We thank Aimee Myers and Esi Quayson for technical skills and help. This work was supported in part by NSF 0216310 and Givaudan Inc grant (NER).

1. Obtaining Human Fungiform Taste Papillae
<ol>
 <li>Remove four to eight human fungiform taste papillae from the dorsal surface of the anterior portion of the tongue using curved spring microscissors.</li>
 <li>Place immediately into an isolation solution (26 mM NaHCO3, 2.5 mM NaH2PO4, 20 mM glucose, 65 mM NaCl, 20 mM KCl, and 1 mM EDTA dissolved in nuclease-free water and filter sterilized).</li>
</ol>
2. Human Fungiform Taste Papillae Digestion
Human fungiform taste cell papillae can be dissociated using two different enzymatic digestion protocols with slight differences.
<ol>
 <li>Incubate fungiform papillae in isolation solution with pronase (1 mg/ml, Sigma Aldrich) and elastase (1 mg/ml Sigma Aldrich) at room temperature for 30-45 min (protocol 1).</li>
 <li>Incubate fungiform papillae with Collagenase type I (550 U/mL, from Worthington) + elastase (10 U/mL, from Worthington) + Trypsin inhibitor (0.9 mg/mL, from Worthington) in 2 ml calcium free Ringer solution in 35 &deg;C water bath with circulation for 30 minutes and gentle oxygenation with 95% O2 / 5% CO2. (Alternative method for digestion, protocol 2)</li>
 <li>After incubation, wash papillae with ringer and triturate the papillae with fire polished glass Pasteur pipette for 10 times.</li>
 <li>Centrifuge it for 3 minutes at 2500 rpm at RT and remove isolation solution and add 1 ml of taste cell culture medium.</li>
 <li>Transfer digested fungiform papillae into glass dish.</li>
 <li>Dissect fungiform papillae gently with surgical razor.</li>
 <li>Add 250 &mu;l of dissected papillae into cloning cylinder onto rat tail collagen type-1 coated coverslip.</li>
 <li>Add 1 ml of taste cell culture medium into each well.</li>
</ol>
3. Culturing of Human Fungiform Taste Papillae Cells
<ol>
 <li>Incubate plate at 36 &deg;C in a humidified incubator containing 5% CO2.</li>
 <li>Place in an incubator undisturbed for 2 days prior to the first change of complete medium. Taste cells will eventually bind to the coated coverslip, although it may not be clearly visible in 1 to 3 days.</li>
 <li>Remove cloning cylinder from plate and medium completely and add 1 ml of taste cell medium into each well.</li>
 <li>Replace 1/3 of medium every 6-7 days. Do not change medium more often and/or completely.</li>
 <li>Check cell growth under microscope every other day. Most of the new cells grow underneath cell clusters. Cell clusters usually detach after 2-3 weeks in culture leaving the newly generated cells.</li>
 <li>Once 40-50% of the cloning cylinder is covered in expanding taste cells, trypsinize cells using 0.25% w/v trypsin/EDTA for 2-3 minutes at 36 &deg;C.</li>
 <li>Transfer cells from wells into 15 ml tubes, add 3 volumes of taste cell culture medium followed by centrifugation at 3000 rpm for 5 minutes at room temperature.</li>
 <li>Remove supernatant and resuspend cells with 1 ml of taste cell medium.</li>
</ol>
4. Propagation of Human Fungiform Taste Papillae Cells
<ol>
 <li>Transfer cells into T25 plate and add 4 ml of taste cell medium (passage 0). Maintain cells at 36 &deg;C in a humidified incubator containing 5% CO2.</li>
 <li>Replace 1/3 of medium every 6-7 days until cultured taste cells have reached 100% confluence. At this time, to enable taste cells to harvest, wash cells once with sterile PBS then trypsinize cells using 0.25% w/v trypsin/EDTA for 2-3 minutes at 36 &deg;C.</li>
 <li>After centrifugation as described above, resuspend in complete taste cell medium and transfer cells to fresh T-75 flasks (passage 1).</li>
 <li>Replace 1/3 of medium every 6-7 days. Do not change medium more often and/or completely.</li>
 <li>Repeat step 4.3 and 4.4 when cells have reached close to 100% confluence. Split cells to no more than 1:4 dilution in a T75 flask for maintaining adequate growth of the cells over time.</li>
</ol>
5. Freezing and Thawing Cultured Human Fungiform Taste Papillae Cells
<ol>
 <li>To freeze stocks of primary taste cells, after trypsinization (step 4.2), add 3 ml complete taste cell medium and transfer cells to sterile 15 ml conical centrifuge tubes. Centrifuge at 2500 rpm for 5 min at room temperature.</li>
 <li>Carefully remove the supernatant and gently resuspend cells with appropriate volume of freezing medium containing 95% Fetal Bovine serum (FBS) and 5% DMSO.</li>
 <li>Transfer cells to labeled, sterile cryovials, cap tightly, and place in a freezing container containing isopropanol. Place into a -80 &deg;C freezer for at least one day prior to transferring indefinitely to liquid nitrogen.</li>
 <li>To thaw a vial of frozen primary human fungiform taste papillae cells, place at 37 &deg;C water bath until just thawed (approximately 1 minute), while working in a laminar-flow cell culture hood.</li>
 <li>Transfer cells and freezing medium to a sterile 15 ml conical centrifuge tube and add 5 ml of taste cell culture medium.</li>
 <li>Centrifuge cells at 2500 rpm for 5 min at room temperature. Carefully discard supernatant, gently resuspend cells with complete taste cell culture medium, and transfer to a sterile T-25 tissue culture flask.</li>
