우리는 아미 마이어스 및 기술 능력과 도움 ESI의 Quayson 감사드립니다. 이 작품은 NSF 0,216,310 및 Givaudan INC 부여 (NER)에 의해 부분적으로 지원되었다.

1. 인간 Fungiform의 맛 용의자 구하기 <ol><li> 곡선 봄 microscissors를 사용하여 혀의 앞부분은 부분 등 부분의 표면 4-8 인간 fungiform의 맛을 용의자를 제거합니다. </li><li> 즉시 격리 솔루션에 플레이스 (26 MM NaHCO 3, 2.5 MM 아뇨 2 PO 4, 20 MM 포도당, 65 MM NaCl, 20 MM KCl, 1 밀리미터 EDTA (에틸렌 다이아 민 테트라 초산) nuclease없는 물속에 녹아 및 소독 필터링). </li></ol> 2. 인간 Fungiform의 맛 용의자는 소화 인간 fungiform의 맛을 전지 용의자는 약간의 차이로 두 개의 서로 다른 효소 소화 프로토콜을 사용하여 dissociated 수 있습니다. <ol><li> pronase (1 밀리그램 / ML, 시그마 알드리치)과 엘라스타제 (1 밀리그램 / ML 시그마 알드리치) 30-45 분 (프로토콜 1) 상온에서 함께 격리 솔루션에서 품어 fungiform 용의자. </li><li> Collagenase 유형 I (워싱턴에서 550 U / ML,)로 품어 fungiform 용의자 + 엘라스타제 (10 Wort에서 U / ML,대한 hington) 35 2 ML 칼슘 무료 닮은 솔루션의 + 트립신 억제제 (워싱턴에서 0.9 밀리그램 / ML) ° 30 분 95% O 5분의 2 %의 CO 2와 부드러운 산소를위한 순환와 C 물 목욕. (다른 방법 소화, 프로토콜 2) </li><li> 부화 후 닮은 함께 용의자를 씻고 10 회 대한 화재 광택 유리 파스퇴르 피펫으로 용의자를 씹다. </li><li> RT에서 2,500 rpm으로 3 분만을 원심 분리기 및 절연 솔루션을 제거하고 미각 세포 배양 매체의 1 ML을 추가합니다. </li><li> 유리 그릇에 소화 fungiform 용의자를 전송합니다. </li><li> 수술 면도기로 부드럽게 fungiform 용의자를 해부. </li><li> 쥐의 꼬리 콜라겐 타입-1 코팅 coverslip 향해 복제 실린더로 해부하는 용의자를 250 μl를 추가합니다. </li><li> 각 잘으로 미각 세포 배양 매체의 1 ML을 추가합니다. </li></ol> 3. 인간 Fungiform의 맛 용의자 전지의 Culturing <ol><li> humidified에서 36 ° C에서 접시를 품어배양기 5 %에게 CO 2를 포함하는. </li><li> 전체 매체의 첫 번째 변경 이전 2 일 흐트러지지 인큐베이터에 넣으십시오. 그 1 ~ 3 일 안에 분명하게 보이지 않을 수도 있지만 맛이 전지는 결국 코팅된 coverslip에 바인딩됩니다. </li><li> 완전히 플레이트와 매체에서 복제 실린더를 제거하고 각 잘으로 미각 세포 매체의 1 ML을 추가합니다. </li><li> 모든 매체 6-7일 1 / 3을 교체하십시오. 더 자주 그리고 / 또는 완전히 매체를 변경하지 마십시오. </li><li> 매일 현미경으로 세포의 성장을 확인합니다. 새로운 세포의 대부분은 세포 클러스터 아래 성장. 세포 클러스터는 일반적으로 문화 2-3주은 새로 생성된 세포를 떠난 후 분리. </li><li> 일단 복제 실린더의 40~50%는 미각 세포를 팽창으로 덮여 있습니다, 36시 2~3분 위해 W / V 트립신 / EDTA (에틸렌 다이아 민 테트라 초산) 0.25 %을 사용하여 세포를 trypsinize ° C. </li><li> 15 ML 튜브로 우물에서 세포를 전송, 룸 기질에서 5 분 동안 3,000 rpm으로 원심 분리에 의해 다음 미각 세포 배양 매체 3 권 추가ature. </li><li> 미각 세포 매체의 1 ML로 뜨는 및 resuspend 세포를 제거합니다. </li></ol> 4. 인간 Fungiform의 맛 용의자 전지의 전파 <ol><li> T25 접시에 세포를 전송하고 미각 세포 매체 (통로 0) 4 ML에 추가합니다. 36 humidified 인큐베이터에서 ° C는 CO 2 5 %를 포함한에서 세포를 유지합니다. </li><li> 교양 미각 세포가 100 % 합류점에 도달하기 전까지 모든 매체 6-7일 1 / 3을 교체하십시오. 이때 수확 미각 세포를 활성화하려면, 멸균 PBS로 한 번 세포를 씻어가 36에서 2-3분 동안 0.25 % W / V 트립신 / EDTA (에틸렌 다이아 민 테트라 초산)를 사용하여 세포 ° C를 trypsinize </li><li> 위에서 설명한 원심 분리 후, 신선한 T-75 flasks (통로 1) 완전 맛 셀 매체 및 전송 세포에 resuspend. </li><li> 모든 매체 6-7일 1 / 3을 교체하십시오. 더 자주 그리고 / 또는 완전히 매체를 변경하지 마십시오. </li><li> 세포가 주변에 100 % 합류점에 도달했을 때 4.3 및 4.4 단계를 반복합니다. T75 플라스크에 1시 4분 희석보다 더 이상으로 세포를 분할시간에 따른 세포의 적절한 성장을 유지하는. </li></ol> 5. 교양 인간 Fungiform의 맛 용의자 세포를 동결 융해 <ol><li> 기본 미각 세포의 주식을 동결시키고 trypsinization 후 (단계 4.2), 3 ML 완전한 미각 세포 매체와 무균 15 ML 원추형 원심 튜브에 전송 세포를 추가합니다. 