Ringraziamo Aimee Myers e Quayson Esi per le competenze tecniche e di aiuto. Questo lavoro è stato sostenuto in parte da NSF 0216310 e Givaudan Inc sovvenzione (NER).

1. Ottenere umana papille gustative fungiformi <ol><li> Rimuovere 4-8 umana papille gustative fungiformi dalla superficie dorsale della porzione anteriore della lingua utilizzando microscissors primavera curve. </li><li> Inserire immediatamente in una soluzione di isolamento (26 mM NaHCO 3, 2,5 mM NaH 2 PO 4, 20 mM di glucosio, 65 mM NaCl, 20 mM KCl, e 1 mM EDTA disciolto in acqua priva di nucleasi e sterilizzato per filtrazione). </li></ol> 2. Umano digestione Papille fungiformi Taste Umano papille gustative fungiformi cella può essere dissociato utilizzando due differenti protocolli digestione enzimatica con lievi differenze. <ol><li> Incubare papille fungiformi in soluzione di isolamento con pronasi (1 mg / ml, Sigma Aldrich) e elastasi (1 mg / ml Sigma Aldrich) a temperatura ambiente per 30-45 min (protocollo 1). </li><li> Incubare papille fungiformi con collagenasi di tipo I (550 U / mL, da Worthington) + elastasi (10 U / mL, dal Worthington) + inibitore della tripsina (0,9 mg / mL, da Worthington) in 2 ml di soluzione di calcio Ringer libero in 35 ° C Il metodo bagnomaria con circolazione per 30 minuti e l&#39;ossigenazione delicata con il 95% O 2/5% di CO 2. (Alternativa per la digestione, protocollo 2) </li><li> Dopo l&#39;incubazione, lavare papille con suoneria e triturare le papille lucido fuoco pipetta Pasteur di vetro per 10 volte. </li><li> Centrifugare per 3 minuti a 2500 rpm a temperatura ambiente e rimuovere la soluzione di isolamento e aggiungere 1 ml di mezzo di coltura cellulare gusto. </li><li> Trasferimento digerito papille fungiformi nel piatto di vetro. </li><li> Staccare delicatamente con papille fungiformi rasoio chirurgico. </li><li> Aggiungere 250 microlitri di papille sezionato nel cilindro clonazione sul vetrino collagene coda di topo di tipo-1 rivestito. </li><li> Aggiungere 1 ml di mezzo di coltura cellulare gusto in ciascun pozzetto. </li></ol> 3. Coltura di cellule umane Gusto papille fungiformi <ol><li> Incubare la piastra a 36 ° C in un umidificataincubatore contenente il 5% di CO 2. </li><li> Mettere in un indisturbato incubatore per 2 giorni prima del primo cambio di terreno completo. Gusto cellule finalmente legarsi al vetrino rivestito, anche se non può essere chiaramente visibile in 1 a 3 giorni. </li><li> Rimuovere la clonazione cilindro dalla piastra e medie completamente e aggiungere 1 ml di terreno gusto cellulare in ciascun pozzetto. </li><li> Sostituire 1/3 di media ogni 6-7 giorni. Non modificare medie più spesso e / o completamente. </li><li> Controllare la crescita delle cellule sotto microscopio ogni altro giorno. La maggior parte delle nuove cellule crescere sotto gruppi di cellule. Gruppi di cellule di solito staccare dopo 2-3 settimane in coltura lasciando le nuove cellule generate. </li><li> Dopo 40-50% del cilindro clonazione è coperto in espansione cellule gustative, Tripsinizzare le cellule che utilizzano 0,25% w / v di tripsina / EDTA per 2-3 minuti a 36 ° C. </li><li> Trasferire cellule di pozzetti in provette da 15 ml, aggiungere 3 volumi di mezzo di coltura cellulare gusto seguita da centrifugazione a 3000 rpm per 5 minuti a carattere stanzaperatura. </li><li> Rimuovere le cellule supernatante e risospendere con 1 ml di mezzo il gusto delle cellule. </li></ol> 4. Propagazione di cellule umane Gusto papille fungiformi <ol><li> Trasferire le cellule in T25 piatto e aggiungere 4 ml di terreno gusto cellulare (passaggio 0). Mantenere le cellule a 36 ° C in un incubatore umidificato contenente il 5% CO 2. </li><li> Sostituire 1/3 di ogni 6-7 giorni medi fino cellule gustative coltura ha raggiunto il 100% confluenza. A questo punto, per consentire