 <li>Continue to culture cells according to Step 3 to 4.</li>
</ol>
6. Representative Results
Attempts to grow taste biopsies in culture were successful 90% of the time. A few days after biopsy and dissociation, cells typically began to grow and migrate outwards from the pieces of dissected fungiform tissue that remained after the dissociation procedure. Although individual cells were visible 24-48 hr after plating (Figure 1A), cells grew for up to 2-3 weeks under attached cell clusters, occasionally generating daughter cells (Figure 1B). From biopsying 4-8 human fungiform papillae, initial isolates of primary human fungiform taste papillae cells reach approximately 2000 - 8000 cells in 4 weeks in culture. Expansion in T25 cell culture flasks (passage 0) for additional 3-4 weeks will result in having human fungiform taste papillae cells in culture adapted (Figure 1C). Primary human fungiform taste papillae cells can be further expanded in culture to yield upwards of at least a million cells by passage-1 in 3-4 weeks (Figure 1D). Primary taste cells will continue to grow for more than 8 passages.
The morphology of the cultured human fungiform taste papillae cells in culture was similar to cultured chemosensory cells described previously11,12.. Most cultured human fungiform taste papillae cells maintained their original compact appearance of cell bodies with or without one or more processes up to 15-30 days. After they reached confluence most of the cultured cells had a polarized-elongated appearance. Mature taste cells consist of several different histological subtypes and exhibit taste cell specific features. Here we show that cells within these cultures display many molecular and physiological features characteristic of mature taste cells. Gustducin and phospholipase C - &beta;2, (PLC-&beta;2) mRNA were detected by reverse transcriptase-polymerase chain reaction and products confirmed by sequencing (Figure 2). Expression of gustducin and PLC-&beta;2 was detected immunocytochemically indicating the presence of type II-like cells (Figure 3 B and D respectively). The prevalence and relative expression patterns of gustducin and PLC-&beta;2 reflecting cell signaling pathways and cell types does not precisely reflect that seen in vivo. The factors governing the relative distribution of different cell types within a taste bud are unknown, and may not be replicated in the culture conditions. Therefore, both the similarities and differences between the cultured cells and their in vivo counterparts provide an opportunity to examine the regulation of these characteristics at a molecular level, under conditions which can be manipulated and monitored.
An important criterion for a model system is the presence of relevant functional properties. Cultured cells also exhibited robust increases in intracellular calcium in response to appropriate concentrations of several taste stimuli (Figure 4). In these studies, sweet and bitter stimuli elicit an increase in intracellular calcium that may correspond to a depolarization. These taste cell-like properties of the cultured cells lend support to the assertion that the model system we describe here will be a valuable asset for further studies of the transduction pathways and regenerative capacity of human taste cells.
<img alt="Figure 1" src="/files/ftp_upload/3730/3730fig1.jpg" /> 
Figure 1. Attachment and morphology of cultured human fungiform taste papillae cells. Primary human fungiform taste papillae cell cultures grown on collagen type-1 coated plates were imaged after 2 days (A). Human fungiform taste papillae cells grew for up to 4 weeks under attached cell clusters, which seemed to give rise to daughter cells. The cells typically grew to confluence within four weeks (B), and (C and D) represents day 2 and 4 weeks after harvesting and reseeding respectively. Cultured cells continued to grow for at least 8 months. Scale bars = 50 nm. Part of Figure 1 was also presented in Ozdener et. al.10.
<img alt="Figure 2" src="/files/ftp_upload/3730/3730fig2.jpg" /> 
Figure 2. RT-PCR results demonstrated the presence of specific taste cell biomarker mRNAs (gustducin and PLC-&beta;2,). Total RNA from cultured human fungiform cells was reverse transcribed using the Superscript First Strand Synthesis System for RT-PCR (Invitrogen) and used for PCR by amplifying with specific primers designed for detection of gustducin and PLC-&beta;2. Primers (Table 1) were chosen to span one or more introns. Each mRNA was detected in cultured human fungiform taste papillae cells from passage 4 or 5 with amplification products of the expected size, confirmed by sequencing. Specific mRNA was not detected in control experiments without reverse transcriptase indicating no genomic DNA contamination. PCR products were separated on 2% agarose gels and the amplified products on the gel were excised with a razor. DNA was extracted from the gel using QIAquick Gel Extraction Kit (Qiagen). PCR products were sequenced at the University of Pennsylvania Sequencing facilities. C-PCR and C-RT are control experiments for PCR and Reverse Transcriptase, respectively. Part of Figure 2 was also presented in Ozdener et. al.10.