상온에서 5 분 동안 2,500 rpm으로 원심 분리기. </li><li> 조심스럽게 95% 태아 소 혈청 (FBS)와 5 % DMSO를 포함하는 동결 매체의 적절한 볼륨으로 뜨는 부드럽게 resuspend 세포를 제거합니다. </li><li> 라벨, 멸균 cryovials, 단단히 모자 및 이소프로판올를 포함하는 냉동 컨테이너의 장소로 세포를 전송합니다. 이전 액체 질소로 무한정 전송에 하나 이상의 일간 -80 ° C ~ 냉동기에 장소. </li><li> 37 일차 냉동 인간 fungiform의 맛을 용의자 세포, 장소의 병을 녹여하려면 ° C 물에 목욕까지 판상 흐름 세포 배양에서 작업하는 동안 단지 (약 1 분) 해동후드. </li><li> 멸균 15 ML 원추형 원심 튜브에 세포 동결 매체를 전송하고 미각 세포 배양 매체의 5 ML에 추가합니다. </li><li> 상온에서 5 분 동안 2,500 rpm으로 세포를 원심 분리기. 조심스럽게 완전한 미각 세포 배양 매체 및 멸균 T-25 조직 배양 플라스크에 전송로 뜨는, 부드럽게 resuspend 세포를 버리고. </li><li> 4 3 단계에 따라 배양 세포로 진행합니다. </li></ol> 6. 대표 결과 문화에 맛을 biopsies 성장하려고 시도 시간의 90 % 성공했다. 생검 및 분리 후 며칠이 세포는 일반적으로 분리 과정 후 남아 해부 fungiform 조직의 조각에서 바깥쪽으로 성장하고 마이 그 레이션하기 시작했다. 개별 세포 도금 (그림 1A) 이후 24-48 시간 볼 수 있었다지만, 세포가 가끔 딸 세포 (그림 1B) 생성, 최대 첨부된 세포 클러스터 미만 2~3주에 대해되었다. 생검에서문화 상품 4 주 동안 8,000 세포 - ING 4-8 인간 fungiform 용의자는 기본 인간 fungiform의 맛을 용의자 전지의 초기 분리는 약 2000에 도달합니다. 추가 3-4주위한 T25 세포 배양 flasks (통로 0)의 확장 (그림 1C) 적응 문화에 인간 fungiform의 맛을 용의자 세포가 발생하게됩니다. 기본 인간 fungiform의 맛을 용의자 전지는 더욱 3-4주 (그림 1D)의 통로-1에 의해 적어도 백만 세포의 이상을 양보하는 문화에 확장 할 수 있습니다. 기본 미각 세포가 이상 8 구절에 대해 계속 증가할 것이다. 문화 교양 인간 fungiform의 맛을 용의자 세포의 형태 교양 chemosensory 세포 비슷했다 이전에 11,12 설명했다 .. 대부분의 교양 인간 fungiform의 맛을 용의자 전지는 최대 15~30일까지 함께 또는 하나 이상의 프로세스없이 세포 기관의 원래 컴팩트한 외관을 유지했습니다. 그들이 합류에게 교양 CE의 대부분을 도달 후재편은 편광-길쭉한 모양을했다. 중년 여인 미각 세포는 여러 가지 histological subtypes 및 전시 미각 세포 특징 구성되어 있습니다. 여기에서 우리는 이러한 문화권 내에서 세포가 성숙 미각 세포의 특성 많은 분자 및 생리 기능을 표시하는 것으로 나타났습니다. Gustducin 및 포스 포 라이 페이스 C - β2, (PLC-β2) mRNA는 반전 transcriptase - 중합 효소 사슬 반응 및 시퀀싱 (그림 2)에 의해 확인된 제품에 의해 감지되었다. gustducin 및 PLC-β2 표현은 immunocytochemically 타입 II와 같은 세포 (B와 D는 각각 그림 3)의 존재를 나타내는 감지되었습니다. 유행과 gustducin 및 PLC-β2 세포 신호 전달 경로와 세포 유형을 반영한 것이 정확하게 생체내을 볼 것을 반영하지 않는의 상대적인 표현 패턴. 미뢰 내에서 다른 세포 유형의 상대적 분포를 지배하는 요인 알 수 있으며, 문화 조건에 복제되지 않을 수 있습니다. 따라서, B<html> 교양 세포들의 생체내의 대응에서이 조작해서 모니터링할 수 있습니다 조건 하에서, 분자 수준에서 이러한 특성의 규정을 검토하는 기회를 제공 사이의 유사점과 차이점을 oth. 모델 시스템에 대한 중요한 기준은 관련 기능적 속성의 존재이다. 교양 세포들은 또한 여러 미각 자극 (그림 4)의 적절한 농도에 대한 응답으로 세포 내 칼슘의 강력한 증가를 전시. 이러한 연구에서는 다정하고 쓰라린 자극은 탈분극에 해당 있습니다 세포내 칼슘의 증가를 유도. 이러한 미각 세포와 같은 교양 세포의 특성은 우리가 여기서 설명하는 모델 시스템이 도입 경로와 인간의 미각 세포의 재생 능력을 더욱 연구를위한 귀중한 자산이 될 것이라는 주장에 지원을 빌려 주다. fig1.jpg &quot;/&gt; 그림 1. 첨부 파일과 교양 인간 fungiform의 맛을 용의자 세포의 형태. 콜라겐 타입-1 코팅 접시에 성장 기본 인간 fungiform의 맛을 용의자 세포 배양은 2 일 () 이후에 몇 군데 있었다. 인간 fungiform의 맛을 용의자 전지는 최대 딸 세포를 야기할 것 같았다 첨부된 세포 클러스터, 아래 4 주 동안 성장했다. 세포는 일반적으로 4 주 (B) 내에서 합류로 증가, 그리고 (C와 D) 수확 각각 reseeding 후 2 일 그리고 4 주를 나타냅니다. 교양 세포는 최소한 8 개월 동안 성장을 계속했다. 스케일 바 = 50 nm의. 그림 1의 일부도 Ozdener 동부 표준시로 표시되었다. 알. 10. <img alt="그림 2" src="/files/ftp_upload/3730/3730fig2.jpg" /> 그림 2. RT-PCR 결과는 특정 미각 세포 biomarker의 mRNAs (gustducin 및 PLC-β2)의 존재를 보여주었다. 교양 인간 fungiform 세포로부터 총 RNA는 역방향 transc였다RT-PCR (Invitrogen)에 윗첨자 첫 스트랜드 합성 시스템을 이용한 ribed하고 gustducin 및 PLC-β2의 검출을위한 구체적인 primers로 증폭하여 PCR에 사용. Primers (표 1) 하나 이상의 introns에 걸쳐하기로했다. 