cellule gustative di raccolta, le cellule lavare una volta con PBS sterile quindi Tripsinizzare le cellule che utilizzano 0,25% w / v di tripsina / EDTA per 2-3 minuti a 36 ° C. </li><li> Dopo centrifugazione come descritto sopra, risospendere in mezzo completo cella gusto e trasferire le cellule a nuove T-75 beute (passaggio 1). </li><li> Sostituire 1/3 di media ogni 6-7 giorni. Non modificare medie più spesso e / o completamente. </li><li> Ripetere il punto 4.3 e 4.4 quando le cellule hanno raggiunto quasi il 100% di confluenza. Split cellule a non più di diluizione 1:4 in una beuta T75per mantenere un&#39;adeguata crescita delle cellule nel tempo. </li></ol> 5. Congelamento e lo scongelamento coltivate cellule umani fungiformi papille gustative <ol><li> Per bloccare le scorte di cellule gustative primarie, dopo tripsinizzazione (passo 4.2), aggiungere 3 ml completo medie cellulare gusto e trasferire le cellule sterili 15 provette ml. Centrifugare a 2500 rpm per 5 min a temperatura ambiente. </li><li> Rimuovere delicatamente le cellule supernatante e Risospendere delicatamente con volume appropriato di congelamento mezzo contenente 95% siero bovino fetale (FBS) e 5% DMSO. </li><li> Trasferimento cellule etichettato, sterile cryovials, cap stretto, e posto in un contenitore al congelamento contenenti isopropanolo. Inserire in un congelatore a -80 ° C per almeno un giorno prima di trasferire indefinitamente in azoto liquido. </li><li> Per scongelare un flacone di surgelati cellule primarie umane papille gustative fungiformi, posto a 37 ° C bagnomaria fino a poco sciolto (circa 1 minuto), mentre lavorava in un flusso laminare coltura cellularecappuccio. </li><li> Trasferimento di cellule e medie di congelamento ad un tubo da centrifuga sterile 15 ml ed aggiungere 5 ml di terreno di coltura delle cellule gusto. </li><li> Centrifugare celle a 2500 rpm per 5 min a temperatura ambiente. Gettare il surnatante con cura, le cellule Risospendere delicatamente con completo mezzo di coltura cellulare gusto, e il trasferimento ad una sterile T-25 pallone di coltura di tessuti. </li><li> Continuare a cellule di coltura in base al punto 3 a 4. </li></ol> 6. Risultati rappresentativi I tentativi di crescere in cultura biopsie gusto avuto successo 90% del tempo. Pochi giorni dopo la biopsia e la dissociazione, le cellule di solito ha cominciato a crescere e migrare verso l&#39;esterno i pezzi di tessuto fungiformi sezionato che sono rimasti dopo la procedura di dissociazione. Sebbene le celle individuali erano visibili 24-48 ore dopo la placcatura (Figura 1A), cellule cresciuta fino a 2-3 settimane di età inferiore a cluster cellulari allegate, occasionalmente generando cellule figlie (figura 1B). Dalla biopsiaING 4-8 umana papille fungiformi, isolati iniziali di cellule primarie umane papille gustative fungiformi raggiungere circa 2000 - 8000 in 4 settimane le cellule in coltura. Espansione in fiasche di coltura cellulare T25 (passaggio 0) per ulteriori 3-4 settimane porterà ad avere umani papille gustative fungiformi cellule in coltura adatto (Figura 1C). Cellule primarie umane fungiformi papille gustative può essere ulteriormente ampliato in coltura a cedere verso l&#39;alto di almeno un milione di cellule per passaggio-1 in 3-4 settimane (Figura 1D). Cellule gustative primarie continuerà a crescere per più di 8 passaggi. La morfologia delle cellule umane in coltura papille gustative fungiformi della cultura era simile a una coltura di cellule chemosensoriali descritto in precedenza 11,12 .. La maggior parte umane in coltura cellule papille gustative fungiformi hanno mantenuto la loro aspetto originale compatto di corpi cellulari con o senza uno o più processi fino a 15-30 giorni. Dopo aver raggiunto la maggior confluenza del colta ceLLS aveva un aspetto allungata-polarizzata. Cellule