<img alt="Figure 3" src="/files/ftp_upload/3730/3730fig3.jpg" /> 
Figure 3. Immunostaining of cultured human fungiform taste papillae cells passage 4 or 5 showed presence of taste cell biomarkers. Cultured human fungiform taste papillae cells (5 days old) were fixed with 4% paraformaldehyde, and incubated with primary antibodies (Table 2) overnight at 4 &deg;C. Images were acquired with a Leica TCS-SP2 confocal laser scanning microscope. Approximately, 60% of cultured fungiform taste papillae cells were labeled with gustducin (B) and 20-30 % with PLC-&beta;2 (D). Transmission images of corresponding cells are shown (A and C). For controls, immunostaining with antibody specific immunoglobulin demonstrated the absence of nonspecific immuno reactivity (data not shown). Scale bars = 50 nm. Part of Figure 3 was also presented in Ozdener et. al.10.
<img alt="Figure 4" src="/files/ftp_upload/3730/3730fig4.jpg" /> 
Figure 4. Cultured human fungiform taste papillae cells from passage 4 or 5 respond to different stimuli. Cultured human fungiform taste papillae cells (4-5 days old) were loaded with 1mM Fura-2 AM (Molecular Probes) and 10 mg/ml Pluronic F127 (Molecular Probes). Changes in intracellular calcium levels ([Ca2+]i) in cultured human fungiform taste papillae cells were measured using standard manual imaging techniques. The cells were visualized using an inverted fluorescence microscope at excitation wavelengths of 340 nm and 380 nm and an emission wavelength set by a band pass filter centered at 510 nm. Stimuli were dissolved in Bath solution and then pH and osmolarity readjusted if needed. Cultured human fungiform taste papillae cells responded to sweet and bitter stimuli. Graphs illustrate representative responses of [Ca+2]i levels in individual cells during exposure to (A) Denatonium (2 mM), (B) Sucralose (1 mM). Each trace represents single individual cells.


<table border="1">
<tbody>
 <tr>
 <td>Gene </td>
 <td>Sequence </td>
 <td colspan="2">PCR condition </td>
 <td>Expected size (bp) </td>
 <td>Reference </td>
 </tr>
 <tr>
 <td>&beta;-Actin </td>
 <td>GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG </td>
 <td> 7 min 45 sec 45 sec 45 sec 7 min </td>
 <td>95 94 53 72 72</td>
 <td>234 </td>
 <td>NM_001101.3 </td>
 </tr>
 <tr>
 <td>Gustducin </td>
 <td>TCTGGGTATGTGCCAAATGA GGCCCAGTGTATTCTGGAAA </td>
 <td> 7 min 45 sec 45 sec 45 sec 7 min </td>
 <td>95 94 53 72 72</td>
 <td>386 </td>
 <td>NM_001102386 </td>
 </tr>
 <tr>
 <td>PLC-&beta;2 </td>
 <td>GTCACCTGAAGGCATGGTCT TTAAAGGCGCTTTCTGCAAT </td>
 <td> 3 min 30 sec 30 sec 60 sec 7 min </td>
 <td>95 94 53 72 72</td>
 <td>333 </td>
 <td>NM_004573 </td>
 </tr>
 </tbody>
</table>
Table 1. Primers and conditions used for detecting taste specific molecules. 
<table border="1">
<tbody>
 <tr>
 <td>Primary Antibody </td>
 <td>Source </td>
 <td>Host </td>
 <td>Dilution</td>
 <td>Secondary Antibody </td>
 <td>Source </td>
 <td>Host </td>
 <td>Dilution</td>
 </tr>
 <tr>
 <td>Gustducin </td>
 <td>SantaCruz </td>
 <td>Rabbit </td>
 <td>1:500 </td>
 <td>Anti-rabbit IgG Alexa 633</td>
 <td>Molecular Probes </td>
 <td>Goat </td>
 <td>1:500 </td>
 </tr>
 <tr>
 <td>PLC-&beta;2 </td>
 <td>SantaCruz </td>
 <td>Rabbit </td>
 <td>1:500 </td>
 <td>Anti-rabbit IgG Alexa 633</td>
 <td>Molecular Probes </td>
 <td>Goat </td>
 <td>1:500 </td>
 </tr>
 </tbody>
</table>
Table 2. Antibodies used for detecting expression of specific molecules.