각각의 mRNA는 통로 4 또는 시퀀싱에 의해 확인 예상 크기의 증폭 제품과 5에서 교양 인간 fungiform의 맛을 용의자 세포에서 발견되었다. 특정 mRNA는 더 게놈 DNA의 오염을 나타내는없는 역방향 transcriptase없이 제어 실험에서 검출되지 않았습니다. PCR 제품은 2% 아가로 오스 젤에 별거 중이 젤의 증폭 제품은 면도칼로 excised되었다. DNA가 QIAquick 젤 추출 키트 (Qiagen)을 사용하여 겔에서 추출되었다. PCR 제품은 펜실베니아 장면 시설의 대학에서 순서가되었다. C-PCR 및 C-RT는 각각 PCR 및 역방향 Transcriptase를위한 제어 실험입니다. 그림 2의 일부도 Ozdener 동부 표준시로 표시되었다. 알. <sup&gt; 10. <img alt="그림 3" src="/files/ftp_upload/3730/3730fig3.jpg" /> 그림 3. 교양 인간 fungiform의 맛을 용의자 세포 통로 4 또는 5의 Immunostaining은 미각 세포 생체 존재를 보여주었다. 교양 인간 fungiform의 맛을 용의자 전지 (5 일 이전) 4 ° C.에서 하룻밤 (표 2) 4 % paraformaldehyde로 고정하고, 일차 항체와 incubated되었습니다 이미지 Leica TCS-SP2 공촛점 레이저 스캐닝 현미경과 함께 인수했다. 약, 교양 fungiform의 맛을 용의자 세포의 60 %가 gustducin (B) 및 PLC-β2 (D)와 20~30%으로 표시되었습니다. 해당 셀의 전송 이미지는 (A와 C) 표시됩니다. 컨트롤이 들어, 특정 면역 글로불린 항체와 immunostaining 것은 특이 현상 immuno의 반응성 (데이터가 표시되지 않음)의 부재를 보여주었다. 스케일 바 = 50 nm의. 부분그림 3은 역시 Ozdener 동부 표준시로 표시되었다. 알. 10. <img alt="그림 4" src="/files/ftp_upload/3730/3730fig4.jpg" /> 통로 4 또는 5에서 그림 4. 교양 인간 fungiform의 맛을 용의자 세포는 다른 자극에 반응한다. 교양 인간 fungiform의 맛을 용의자 전지 (4-​​5일 이전) 1mM Fura-2 AM (분자 프로브) 및 10 밀리그램 / ML Pluronic F127 (분자 프로브)로로드했습니다. 교양 인간 fungiform의 맛을 용의자 세포에서 세포 내 칼슘 수준 ([칼슘 2 +] I)의 변경은 표준 수동 이미징 기술을 이용하여 측정되었다. 전지는 340 나노미터와 380 나노미터의 여기 파장의 간접 형광 현미경과 510 nm의 중심 밴드 패스 필터가 정한 방출 파장을 사용하여 시각 있었다. 필요하면 자극이 목욕 용액에 용해 후 산도와 osmolarity 재조정되었다. 교양 인간 fungiform의 맛을 용의자 전지는 달콤한 쓴맛 자극에 응답했습니다. Graphs은 [카 2]의 대표적인 반응을 보여주는에 노출 (A) Denatonium (2 ㎜), (B) Sucralose (1 ㎜) 중 개별 셀의 I 수준. 각 성분은 하나의 개별 셀을 나타냅니다. <table border="1"><tbody><tr><td> 유전자 </td><td> 순서 </td><td colspan="2"> PCR 조건 </td><td> 예상 크기 (BP) </td><td> 참고 </td></tr><tr><td> β-Actin </td><td> GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG </td><td> 7 분 45 초 45 초 45 초 7 분 </td><td> 95 94 53 72 72 </td><td> 234 </td><td> NM_001101.3 </td></tr><tr><td> Gustducin </td><td> TCTGGGTATGTGCCAAATGA GGCCCAGTGTATTCTGGAAA </td><td> 7 분 45 초 45 초 45 초 7 분 </td><td> 95 94 53 72 72 </td><td> 386 </td><td> NM_001102386 </td></tr><tr><td> PLC-β2 </td><td> GTCACCTGAAGGCATGGTCT TTAAAGGCGCTTTCTGCAAT </td><td> 3 분 30 초 30 초 60 초 7 분 </td><td> 95 94 53 72 72 </td><td> 333 </td><td> NM_004573 </td></tr></tbody></table> 표 1. 맛이 특정 분자를 검출에 사용 Primers 및 조건. <table border="1"><tbody><tr><td> 일차 항체 </td><td> 출처 </td><td> 숙주 </td><td> 묽게 함 </td><td> 이차 항체 </td><td> 출처 </td><td> 숙주 </tD&gt; <td> 묽게 함 </td></tr><tr><td> Gustducin </td><td> SantaCruz </td><td> 토끼 </td><td> 1:500 </td><td> 안티 - 토끼 IgG 알렉사 633 </td><td> 분자 프로브 </td><td> 염소 </td><td> 1:500 </td></tr><tr><td> PLC-β 2 </td><td> SantaCruz </td><td> 토끼 </td><td> 1:500 </td><td> 안티 - 토끼 IgG 알렉사 633 </td><td> 분자 프로브 </td><td> 염소 </td><td> 1:500 </td></tr></tbody></table> 표 2. 항체가 특정 분자의 표현을 감지를 위해 사용됩니다.

