melanocytic, and neuronal cell lineages after in vitro clonal single cell culture. Differentiated cells not only acquire lineage-specific markers but also demonstrate appropriate functions in ex vivo conditions. In addition, these NCSCs show differentiation potential toward mesenchymal lineages. Differentiated neuronal cells can persist in mouse brain and retain neuronal differentiation markers. It has been shown that hair follicle derived NCSCs can help nerve regrowth, and they improve motor function in mice transplanted with these stem cells following transecting spinal cord injury8. Furthermore, peripheral nerves have been repaired with stem cell grafts9, and implantation of skin-derived precursor cells adjacent to crushed sciatic nerves has resulted in remyelination10. Therefore, the hair follicle/skin derived NCSCs have already shown promising results for regenerative therapy in preclinical models.
Somatic cell reprogramming to induced pluripotent stem (iPS) cells has shown enormous potential for regenerative medicine. However, there are still many issues with iPS cells, particularly the long term effect of oncogene/virus integration and potential tumorigenicity of pluripotent stem cells have not been adequately addressed. There are still many hurdles to be overcome before iPS cells can be used for regenerative medicine. Whereas the adult stem cells are known to be safe and they have been used clinically for many years, such as bone marrow transplant. Many patients have already benefited from the treatment. Autologous adult stem cells are still preferred cells for transplantation. Therefore, the readily accessible and expandable adult stem cells in human skin/hair follicles are a valuable source for regenerative medicine.

This article presents a robust protocol for isolation and culture of neural crest stem cells from human hair follicles.

Isolation und Kultur von Neural Crest Stem Cells aus menschlichen Haarfollikeln

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a ...

Forschung

Neurowissenschaften

Isolation and Expansion of Human Glioblastoma Multiforme Tumor Cells Using the Neurosphere Assay

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in glioblastoma mutliforme (GBM), is to identify and isolate tumor initiating cell population(s) to investigate their role in tumor formation, progression, and recurrence. Understanding tumor initiating cell populations will provide clues to finding effective therapeutic approaches for these tumors. The neurosphere assay (NSA) due to its simplicity and reproducibility has been used as the method of choice for isolation and propagation of many of this tumor cells. This protocol demonstrates the neurosphere culture method to isolate and expand stem-like cells in surgically resected human GBM tumor tissue. The procedures include an initial chemical digestion and mechanical dissociation of tumor tissue, and subsequently plating the resulting single cell suspension in NSA culture. After 7-10 days, primary neurospheres of 150-200 &mu;m in diameter can be observed and are ready for further passaging and expansion.

This video protocol demonstrates the isolation and expansion of stem like cells from surgically resected human glioblastoma mutliforme (GBM) tumor tissue using the neurosphere assay culture method.

Isolation und Expansion der menschlichen Glioblastoma multiforme Tumorzellen unter Verwendung der Neurosphäre Assay

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in ...

Isolation and Culture of Rat Embryonic Neural Cells: A Quick Protocol

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied successfully to the isolation of mouse and human primary neurons and neural progenitors. Dissociated neurons are maintained in serum-free medium up to several weeks. These cultures can be used for nucleofection, immunocytochemistry, nucleic acids preparation, as well as electrophysiology. Older neuronal cultures can also be transfected with a good efficiency rate by lentiviral transduction and, less efficiently, with calcium phosphate or lipid-based methods such as lipofectamine.

We describe a rapid methodology to isolate and culture hippocampal and cortical neurons from rodent embryos. This protocol allows us to perform experiments in which nearly pure neuronal cultures are required.

Isolierung und Kultivierung von embryonalen Ratten-Nervenzellen: ein Quick-Protokoll

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied ...