<ol>
	<li>Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ+cultures+of+embryonic+rat+tongue+support+tongue+and+gustatory+papilla+morphogenesis+in+vitro+without+intact+sensory+ganglia.">Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia.</a> J. Comp. Neurol. 377, 324-340 (1997).</li><li>Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain+difference+in+amiloride-sensitivity+of+salt-induced+responses+in+mouse+non-dissociated+taste+cells.">Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells.</a> Neurosci. Lett. 277, 13-16 (1999).</li><li>Caicedo, A., Jafri, M. S., Roper, S. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+Ca2++imaging+reveals+neurotransmitter+receptors+for+glutamate+in+taste+receptor+cells.">In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells.</a> J. Neurosci. 20, 7978-7985 (2000).</li><li>Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+method+to+obtain+cells+of+taste+buds+from+fungiform+papillae+of+mice.">A reliable method to obtain cells of taste buds from fungiform papillae of mice.</a> Acta Histochem. 112, 107-112 (2010).</li><li>Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+isolating+and+patch-clamping+single+mammalian+taste+receptor+cells.">A method for isolating and patch-clamping single mammalian taste receptor cells.</a> Brain Res. 503, 326-329 (1989).</li><li>Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+culture+of+rat+taste+bud+cells+that+retain+molecular+markers+for+taste+buds+and+permit+functional+expression+of+foreign+genes.">Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes.</a> Neuroscience. 106, 217-225 (2001).</li><li>Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+rat+taste+buds+in+primary+culture.">Maintenance of rat taste buds in primary culture.</a> Chem. Senses. 26, 861-873 (2001).</li><li>Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+lineage+relationships+in+taste+buds.">Analysis of cell lineage relationships in taste buds.</a> J. Neurosci. 22, 4522-4529 (2002).</li><li>Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+long-term+maintenance+of+rat+taste+cells+in+culture.">Characterization and long-term maintenance of rat taste cells in culture.</a> Chem. Senses. 31, 279-290 (2006).</li><li>Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Human+Fungiform+Papillae+Cells+in+Culture.">Characterization of Human Fungiform Papillae Cells in Culture.</a> Chem. Senses. 36, 601-612 (2011).</li><li>Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characteristics+of+odorant+elicited+calcium+changes+in+cultured+human+olfactory+neurons.">Characteristics of odorant elicited calcium changes in cultured human olfactory neurons.</a> J. Neurosci. Res. 62, 737-749 (2000).</li><li>Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+culture+of+neuronal+cells+from+adult+human+olfactory+epithelium.">Continuous culture of neuronal cells from adult human olfactory epithelium.</a> J. Mol. Neurosci. 3, 137-146 (1992).</li><li>Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomal+comparison+of+human+dermal+lymphatic+endothelial+cells+ex+vivo+and+in+vitro.">Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro.</a> Physiol. Genomics. 17, 179-192 (2007).</li><li>Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+neural+stem+cells+from+mesenchymal+stemcells:+evidence+for+a+bipotential+stem+cell+population.">Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population.</a> Stem Cells Dev. 17, 1109-1121 (2008).</li><li>Sandow, S. L., Grayson, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limits+of+isolation+and+culture:+intact+vascular+endothelium+and+BKCa.">Limits of isolation and culture: intact vascular endothelium and BKCa.</a> Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).</li></ol>

No conflicts of interest declared.