<ol>
	<li>Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ+cultures+of+embryonic+rat+tongue+support+tongue+and+gustatory+papilla+morphogenesis+in+vitro+without+intact+sensory+ganglia.">Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia.</a> J. Comp. Neurol. 377, 324-340 (1997).</li><li>Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain+difference+in+amiloride-sensitivity+of+salt-induced+responses+in+mouse+non-dissociated+taste+cells.">Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells.</a> Neurosci. Lett. 277, 13-16 (1999).</li><li>Caicedo, A., Jafri, M. S., Roper, S. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+Ca2++imaging+reveals+neurotransmitter+receptors+for+glutamate+in+taste+receptor+cells.">In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells.</a> J. Neurosci. 20, 7978-7985 (2000).</li><li>Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+method+to+obtain+cells+of+taste+buds+from+fungiform+papillae+of+mice.">A reliable method to obtain cells of taste buds from fungiform papillae of mice.</a> Acta Histochem. 112, 107-112 (2010).</li><li>Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+isolating+and+patch-clamping+single+mammalian+taste+receptor+cells.">A method for isolating and patch-clamping single mammalian taste receptor cells.</a> Brain Res. 503, 326-329 (1989).</li><li>Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+culture+of+rat+taste+bud+cells+that+retain+molecular+markers+for+taste+buds+and+permit+functional+expression+of+foreign+genes.">Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes.</a> Neuroscience. 106, 217-225 (2001).</li><li>Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+rat+taste+buds+in+primary+culture.">Maintenance of rat taste buds in primary culture.</a> Chem. Senses. 26, 861-873 (2001).</li><li>Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+lineage+relationships+in+taste+buds.">Analysis of cell lineage relationships in taste buds.</a> J. Neurosci. 22, 4522-4529 (2002).</li><li>Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+long-term+maintenance+of+rat+taste+cells+in+culture.">Characterization and long-term maintenance of rat taste cells in culture.</a> Chem. Senses. 31, 279-290 (2006).</li><li>Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Human+Fungiform+Papillae+Cells+in+Culture.">Characterization of Human Fungiform Papillae Cells in Culture.</a> Chem. Senses. 36, 601-612 (2011).</li><li>Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characteristics+of+odorant+elicited+calcium+changes+in+cultured+human+olfactory+neurons.">Characteristics of odorant elicited calcium changes in cultured human olfactory neurons.</a> J. Neurosci. Res. 62, 737-749 (2000).</li><li>Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+culture+of+neuronal+cells+from+adult+human+olfactory+epithelium.">Continuous culture of neuronal cells from adult human olfactory epithelium.</a> J. Mol. Neurosci. 3, 137-146 (1992).</li><li>Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomal+comparison+of+human+dermal+lymphatic+endothelial+cells+ex+vivo+and+in+vitro.">Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro.</a> Physiol. Genomics. 17, 179-192 (2007).</li><li>Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+neural+stem+cells+from+mesenchymal+stemcells:+evidence+for+a+bipotential+stem+cell+population.">Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population.</a> Stem Cells Dev. 17, 1109-1121 (2008).</li><li>Sandow, S. L., Grayson, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limits+of+isolation+and+culture:+intact+vascular+endothelium+and+BKCa.">Limits of isolation and culture: intact vascular endothelium and BKCa.</a> Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).</li></ol>