gustative mature composto da diversi sottotipi istologici diversi e presentano caratteristiche specifiche delle cellule gustative. Qui mostriamo che le cellule all&#39;interno di queste culture presentano molte caratteristiche molecolari e fisiologiche tipiche delle cellule gustative mature. Gustducin e fosfolipasi C - β2, (β2-PLC) mRNA sono state rilevate mediante trascrittasi inversa-reazione a catena della polimerasi e prodotti confermato tramite sequenziamento (Figura 2). Espressione di gustducin e PLC-β2 stato rilevato immunocytochemically indica la presenza di tipo II cellule simili (Figura 3 B e D, rispettivamente). La prevalenza e modelli di espressione relativi gustducin e PLC-β2 che riflette i percorsi di segnalazione cellulare e tipi di cellule non riflettono precisamente quello osservato in vivo. I fattori che regolano la distribuzione relativa dei diversi tipi di cellule all&#39;interno di una papilla gustativa sono sconosciuti, e non possono essere replicati nelle condizioni di coltura. Pertanto, b<html> nor le somiglianze e le differenze tra le cellule coltivate e le loro controparti in vivo offrono l&#39;opportunità di esaminare la regolamentazione di queste caratteristiche a livello molecolare, in condizioni che possono essere manipolati e controllati. Un criterio importante per un sistema modello è la presenza di rilevanti proprietà funzionali. Cellule in coltura esposti anche aumenti robusti del calcio intracellulare in risposta a stimoli concentrazioni appropriate di diversi gusti (Figura 4). In questi studi, stimoli dolci e amaro provocare un aumento nel calcio intracellulare, che può corrispondere ad una depolarizzazione. Queste cellule, come il gusto le proprietà delle cellule coltivate appoggiare l&#39;affermazione che il modello di sistema che descriviamo qui sarà una risorsa preziosa per ulteriori studi delle vie di trasduzione e capacità rigenerativa delle cellule gustative umane. fig1.jpg &quot;/&gt; Figura 1. Attaccamento e la morfologia di colture di cellule umane papille gustative fungiformi. Primari umani fungiformi papille gustative colture di cellule coltivate in piastre di collagene di tipo-1 rivestiti sono stati ripresi dopo 2 giorni (A). Fungiformi cellule umane papille gustative è cresciuto fino a 4 settimane in gruppi di cellule allegati, che sembravano dare origine a cellule figlie. Le cellule in genere è cresciuta alla confluenza entro quattro settimane (B), e (C e D) rappresenta il giorno 2 e 4 settimane dopo la raccolta e reseeding rispettivamente. Cellule in coltura hanno continuato a crescere per almeno 8 mesi. Barre di scala = 50 nm. Parte della figura 1 è stata presentata anche in Ozdener et. al. 10. <img alt="Figura 2" src="/files/ftp_upload/3730/3730fig2.jpg" /> Figura 2. RT-PCR risultati hanno dimostrato la presenza di mRNA specifici delle cellule gustative biomarker (gustducin e PLC-β2,). L&#39;RNA totale da colture di cellule umane era fungiformi transc inversoribed utilizzando la Superscript primo sistema di sintesi del filamento per RT-PCR (Invitrogen) e utilizzato per PCR da amplificare con primer specifici progettati per il rilevamento di gustducin e di PLC-β2. Primers (Tabella 1) sono stati scelti per coprire uno o più introni. Ogni mRNA è stata rilevata in colture di cellule umane papille gustative fungiformi da passaggio 4 o 5 con prodotti di amplificazione della dimensione prevista, confermato mediante sequenziamento. MRNA specifico non è stata rilevata in esperimenti di controllo senza trascrittasi inversa indica nessuna contaminazione di DNA genomico. I prodotti di PCR sono stati separati su gel di agarosio 2% e dei prodotti amplificati sul gel sono state escisse con un rasoio. DNA è stato estratto dal gel usando QIAquick Gel Extraction Kit (Qiagen). I prodotti di PCR sono stati sequenziati