We have maintained cells obtained from human fungiform taste papillae for over 8 passages, spanning a period of 12 months. These cultures generate new cells, many of which mature in vitro to the stage where they express several markers of mature taste bud cell types, in addition to key molecular and physiological properties of taste receptor cells. The presence of gustducin- and PLC-&beta;2 immunoreactivity in subsets of cultured cells is consistent with this conclusion. Most importantly, some cells responded to...

<table border="1">
<tbody>
 <tr>
 <td>Name of the reagent </td>
 <td>Company </td>
 </tr>
 <tr>
 <td>MCDB 123 </td>
 <td>Sigma-Aldrich </td>
 </tr>
 <tr>
 <td>Iscove's DMEM Medium </td>
 <td>MediaTech </td>
 </tr>
 <tr>
 <td>Elastase </td>
 <td>Sigma-Aldrich </td>
 </tr>
 <tr>
 <td>Pronase E </td>
 <td>Sigma-Aldrich </td>
 </tr>
 <tr>
 <td>Elastase </td>
 <td>Worthington </td>
 </tr>
 <tr>
 <td>Soy bean trypsin inhibitor </td>
 <td>Worthington </td>
 </tr>
 <tr>
 <td>Collagenase type 1 </td>
 <td>Worthington </td>
 </tr>
 <tr>
 <td>Rat tail collagen type 1 </td>
 <td>BD Sciences </td>
 </tr>
 <tr>
 <td>Fura-2 AM </td>
 <td>Molecular Probes </td>
 </tr>
 <tr>
 <td>Superscript First Strand Synthesis System for RT-PCR </td>
 <td>Invitrogen </td>
 </tr>
 <tr>
 <td>Leica TCS SP2 Spectral Confocal Microscope </td>
 <td>Leica Microsystems Inc. </td>
 </tr>
 <tr>
 <td>Discovery-1 imaging station and Metamorph software </td>
 <td>Molecular Devices </td>
 </tr>
 <tr>
 <td>Small fine-tip forceps and extra fine spring scissors </td>
 <td>Fine Science Tools </td>
 </tr>
 </tbody>
</table>

isolation and culture of human fungiform taste papillae cells

Taste cells are highly specialized, with unique histological, molecular and physiological characteristics that permit detection of a wide range of simple stimuli and complex chemical molecules contained in foods. In human, individual fungiform papillae contain from zero to as many as 20 taste buds. There is no established protocol for culturing human taste cells, although the ability to maintain taste papillae cells in culture for multiple cell cycles would be of considerable utility for characterizing the molecular, regenerative, and functional properties of these unique sensory cells. Earlier studies of taste cells have been done using freshly isolated cells in primary culture, explant cultures from rodents, or semi-intact taste buds in tissue slices1,2,3,4. Although each of these preparations has advantages, the development of long-term cultures would have provided significant benefits, particularly for studies of taste cell proliferation and differentiation. Several groups, including ours, have been interested in the development and establishment of taste cell culture models. Most attempts to culture taste cells have reported limited viability, with cells typically not lasting beyond 3-5 d5,6,7,8. We recently reported on a successful method for the extended culture of rodent taste cells9. We here report for the first time the establishment of an in vitro culture system for isolated human fungiform taste papillae cells. Cells from human fungiform papillae obtained by biopsy were successfully maintained in culture for more than eight passages (12 months) without loss of viability. Cells displayed many molecular and physiological features characteristic of mature taste cells. Gustducin and phospholipase C &beta;2, (PLC-&beta;2) mRNA were detected in many cells by reverse transcriptase-polymerase chain reaction and confirmed by sequencing. Immunocytochemistry analysis demonstrated the presence of gustducin and PLC-&beta;2 expression in cultured taste cells. Cultured human fungiform cells also exhibited increases in intracellular calcium in response to appropriate concentrations of several taste stimuli indicating that taste receptors and at least some of the signalling pathways were present. These results sufficient indicate that taste cells from adult humans can be generated and maintained for at least eight passages. Many of the cells retain physiological and biochemical characteristics of acutely isolated cells from the adult taste epithelium to support their use as a model taste system. This system will enable further studies of the processes involved in proliferation, differentiation and function of mammalian taste receptor cells in an in vitro preparation.
Human fungiform taste papillae used for establishing human fungiform cell culture were donated for research following proper informed consent under research protocols that were reviewed and approved by the IRB committee. The protocol (#0934) was approved by Schulman Associates Institutional Review Board Inc., Cincinnati, OH. Written protocol below is based on published parameters reported by Ozdener et al. 201110.