관심의 어떠한 충돌 선언 없습니다.

우리는 12 개월 기간을 걸치는, 8 이상의 구절에 대한 인간의 fungiform의 맛을 용의자로부터 얻은 세포를 유지했습니다. 이러한 문화들은 미각 수용체 세포의 핵심 분자 및 생리 학적 특성 이외에, 성숙한 미뢰 세포 유형의 여러 마커를 표현할 수있는 무대 체외에서 성숙 많은 중 새로운 세포를 생성합니다. 의 존재 gustducin 및 PLC-β2 교양 세포의 하위 집합에 immunoreactivity이 결론과 일치합니다. ...

<table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td></tr><tr><td> MCDB 123 </td><td> 시그마 - 올드 리치 </td></tr><tr><td> Iscove의 DMEM 매체 </td><td> MediaTech </td></tr><tr><td> 엘라스타제 </td><td> 시그마 - 올드 리치 </td></tr><tr><td> Pronase 전자 </td><td> 시그마 - 올드 리치 </td></tr><tr><td> 엘라스타제 </td><td> 워딩턴 </td></tr><tr><td> 콩 콩 트립신 억제제 </td><td> 워딩턴 </td></tr><tr><td> Collagenase의 제 1 형 </td><td> 워딩턴 </td></tr><tr><td> 쥐의 꼬리 콜라겐 제 1 형 </td><td> BD 과학 </td></tr><tr><td> Fura - 오전 2시 </td><td> 분자 프로브 </td></tr><tr><td> RT-PCR을위한 윗첨자 최초 스트랜드 합성 시스템 </td><td> Invitrogen </td></tr><tr><td> Leica TCS SP2의 스펙트럼 공촛점 현미경 </td><td> Leica 마이크로 시스템즈 주식 회사 </TD&gt; </tr><tr><td> 디스커버리-1 영상 역과 Metamorph 소프트웨어 </td><td> 분자 장치 </td></tr><tr><td> 작은 미세 팁 포셉 및 엑스트라 봄날의 가위 </td><td> 파인 과학 도구 </td></tr></tbody></table>

isolation and culture of human fungiform taste papillae cells

미각 세포는 음식에 포함된 간단한 자극하고 복잡한 화학 분자의 광범위한 감지를 허용 독특한 histological, 분자 및 생리 특성으로 고도의 전문입니다. 인간, 개별 fungiform의 용의자에서 제로로부터 많은 20 등 입맛에 포함되어 있습니다. 여러 세포주기위한 문화의 맛을 용의자 세포를 유지하는 능력이 독특한 감각 세포, 분자 재생 및 기능적 특성을 특성화를 위해 상당한 유틸리티 될 비록 culturing 인간의 미각 세포에 대한 설립 프로토콜은 없습니다. 미각 세포의 이전 연구는 일차 문화, 설치류에서 explant 문화, 또는 조직 조각 1,2,3,4의 세미 그대로 입맛에 갓 고립된 세포를 사용하여 수행되었습니다. 이러한 준비는 각각 장점이 있지만, 장기적인 문화의 발전은 특히 미각 세포 증식과 diffe의 연구를 위해 상당한 이점을 제공했을rentiation. 우리를 포함하여 몇몇 그룹은, 미각 세포 배양 모델의 개발 및 구축에 관심이 있었다. 문화 미각 세포에 대한 대부분의 시도는 3-5 D 5,6,7,8 이후 일반적으로 지속하지 세포와 제한된 생존을보고했습니다. 우리는 최근 쥐 미각 세포 9 확장된 문화를위한 성공적인 방법에보고했다. 우리는 여기서 처음 격리된 인간 fungiform의 맛을 용의자 세포에 대한 체외 배양 시스템의 설립에 대해보고합니다. 생검에 의해 얻은 인간 fungiform 용의자의 세포가 성공적으로 생존 능력의 손실없이 더보다 여덟 구절 (12 개월) 동안 문화를 유지했다. 세포는 성숙한 미각 세포의 특징 많은 분자 및 생리 기능을 표시합니다. Gustducin 및 포스 포 라이 페이스 C β2 (PLC-β2) mRNA는 반전 transcriptase - 중합 효소 사슬 반응에 의해 여러 세포에서 감지하고 시퀀싱에 의해 확인되었다. Immunocytochemistry 분석 돌풍의 존재를 증명교양 미각 세포의 ducin 및 PLC-β2 표현. 교양 인간 fungiform 세포는 또한 미각 수용체와 신호 전달 경로 중 적어도 일부는 현재의 것을 나타내는 여러 미각 자극의 적절한 농도에 대한 응답으로 세포 내 칼슘의 증가를 전시. 이러한 결과는 충분히 성인 인간의 미각 세포가 생성하고 적어도 8 구절 지속 돼 있음을 나타냅니다. 세포의 많은 모델 맛을 시스템으로의 사용을 지원하는 성인 취향의 상피에서 심하게 격리 세포의 생리 및 생화 학적 특성을 유지합니다. 이 시스템은 체외 준비에의 포유류의 미각 수용체 세포의 증식, 분화 및 기능에 관련된 프로세스의 추가 연구를 가능하게합니다. 인간 fungiform 셀 문화 확립을 위해 사용되는 휴먼 fungiform의 맛을 용의자가 검토되었다 연구 프로토콜 아래에서 적절한 정보를 동의에 따라 연구를 위해 기증했다그리고 IRB위원회에 의해 승인했다. 프로토콜 (# 0934)는 Schulman 어소 기관 검토위원회 주식, 신시내티, OH에 의해 승인되었습니다. 아래 글 프로토콜은 Ozdener 외 의해 보고된 출판 매개 변수를 기반으로합니다. 2011 10.