presso l&#39;Università di Pennsylvania strutture sequenziamento. C e C-PCR-RT sono esperimenti di controllo per la PCR e la trascrittasi inversa, rispettivamente. Parte di figura 2 è stata presentata anche in Ozdener et. al. <sup&gt; 10. <img alt="Figura 3" src="/files/ftp_upload/3730/3730fig3.jpg" /> Figura 3. Immunostaining di coltura umana gusto papille fungiformi passaggio cellule 4 o 5 ha mostrato la presenza di biomarcatori delle cellule gustative. Coltivate cellule umane fungiformi papille gustative (5 giorni) sono state fissate con 4% paraformaldeide, ed incubate con anticorpi primari (Tabella 2) notte a 4 ° C. Le immagini sono state acquisite con uno TCS-SP2 microscopio a scansione laser confocale Leica. Circa il 60% delle cellule in coltura fungiformi papille gustative sono stati etichettati con gustducin (B) e 20-30% con PLC-β2 (D). Immagini trasmissione di cellule corrispondenti sono mostrati (A e C). Per i controlli, immunocolorazione con immunoglobulina specifica dimostrato l&#39;assenza di reattività aspecifica immuno (dati non mostrati). Barre di scala = 50 nm. Partedella figura 3 è stata presentata anche in Ozdener et. al. 10. <img alt="Figura 4" src="/files/ftp_upload/3730/3730fig4.jpg" /> Figura 4. Umane coltivate cellule gustative papille fungiformi passaggio da 4 o 5 di rispondere a stimoli diversi. Coltivate cellule umane fungiformi papille gustative (4-5 giorni) sono state caricate con Fura 1mM-2 AM (Molecular Probes) e 10 mg / ml Pluronic F127 (Molecular Probes). Variazioni dei livelli intracellulari di calcio ([Ca 2 +] i) in colture di cellule umane fungiformi papille gustative sono stati misurati utilizzando le normali tecniche di imaging manuali. Le cellule sono state visualizzate utilizzando un microscopio a fluorescenza invertito a lunghezze d&#39;onda di eccitazione di 340 nm e 380 nm e una lunghezza d&#39;onda di emissione fissato da un filtro passa banda centrato a 510 nm. Gli stimoli sono stati disciolti in soluzione Bath e poi pH e osmolarità riadattato se necessario. Colture di cellule umane fungiformi papille gustative hanno risposto agli stimoli dolci e amare. Graphs illustrano risposte rappresentativi di [Ca +2] i livelli in singole cellule durante l&#39;esposizione a (A) Denatonium (2 mM), (B) sucralosio (1 mM). Ciascuna traccia rappresenta singole cellule singole. <table border="1"><tbody><tr><td> Gene </td><td> Sequenza </td><td colspan="2"> PCR condizione </td><td> Dimensioni attese (Bp) </td><td> Riferimento </td></tr><tr><td> β-Actina </td><td> GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG </td><td> 7 min 45 sec 45 sec 45 sec 7 min </td><td> 95 94 53 72 72 </td><td> 234 </td><td> NM_001101.3 </td></tr><tr><td> Gustducin </td><td> TCTGGGTATGTGCCAAATGA GGCCCAGTGTATTCTGGAAA </td><td> 7 min 45 sec 45 sec 45 sec 7 min </td><td> 95 94 53 72 72 </td><td> 386 </td><td> NM_001102386 </td></tr><tr><td> PLC-β2 </td><td> GTCACCTGAAGGCATGGTCT TTAAAGGCGCTTTCTGCAAT </td><td> 3 min 30 sec 30 sec 60 sec 7 min </td><td> 95 94 53 72 72 </td><td> 333 </td><td> NM_004573 </td></tr></tbody></table> Tabella 1. Primers e condizioni usate per rilevare molecole specifiche gusto. <table border="1"><tbody><tr><td> Anticorpo primario </td><td> Fonte </td><td> Ospite </td><td> Diluizione </td><td> Anticorpo secondario </td><td> Fonte </td><td> Ospite </td&gt; <td> Diluizione </td></tr><tr><td> Gustducin </td><td> Santacruz </td><td> Coniglio </td><td> 1:500 </td><td> Anti-IgG di coniglio Alexa 633 </td><td> Molecular Probes </td><td> Capra </td><td> 1:500 </td></tr><tr><td> PLC-β 2 </td><td> Santacruz </td><td> Coniglio </td><td> 1:500 </td><td> Anti-IgG di coniglio Alexa 633 </td><td> Molecular Probes </td><td> Capra </td><td> 1:500 </td></tr></tbody></table> Anticorpi Tabella 2. Utilizzato per rivelare l&#39;espressione di molecole specifiche.