Watch this Scientific Journal Video about Isolation and Culture of Human Fungiform Taste Papillae Cells at JoVE.com

Isolation and Culture of Human Fungiform Taste Papillae Cells

We aimed to develop a reproducible protocol for isolating and maintaining long-term cultures of human fungiform taste papillae cells. Cells from human fungiform papillae obtained by biopsy were successfully maintained in culture for more than eight passages (12 months) without loss of viability.

Taste cells are highly specialized, with unique histological, molecular and physiological characteristics that permit detection of a wide range of simple ...

isolation-and-culture-of-human-fungiform-taste-papillae-cells

Research

JoVE Journal

Neuroscience

14.3K Views.  Monell Chemical Senses Center. We aimed to develop a reproducible protocol for isolating and maintaining long-term cultures of human fungiform taste papillae cells. Cells from human fungiform papillae obtained by biopsy were successfully maintained in culture for more than eight passages (12 months) without loss of viability.

Video: Isolation and Culture of Human Fungiform Taste Papillae Cells

Isolation and Culture of Neural Crest Stem Cells from Human Hair Follicles

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a well-characterized niche for adult stem cells1. This segment of the outer root sheath contains a number of different types of stem cells, including epithelial stem cells2, melanocyte stem cells3 and neural crest like stem cells4-7. Hair follicles represent an accessible and rich source for different types of human stem cells. We and others have isolated neural crest stem cells (NCSCs) from human fetal and adult hair follicles4,5. These human stem cells are label-retaining cells and are capable of self-renewal through asymmetric cell division in vitro. They express immature neural crest cell markers but not differentiation markers. Our expression profiling study showed that they share a similar gene expression pattern with murine skin immature neural crest cells. They exhibit clonal multipotency that can give rise to myogenic, melanocytic, and neuronal cell lineages after in vitro clonal single cell culture. Differentiated cells not only acquire lineage-specific markers but also demonstrate appropriate functions in ex vivo conditions. In addition, these NCSCs show differentiation potential toward mesenchymal lineages. Differentiated neuronal cells can persist in mouse brain and retain neuronal differentiation markers. It has been shown that hair follicle derived NCSCs can help nerve regrowth, and they improve motor function in mice transplanted with these stem cells following transecting spinal cord injury8. Furthermore, peripheral nerves have been repaired with stem cell grafts9, and implantation of skin-derived precursor cells adjacent to crushed sciatic nerves has resulted in remyelination10. Therefore, the hair follicle/skin derived NCSCs have already shown promising results for regenerative therapy in preclinical models.
Somatic cell reprogramming to induced pluripotent stem (iPS) cells has shown enormous potential for regenerative medicine. However, there are still many issues with iPS cells, particularly the long term effect of oncogene/virus integration and potential tumorigenicity of pluripotent stem cells have not been adequately addressed. There are still many hurdles to be overcome before iPS cells can be used for regenerative medicine. Whereas the adult stem cells are known to be safe and they have been used clinically for many years, such as bone marrow transplant. Many patients have already benefited from the treatment. Autologous adult stem cells are still preferred cells for transplantation. Therefore, the readily accessible and expandable adult stem cells in human skin/hair follicles are a valuable source for regenerative medicine.

This article presents a robust protocol for isolation and culture of neural crest stem cells from human hair follicles.

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a ...

Isolation and Expansion of Human Glioblastoma Multiforme Tumor Cells Using the Neurosphere Assay

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in glioblastoma mutliforme (GBM), is to identify and isolate tumor initiating cell population(s) to investigate their role in tumor formation, progression, and recurrence. Understanding tumor initiating cell populations will provide clues to finding effective therapeutic approaches for these tumors. The neurosphere assay (NSA) due to its simplicity and reproducibility has been used as the method of choice for isolation and propagation of many of this tumor cells. This protocol demonstrates the neurosphere culture method to isolate and expand stem-like cells in surgically resected human GBM tumor tissue. The procedures include an initial chemical digestion and mechanical dissociation of tumor tissue, and subsequently plating the resulting single cell suspension in NSA culture. After 7-10 days, primary neurospheres of 150-200 &mu;m in diameter can be observed and are ready for further passaging and expansion.

This video protocol demonstrates the isolation and expansion of stem like cells from surgically resected human glioblastoma mutliforme (GBM) tumor tissue using the neurosphere assay culture method.

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in ...