Watch this Scientific Journal Video about Isolation and Culture of Human Fungiform Taste Papillae Cells at JoVE.com

Isolation and Culture of Human Fungiform Taste Papillae Cells

우리는 인간의 fungiform의 맛을 용의자 전지의 장기 문화를 분리하고 관리하기위한 재현성 프로토콜을 개발하기위한. 생검에 의해 얻은 인간 fungiform 용의자의 세포가 성공적으로 생존 능력의 손실없이 더보다 여덟 구절 (12 개월) 동안 문화를 유지했다.

인간 Fungiform의 맛 용의자 전지의 분리 및 문화

Taste cells are highly specialized, with unique histological, molecular and physiological characteristics that permit detection of a wide range of simple ...

isolation-and-culture-of-human-fungiform-taste-papillae-cells

Research

JoVE Journal

Neuroscience

14.3K 조회수.  Monell Chemical Senses Center. 우리는 인간의 fungiform의 맛을 용의자 전지의 장기 문화를 분리하고 관리하기위한 재현성 프로토콜을 개발하기위한. 생검에 의해 얻은 인간 fungiform 용의자의 세포가 성공적으로 생존 능력의 손실없이 더보다 여덟 구절 (12 개월) 동안 문화를 유지했다.

비디오: Isolation and Culture of Human Fungiform Taste Papillae Cells

Isolation and Culture of Neural Crest Stem Cells from Human Hair Follicles

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a well-characterized niche for adult stem cells1. This segment of the outer root sheath contains a number of different types of stem cells, including epithelial stem cells2, melanocyte stem cells3 and neural crest like stem cells4-7. Hair follicles represent an accessible and rich source for different types of human stem cells. We and others have isolated neural crest stem cells (NCSCs) from human fetal and adult hair follicles4,5. These human stem cells are label-retaining cells and are capable of self-renewal through asymmetric cell division in vitro. They express immature neural crest cell markers but not differentiation markers. Our expression profiling study showed that they share a similar gene expression pattern with murine skin immature neural crest cells. They exhibit clonal multipotency that can give rise to myogenic, melanocytic, and neuronal cell lineages after in vitro clonal single cell culture. Differentiated cells not only acquire lineage-specific markers but also demonstrate appropriate functions in ex vivo conditions. In addition, these NCSCs show differentiation potential toward mesenchymal lineages. Differentiated neuronal cells can persist in mouse brain and retain neuronal differentiation markers. It has been shown that hair follicle derived NCSCs can help nerve regrowth, and they improve motor function in mice transplanted with these stem cells following transecting spinal cord injury8. Furthermore, peripheral nerves have been repaired with stem cell grafts9, and implantation of skin-derived precursor cells adjacent to crushed sciatic nerves has resulted in remyelination10. Therefore, the hair follicle/skin derived NCSCs have already shown promising results for regenerative therapy in preclinical models.
Somatic cell reprogramming to induced pluripotent stem (iPS) cells has shown enormous potential for regenerative medicine. However, there are still many issues with iPS cells, particularly the long term effect of oncogene/virus integration and potential tumorigenicity of pluripotent stem cells have not been adequately addressed. There are still many hurdles to be overcome before iPS cells can be used for regenerative medicine. Whereas the adult stem cells are known to be safe and they have been used clinically for many years, such as bone marrow transplant. Many patients have already benefited from the treatment. Autologous adult stem cells are still preferred cells for transplantation. Therefore, the readily accessible and expandable adult stem cells in human skin/hair follicles are a valuable source for regenerative medicine.

This article presents a robust protocol for isolation and culture of neural crest stem cells from human hair follicles.

인간의 모공에서 신경 크레스트 줄기 세포의 분리와 문화

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a ...

연구

신경과학

Isolation and Expansion of Human Glioblastoma Multiforme Tumor Cells Using the Neurosphere Assay

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in glioblastoma mutliforme (GBM), is to identify and isolate tumor initiating cell population(s) to investigate their role in tumor formation, progression, and recurrence. Understanding tumor initiating cell populations will provide clues to finding effective therapeutic approaches for these tumors. The neurosphere assay (NSA) due to its simplicity and reproducibility has been used as the method of choice for isolation and propagation of many of this tumor cells. This protocol demonstrates the neurosphere culture method to isolate and expand stem-like cells in surgically resected human GBM tumor tissue. The procedures include an initial chemical digestion and mechanical dissociation of tumor tissue, and subsequently plating the resulting single cell suspension in NSA culture. After 7-10 days, primary neurospheres of 150-200 &mu;m in diameter can be observed and are ready for further passaging and expansion.