<ol>
	<li>Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ+cultures+of+embryonic+rat+tongue+support+tongue+and+gustatory+papilla+morphogenesis+in+vitro+without+intact+sensory+ganglia.">Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia.</a> J. Comp. Neurol. 377, 324-340 (1997).</li><li>Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain+difference+in+amiloride-sensitivity+of+salt-induced+responses+in+mouse+non-dissociated+taste+cells.">Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells.</a> Neurosci. Lett. 277, 13-16 (1999).</li><li>Caicedo, A., Jafri, M. S., Roper, S. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+Ca2++imaging+reveals+neurotransmitter+receptors+for+glutamate+in+taste+receptor+cells.">In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells.</a> J. Neurosci. 20, 7978-7985 (2000).</li><li>Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+method+to+obtain+cells+of+taste+buds+from+fungiform+papillae+of+mice.">A reliable method to obtain cells of taste buds from fungiform papillae of mice.</a> Acta Histochem. 112, 107-112 (2010).</li><li>Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+isolating+and+patch-clamping+single+mammalian+taste+receptor+cells.">A method for isolating and patch-clamping single mammalian taste receptor cells.</a> Brain Res. 503, 326-329 (1989).</li><li>Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+culture+of+rat+taste+bud+cells+that+retain+molecular+markers+for+taste+buds+and+permit+functional+expression+of+foreign+genes.">Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes.</a> Neuroscience. 106, 217-225 (2001).</li><li>Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+rat+taste+buds+in+primary+culture.">Maintenance of rat taste buds in primary culture.</a> Chem. Senses. 26, 861-873 (2001).</li><li>Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+lineage+relationships+in+taste+buds.">Analysis of cell lineage relationships in taste buds.</a> J. Neurosci. 22, 4522-4529 (2002).</li><li>Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+long-term+maintenance+of+rat+taste+cells+in+culture.">Characterization and long-term maintenance of rat taste cells in culture.</a> Chem. Senses. 31, 279-290 (2006).</li><li>Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Human+Fungiform+Papillae+Cells+in+Culture.">Characterization of Human Fungiform Papillae Cells in Culture.</a> Chem. Senses. 36, 601-612 (2011).</li><li>Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characteristics+of+odorant+elicited+calcium+changes+in+cultured+human+olfactory+neurons.">Characteristics of odorant elicited calcium changes in cultured human olfactory neurons.</a> J. Neurosci. Res. 62, 737-749 (2000).</li><li>Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+culture+of+neuronal+cells+from+adult+human+olfactory+epithelium.">Continuous culture of neuronal cells from adult human olfactory epithelium.</a> J. Mol. Neurosci. 3, 137-146 (1992).</li><li>Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomal+comparison+of+human+dermal+lymphatic+endothelial+cells+ex+vivo+and+in+vitro.">Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro.</a> Physiol. Genomics. 17, 179-192 (2007).</li><li>Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+neural+stem+cells+from+mesenchymal+stemcells:+evidence+for+a+bipotential+stem+cell+population.">Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population.</a> Stem Cells Dev. 17, 1109-1121 (2008).</li><li>Sandow, S. L., Grayson, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limits+of+isolation+and+culture:+intact+vascular+endothelium+and+BKCa.">Limits of isolation and culture: intact vascular endothelium and BKCa.</a> Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).</li></ol>

Non ci sono conflitti di interesse dichiarati.