Isolation and Culture of Neural Crest Cells from Embryonic Murine Neural Tube

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to mesenchymal transition (EMT) and migrates throughout the embryo, giving rise to diverse cell types 1-3. NC also has the unique ability to influence the differentiation and maturation of target organs4-6. When explanted in vitro, NC progenitors undergo self-renewal, migrate and differentiate into a variety of tissue types including neurons, glia, smooth muscle cells, cartilage and bone. 
NC multipotency was first described from explants of the avian neural tube7-9. In vitro isolation of NC cells facilitates the study of NC dynamics including proliferation, migration, and multipotency. Further work in the avian and rat systems demonstrated that explanted NC cells retain their NC potential when transplanted back into the embryo10-13. Because these inherent cellular properties are preserved in explanted NC progenitors, the neural tube explant assay provides an attractive option for studying the NC in vitro. 
To attain a better understanding of the mammalian NC, many methods have been employed to isolate NC populations. NC-derived progenitors can be cultured from post-migratory locations in both the embryo and adult to study the dynamics of post-migratory NC progenitors11,14-20, however isolation of NC progenitors as they emigrate from the neural tube provides optimal preservation of NC cell potential and migratory properties13,21,22. Some protocols employ fluorescence activated cell sorting (FACS) to isolate a NC population enriched for particular progenitors11,13,14,17. However, when starting with early stage embryos, cell numbers adequate for analyses are difficult to obtain with FACS, complicating the isolation of early NC populations from individual embryos. Here, we describe an approach that does not rely on FACS and results in an approximately 96% pure NC population based on a Wnt1-Cre activated lineage reporter23. 
The method presented here is adapted from protocols optimized for the culture of rat NC11,13. The advantages of this protocol compared to previous methods are that 1) the cells are not grown on a feeder layer, 2) FACS is not required to obtain a relatively pure NC population, 3) premigratory NC cells are isolated and 4) results are easily quantified. Furthermore, this protocol can be used for isolation of NC from any mutant mouse model, facilitating the study of NC characteristics with different genetic manipulations. The limitation of this approach is that the NC is removed from the context of the embryo, which is known to influence the survival, migration and differentiation of the NC2,24-28.

Isolation of embryonic neural crest from the neural tube facilitates the use of in vitro methods for studying migration, self-renewal, and multipotency of neural crest.

Isolierung und Kultivierung von Zellen der Neuralleiste aus embryonalen murinen Neuralrohr

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to ...

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Isolation und Kultur von Maus Kortikale Astrozyten

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Membrane Potential Dye Imaging of Ventromedial Hypothalamus Neurons From Adult Mice to Study Glucose Sensing

Studies of neuronal activity are often performed using neurons from rodents less than 2 months of age due to the technical difficulties associated with increasing connective tissue and decreased neuronal viability that occur with age. Here, we describe a methodology for the dissociation of healthy hypothalamic neurons from adult-aged mice. The ability to study neurons from adult-aged mice allows the use of disease models that manifest at a later age and might be more developmentally accurate for certain studies. Fluorescence imaging of dissociated neurons can be used to study the activity of a population of neurons, as opposed to using electrophysiology to study a single neuron. This is particularly useful when studying a heterogeneous neuronal population in which the desired neuronal type is rare such as for hypothalamic glucose sensing neurons. We utilized membrane potential dye imaging of adult ventromedial hypothalamic neurons to study their responses to changes in extracellular glucose. Glucose sensing neurons are believed to play a role in central regulation of energy balance. The ability to study glucose sensing in adult rodents is particularly useful since the predominance of diseases related to dysfunctional energy balance (e.g.&#160;obesity) increase with age.

The activity of single neurons from adult-aged mice can be studied by dissociating neurons from specific brain regions and using fluorescent membrane potential dye imaging. By testing responses to changes in glucose, this technique can be used to study the glucose sensitivity of adult ventromedial hypothalamic neurons.

Membrane Potential Dye Imaging von Ventromedial Hypothalamus Neuronen aus erwachsenen Mäusen zu Glucose Sensing Studieren

Studies of neuronal activity are often performed using neurons from rodents less than 2 months of age due to the technical difficulties associated with ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Isolierung und Kultivierung von Endothelzellen aus dem embryonalen Vorderhirn

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Denver Papillae Protocol for Objective Analysis of Fungiform Papillae