This video protocol demonstrates the isolation and expansion of stem like cells from surgically resected human glioblastoma mutliforme (GBM) tumor tissue using the neurosphere assay culture method.

분리 및 Neurosphere 분석을 사용하여 인간 Glioblastoma의 Multiforme 종양 세포의 확장

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in ...

Isolation and Culture of Rat Embryonic Neural Cells: A Quick Protocol

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied successfully to the isolation of mouse and human primary neurons and neural progenitors. Dissociated neurons are maintained in serum-free medium up to several weeks. These cultures can be used for nucleofection, immunocytochemistry, nucleic acids preparation, as well as electrophysiology. Older neuronal cultures can also be transfected with a good efficiency rate by lentiviral transduction and, less efficiently, with calcium phosphate or lipid-based methods such as lipofectamine.

We describe a rapid methodology to isolate and culture hippocampal and cortical neurons from rodent embryos. This protocol allows us to perform experiments in which nearly pure neuronal cultures are required.

쥐 배아 신경 세포의 분리 및 문화 : 빠른 프로토콜

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied ...

Isolation and Culture of Neural Crest Cells from Embryonic Murine Neural Tube

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to mesenchymal transition (EMT) and migrates throughout the embryo, giving rise to diverse cell types 1-3. NC also has the unique ability to influence the differentiation and maturation of target organs4-6. When explanted in vitro, NC progenitors undergo self-renewal, migrate and differentiate into a variety of tissue types including neurons, glia, smooth muscle cells, cartilage and bone. 
NC multipotency was first described from explants of the avian neural tube7-9. In vitro isolation of NC cells facilitates the study of NC dynamics including proliferation, migration, and multipotency. Further work in the avian and rat systems demonstrated that explanted NC cells retain their NC potential when transplanted back into the embryo10-13. Because these inherent cellular properties are preserved in explanted NC progenitors, the neural tube explant assay provides an attractive option for studying the NC in vitro. 
To attain a better understanding of the mammalian NC, many methods have been employed to isolate NC populations. NC-derived progenitors can be cultured from post-migratory locations in both the embryo and adult to study the dynamics of post-migratory NC progenitors11,14-20, however isolation of NC progenitors as they emigrate from the neural tube provides optimal preservation of NC cell potential and migratory properties13,21,22. Some protocols employ fluorescence activated cell sorting (FACS) to isolate a NC population enriched for particular progenitors11,13,14,17. However, when starting with early stage embryos, cell numbers adequate for analyses are difficult to obtain with FACS, complicating the isolation of early NC populations from individual embryos. Here, we describe an approach that does not rely on FACS and results in an approximately 96% pure NC population based on a Wnt1-Cre activated lineage reporter23. 
The method presented here is adapted from protocols optimized for the culture of rat NC11,13. The advantages of this protocol compared to previous methods are that 1) the cells are not grown on a feeder layer, 2) FACS is not required to obtain a relatively pure NC population, 3) premigratory NC cells are isolated and 4) results are easily quantified. Furthermore, this protocol can be used for isolation of NC from any mutant mouse model, facilitating the study of NC characteristics with different genetic manipulations. The limitation of this approach is that the NC is removed from the context of the embryo, which is known to influence the survival, migration and differentiation of the NC2,24-28.

Isolation of embryonic neural crest from the neural tube facilitates the use of in vitro methods for studying migration, self-renewal, and multipotency of neural crest.

배아 Murine 신경 튜브에서 신경 크레스트 세포의 분리 및 문화

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to ...

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

마우스 두피 Astrocytes의 분리와 문화

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

배아 전뇌에서 내피 세포의 분리 및 문화

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Denver Papillae Protocol for Objective Analysis of Fungiform Papillae

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure consistent scoring between scorers. This protocol builds off of a need that has arisen from the last two decades of taste research using FP as a proxy for taste pore density. FP density has historically been analyzed using Miller &#38; Reedy&#8217;s 1990 characterizations of their morphology: round, stained lighter, large, and elevated. In this work, the authors forewarned that stricter definitions of FP morphology needed to be outlined. Despite this call to action, follow up literature has been scarce, with most studies continuing to cite Miller &#38; Reedy&#8217;s original work. Consequently, FP density reports have been highly variable and, combined with small sample sizes, may contribute to the discrepant conclusions on the role of FP in taste sensitivity. The Genetics of Taste Lab explored this apparent inconsistency in counting and found that scorers were individually prioritizing the importance of these characteristics differently and had no guidance for when a papilla had some, but not all, of the reported qualities of FP. The result of this subjectivity is highly variable FP counts of the same tongue image. The Denver Papillae Protocol has been developed to remedy this consequence through use of a dichotomous key that further defines and prioritizes the importance of the characteristics put forth by Miller &#38; Reedy. The proposed method could help create a standard way to quantify FP for researchers in the field of taste and nutritional studies.