Isolation and Culture of Hippocampal Neurons from Prenatal Mice

Primary cultures of rat and murine hippocampal neurons are widely used to reveal cellular mechanisms in neurobiology. By isolating and growing individual neurons, researchers are able to analyze properties related to cellular trafficking, cellular structure and individual protein localization using a variety of biochemical techniques. Results from such experiments are critical for testing theories addressing the neural basis of memory and learning. However, unambiguous results from these forms of experiments are predicated on the ability to grow neuronal cultures with minimum contamination by other brain cell types. In this protocol, we use specific media designed for neuron growth and careful dissection of embryonic hippocampal tissue to optimize growth of healthy neurons while minimizing contaminating cell types (i.e. astrocytes). Embryonic mouse hippocampal tissue can be more difficult to isolate than similar rodent tissue due to the size of the sample for dissection. We show detailed dissection techniques of hippocampus from embryonic day 19 (E19) mouse pups. Once hippocampal tissue is isolated, gentle dissociation of neuronal cells is achieved with a dilute concentration of trypsin and mechanical disruption designed to separate cells from connective tissue while providing minimum damage to individual cells. A detailed description of how to prepare pipettes to be used in the disruption is included. Optimal plating densities are provided for immuno-fluorescence protocols to maximize successful cell culture. The protocol provides a fast (approximately 2 hr) and efficient technique for the culture of neuronal cells from mouse hippocampal tissue.

We provide a protocol for the culture of highly purified hippocampal neurons from prenatal mouse brains without the use of a feeder glial cell layer.

Primary cultures of rat and murine hippocampal neurons are widely used to reveal cellular mechanisms in neurobiology. By isolating and growing individual ...

Isolation and Culture of Rat Embryonic Neural Cells: A Quick Protocol

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied successfully to the isolation of mouse and human primary neurons and neural progenitors. Dissociated neurons are maintained in serum-free medium up to several weeks. These cultures can be used for nucleofection, immunocytochemistry, nucleic acids preparation, as well as electrophysiology. Older neuronal cultures can also be transfected with a good efficiency rate by lentiviral transduction and, less efficiently, with calcium phosphate or lipid-based methods such as lipofectamine.

We describe a rapid methodology to isolate and culture hippocampal and cortical neurons from rodent embryos. This protocol allows us to perform experiments in which nearly pure neuronal cultures are required.

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied ...

Isolation and Culture of Neural Crest Cells from Embryonic Murine Neural Tube

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to mesenchymal transition (EMT) and migrates throughout the embryo, giving rise to diverse cell types 1-3. NC also has the unique ability to influence the differentiation and maturation of target organs4-6. When explanted in vitro, NC progenitors undergo self-renewal, migrate and differentiate into a variety of tissue types including neurons, glia, smooth muscle cells, cartilage and bone. 
NC multipotency was first described from explants of the avian neural tube7-9. In vitro isolation of NC cells facilitates the study of NC dynamics including proliferation, migration, and multipotency. Further work in the avian and rat systems demonstrated that explanted NC cells retain their NC potential when transplanted back into the embryo10-13. Because these inherent cellular properties are preserved in explanted NC progenitors, the neural tube explant assay provides an attractive option for studying the NC in vitro. 
To attain a better understanding of the mammalian NC, many methods have been employed to isolate NC populations. NC-derived progenitors can be cultured from post-migratory locations in both the embryo and adult to study the dynamics of post-migratory NC progenitors11,14-20, however isolation of NC progenitors as they emigrate from the neural tube provides optimal preservation of NC cell potential and migratory properties13,21,22. Some protocols employ fluorescence activated cell sorting (FACS) to isolate a NC population enriched for particular progenitors11,13,14,17. However, when starting with early stage embryos, cell numbers adequate for analyses are difficult to obtain with FACS, complicating the isolation of early NC populations from individual embryos. Here, we describe an approach that does not rely on FACS and results in an approximately 96% pure NC population based on a Wnt1-Cre activated lineage reporter23. 
The method presented here is adapted from protocols optimized for the culture of rat NC11,13. The advantages of this protocol compared to previous methods are that 1) the cells are not grown on a feeder layer, 2) FACS is not required to obtain a relatively pure NC population, 3) premigratory NC cells are isolated and 4) results are easily quantified. Furthermore, this protocol can be used for isolation of NC from any mutant mouse model, facilitating the study of NC characteristics with different genetic manipulations. The limitation of this approach is that the NC is removed from the context of the embryo, which is known to influence the survival, migration and differentiation of the NC2,24-28.

Isolation of embryonic neural crest from the neural tube facilitates the use of in vitro methods for studying migration, self-renewal, and multipotency of neural crest.