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure consistent scoring between scorers. This protocol builds off of a need that has arisen from the last two decades of taste research using FP as a proxy for taste pore density. FP density has historically been analyzed using Miller &#38; Reedy&#8217;s 1990 characterizations of their morphology: round, stained lighter, large, and elevated. In this work, the authors forewarned that stricter definitions of FP morphology needed to be outlined. Despite this call to action, follow up literature has been scarce, with most studies continuing to cite Miller &#38; Reedy&#8217;s original work. Consequently, FP density reports have been highly variable and, combined with small sample sizes, may contribute to the discrepant conclusions on the role of FP in taste sensitivity. The Genetics of Taste Lab explored this apparent inconsistency in counting and found that scorers were individually prioritizing the importance of these characteristics differently and had no guidance for when a papilla had some, but not all, of the reported qualities of FP. The result of this subjectivity is highly variable FP counts of the same tongue image. The Denver Papillae Protocol has been developed to remedy this consequence through use of a dichotomous key that further defines and prioritizes the importance of the characteristics put forth by Miller &#38; Reedy. The proposed method could help create a standard way to quantify FP for researchers in the field of taste and nutritional studies.

Here we present a protocol to measure fungiform papilla density from digital photographs. This method builds prioritization and objective characteristic metrics into the original descriptive work on fungiform papillae by Miller &#38; Reedy (1990).

Denver Papillen Protokoll für objektive Analyse der pilzförmige Papillen

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure ...

Isolation and Culture of Adult Neural Stem Cells from the Mouse Subcallosal Zone

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation into three types of cells: neurons, astrocytes, and oligodendrocytes. Identifying aNSC-derived regions and characterizing the aNSC properties are critical for the potential use of aNSCs and for the elucidation of their role in neural regeneration. The subcallosal zone (SCZ), located between white matter and the hippocampus, has recently been reported to contain aNSCs and continuously give rise to neuroblasts. A low percentage of aNSCs from the SCZ is differentiated into neurons; most cells are differentiated into glial cells, such as oligodendrocytes and astrocytes. These cells are suggested to have a therapeutic potential for traumatic cortical injury. This protocol describes in detail the process to generate SCZ-aNSCs from an adult mouse brain. A brain matrix with intervals of 1 mm is used to obtain the SCZ-containing coronal slices and to precisely dissect the SCZ from the whole brain. The SCZ sections are initially subjected to a neurosphere culture. A well-developed culture system allows for the verification of their characteristics and can increase research on NSCs. A neurosphere culture system provides a useful tool for determining proliferation and collecting the genuine NSCs. A monolayer culture is also an in vitro system to assay proliferation and differentiation. Significantly, this culture system provides a more homogenous environment for NSCs than the neurosphere culture system. Thus, using a discrete brain region, these culture systems will be helpful for expanding our knowledge about aNSCs and their applications for therapeutic uses.

Establishing culture systems for the expansion of adult neural stem cells (aNSCs) allows for the examination and application of aNSCs for therapy. The subcallosal zone (SCZ) has recently been recognized as a novel neuroblast-forming region in adult mice. Here, methods for the isolation, expansion, and differentiation of SCZ-aNSCs are described.

Isolierung und Kultur von adulten neuralen Stammzellen aus der Maus subcallosa Zone

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation ...

Isolation and Culture of Embryonic Mouse Neural Stem Cells

Neural stem cells (NSCs) are multipotent and can give rise to the three major cell types of the central nervous system (CNS). In vitro culture and expansion of NSCs provide a suitable source of cells for neuroscientists to study the function of neurons and glial cells along with their interactions. There are several reported techniques for the isolation of neural stem cells from adult or embryo mammalian brains. During the microsurgical operation to isolate NSCs from different regions of the embryonic CNS, it is very important to reduce the damage to the brain cells to obtain the highest ratio of live and expandable stem cells. A possible technique for stress reduction during isolation of these cells from the mouse embryo brain is the reduction of surgical time. Here, we demonstrate a developed technique for rapid isolation of these cells from the E13 mouse embryo ganglionic eminence. Surgical procedures include harvesting E13 mouse embryos from the uterus, cutting the frontal fontanelle of the embryo with a bent needle tip, extracting the brain from the skull, microdissection of the isolated brain to harvest the ganglionic eminence, dissociation of the harvested tissue in NSC medium to gain a single cell suspension, and finally plating cells in suspension culture to generate neurospheres.

Here, we introduce a novel microsurgical technique for the isolation of neural stem cells from the E13 mouse embryo ganglionic eminence.