Here we present a protocol to measure fungiform papilla density from digital photographs. This method builds prioritization and objective characteristic metrics into the original descriptive work on fungiform papillae by Miller &#38; Reedy (1990).

Fungiform 용의자 객관적인 분석을위한 덴버 유두 프로토콜

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure ...

Isolation and Culture of Adult Neural Stem Cells from the Mouse Subcallosal Zone

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation into three types of cells: neurons, astrocytes, and oligodendrocytes. Identifying aNSC-derived regions and characterizing the aNSC properties are critical for the potential use of aNSCs and for the elucidation of their role in neural regeneration. The subcallosal zone (SCZ), located between white matter and the hippocampus, has recently been reported to contain aNSCs and continuously give rise to neuroblasts. A low percentage of aNSCs from the SCZ is differentiated into neurons; most cells are differentiated into glial cells, such as oligodendrocytes and astrocytes. These cells are suggested to have a therapeutic potential for traumatic cortical injury. This protocol describes in detail the process to generate SCZ-aNSCs from an adult mouse brain. A brain matrix with intervals of 1 mm is used to obtain the SCZ-containing coronal slices and to precisely dissect the SCZ from the whole brain. The SCZ sections are initially subjected to a neurosphere culture. A well-developed culture system allows for the verification of their characteristics and can increase research on NSCs. A neurosphere culture system provides a useful tool for determining proliferation and collecting the genuine NSCs. A monolayer culture is also an in vitro system to assay proliferation and differentiation. Significantly, this culture system provides a more homogenous environment for NSCs than the neurosphere culture system. Thus, using a discrete brain region, these culture systems will be helpful for expanding our knowledge about aNSCs and their applications for therapeutic uses.

Establishing culture systems for the expansion of adult neural stem cells (aNSCs) allows for the examination and application of aNSCs for therapy. The subcallosal zone (SCZ) has recently been recognized as a novel neuroblast-forming region in adult mice. Here, methods for the isolation, expansion, and differentiation of SCZ-aNSCs are described.

마우스 뇌량 밑 영역에서의 분리 및 성인 신경 줄기 세포의 문화

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation ...

Isolation and Culture of Embryonic Mouse Neural Stem Cells

Neural stem cells (NSCs) are multipotent and can give rise to the three major cell types of the central nervous system (CNS). In vitro culture and expansion of NSCs provide a suitable source of cells for neuroscientists to study the function of neurons and glial cells along with their interactions. There are several reported techniques for the isolation of neural stem cells from adult or embryo mammalian brains. During the microsurgical operation to isolate NSCs from different regions of the embryonic CNS, it is very important to reduce the damage to the brain cells to obtain the highest ratio of live and expandable stem cells. A possible technique for stress reduction during isolation of these cells from the mouse embryo brain is the reduction of surgical time. Here, we demonstrate a developed technique for rapid isolation of these cells from the E13 mouse embryo ganglionic eminence. Surgical procedures include harvesting E13 mouse embryos from the uterus, cutting the frontal fontanelle of the embryo with a bent needle tip, extracting the brain from the skull, microdissection of the isolated brain to harvest the ganglionic eminence, dissociation of the harvested tissue in NSC medium to gain a single cell suspension, and finally plating cells in suspension culture to generate neurospheres.

Here, we introduce a novel microsurgical technique for the isolation of neural stem cells from the E13 mouse embryo ganglionic eminence.

절연 및 마우스 배아 신경 줄기 세포의 문화

Neural stem cells (NSCs) are multipotent and can give rise to the three major cell types of the central nervous system (CNS). In vitro culture and ...

Isolation and Culture of Chick Ciliary Ganglion Neurons

Chick ciliary ganglia (CG) are part of the parasympathetic nervous system and are responsible for the innervation of the muscle tissues present in the eye. This ganglion is constituted by a homogenous population of ciliary and choroidal neurons that innervate striated and smooth muscle fibers, respectively. Each of these neuronal types regulate specific eye structures and functions. Over the years, neuronal cultures of the chick ciliary ganglia were shown to be effective cell models in the study of muscle-nervous system interactions, which communicate through cholinergic synapses. Ciliary ganglion neurons are, in its majority, cholinergic. This cell model has been shown to be useful comparatively to previously used heterogeneous cell models that comprise several neuronal types, besides cholinergic. Anatomically, the ciliary ganglion is localized between the optic nerve (ON) and the choroid fissure (CF). Here, we describe a detailed procedure for the dissection, dissociation and in vitro culture of ciliary ganglia neurons from chick embryos. We provide a step-by-step protocol in order to obtain highly pure and stable cellular cultures of CG neurons, highlighting key steps of the process. These cultures can be maintained in vitro for 15 days and, hereby, we show the normal development of CG cultures. The results also show that these neurons can interact with muscle fibers through neuro-muscular cholinergic synapses.

Chick ciliary ganglia (CG) are part of the parasympathetic nervous system. Neuronal cultures of chick CG neurons were shown to be effective cell models in the study of nerve muscle interactions. We describe a detailed protocol for the dissection, dissociation and in vitro culture of CG neurons from chick embryos.

독실성 신경절 뉴런의 고립과 문화

Chick ciliary ganglia (CG) are part of the parasympathetic nervous system and are responsible for the innervation of the muscle tissues present in the ...