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to ...

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Denver Papillae Protocol for Objective Analysis of Fungiform Papillae

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure consistent scoring between scorers. This protocol builds off of a need that has arisen from the last two decades of taste research using FP as a proxy for taste pore density. FP density has historically been analyzed using Miller &#38; Reedy&#8217;s 1990 characterizations of their morphology: round, stained lighter, large, and elevated. In this work, the authors forewarned that stricter definitions of FP morphology needed to be outlined. Despite this call to action, follow up literature has been scarce, with most studies continuing to cite Miller &#38; Reedy&#8217;s original work. Consequently, FP density reports have been highly variable and, combined with small sample sizes, may contribute to the discrepant conclusions on the role of FP in taste sensitivity. The Genetics of Taste Lab explored this apparent inconsistency in counting and found that scorers were individually prioritizing the importance of these characteristics differently and had no guidance for when a papilla had some, but not all, of the reported qualities of FP. The result of this subjectivity is highly variable FP counts of the same tongue image. The Denver Papillae Protocol has been developed to remedy this consequence through use of a dichotomous key that further defines and prioritizes the importance of the characteristics put forth by Miller &#38; Reedy. The proposed method could help create a standard way to quantify FP for researchers in the field of taste and nutritional studies.

Here we present a protocol to measure fungiform papilla density from digital photographs. This method builds prioritization and objective characteristic metrics into the original descriptive work on fungiform papillae by Miller &#38; Reedy (1990).

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure ...

Isolation and Culture of Adult Neural Stem Cells from the Mouse Subcallosal Zone

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation into three types of cells: neurons, astrocytes, and oligodendrocytes. Identifying aNSC-derived regions and characterizing the aNSC properties are critical for the potential use of aNSCs and for the elucidation of their role in neural regeneration. The subcallosal zone (SCZ), located between white matter and the hippocampus, has recently been reported to contain aNSCs and continuously give rise to neuroblasts. A low percentage of aNSCs from the SCZ is differentiated into neurons; most cells are differentiated into glial cells, such as oligodendrocytes and astrocytes. These cells are suggested to have a therapeutic potential for traumatic cortical injury. This protocol describes in detail the process to generate SCZ-aNSCs from an adult mouse brain. A brain matrix with intervals of 1 mm is used to obtain the SCZ-containing coronal slices and to precisely dissect the SCZ from the whole brain. The SCZ sections are initially subjected to a neurosphere culture. A well-developed culture system allows for the verification of their characteristics and can increase research on NSCs. A neurosphere culture system provides a useful tool for determining proliferation and collecting the genuine NSCs. A monolayer culture is also an in vitro system to assay proliferation and differentiation. Significantly, this culture system provides a more homogenous environment for NSCs than the neurosphere culture system. Thus, using a discrete brain region, these culture systems will be helpful for expanding our knowledge about aNSCs and their applications for therapeutic uses.

Establishing culture systems for the expansion of adult neural stem cells (aNSCs) allows for the examination and application of aNSCs for therapy. The subcallosal zone (SCZ) has recently been recognized as a novel neuroblast-forming region in adult mice. Here, methods for the isolation, expansion, and differentiation of SCZ-aNSCs are described.

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation ...

Isolation and Culture of Embryonic Mouse Neural Stem Cells

Neural stem cells (NSCs) are multipotent and can give rise to the three major cell types of the central nervous system (CNS). In vitro culture and expansion of NSCs provide a suitable source of cells for neuroscientists to study the function of neurons and glial cells along with their interactions. There are several reported techniques for the isolation of neural stem cells from adult or embryo mammalian brains. During the microsurgical operation to isolate NSCs from different regions of the embryonic CNS, it is very important to reduce the damage to the brain cells to obtain the highest ratio of live and expandable stem cells. A possible technique for stress reduction during isolation of these cells from the mouse embryo brain is the reduction of surgical time. Here, we demonstrate a developed technique for rapid isolation of these cells from the E13 mouse embryo ganglionic eminence. Surgical procedures include harvesting E13 mouse embryos from the uterus, cutting the frontal fontanelle of the embryo with a bent needle tip, extracting the brain from the skull, microdissection of the isolated brain to harvest the ganglionic eminence, dissociation of the harvested tissue in NSC medium to gain a single cell suspension, and finally plating cells in suspension culture to generate neurospheres.

Here, we introduce a novel microsurgical technique for the isolation of neural stem cells from the E13 mouse embryo ganglionic eminence.