Abbiamo mantenuto cellule ottenute da papille fungiformi gusto umano per oltre 8 brani, che coprono un periodo di 12 mesi. Queste colture generano nuove cellule, molti dei quali maturazione in vitro allo stadio dove esprimono marcatori diversi tipi di cellule adulte gusto germoglio, oltre a chiave proprietà molecolari e fisiologiche di cellule recettori gustative. La presenza di gustducin e PLC-β2 immunoreattività in sottogruppi di cellule in coltura è coerente con questa conclusione. La cosa più important...

<table border="1"><tbody><tr><td> Nome del reattivo </td><td> Azienda </td></tr><tr><td> MCDB 123 </td><td> Sigma-Aldrich </td></tr><tr><td> Iscove DMEM medio </td><td> MediaTech </td></tr><tr><td> Elastase </td><td> Sigma-Aldrich </td></tr><tr><td> E pronasi </td><td> Sigma-Aldrich </td></tr><tr><td> Elastase </td><td> Worthington </td></tr><tr><td> Inibitore di tripsina di soia </td><td> Worthington </td></tr><tr><td> Collagenasi di tipo 1 </td><td> Worthington </td></tr><tr><td> Rat collagene di tipo 1 coda </td><td> BD Scienze </td></tr><tr><td> Fura-2 AM </td><td> Molecular Probes </td></tr><tr><td> Apice First Strand Synthesis sistema per la RT-PCR </td><td> Invitrogen </td></tr><tr><td> Leica TCS SP2 Spectral microscopio confocale </td><td> Leica Microsystems Inc. </td&gt; </tr><tr><td> Discovery-1 Imaging Station e software Metamorph </td><td> Molecular Devices </td></tr><tr><td> Piccole fine-tip pinze e forbici supplementari fine primavera </td><td> Strumenti di Scienze Belle </td></tr></tbody></table>

isolation and culture of human fungiform taste papillae cells

Gusto cellule sono altamente specializzati, con uniche istologiche, caratteristiche molecolari e fisiologiche che permettono il rilevamento di una vasta gamma di stimoli semplici e complessi molecole chimiche contenute negli alimenti. In umana, individuale papille fungiformi contengono da zero a un massimo di 20 papille gustative. Non vi è alcun protocollo stabilito per cellule gustative coltura umane, anche se la capacità di mantenere papille gustative cellule in coltura per più cicli cellulari sarebbe di notevole utilità per caratterizzare le proprietà molecolari, rigenerativa, e funzionali di queste cellule uniche sensoriali. Gli studi precedenti di cellule gustative sono stati condotti utilizzando cellule isolate fresco in coltura primaria, culture espianti da roditori, o semi-intatte le papille gustative in fette di tessuto 1,2,3,4. Sebbene ciascuna di queste preparazioni di vantaggi, lo sviluppo delle colture a lungo termine avrebbe fornito vantaggi significativi, in particolare per studi di proliferazione cellulare gusto e differentiation. Diversi gruppi, compreso il nostro, sono stati interessati nello sviluppo e nella definizione di modelli di coltura delle cellule gustative. La maggior parte dei tentativi di cellule gustative della cultura hanno riferito di agibilità limitata, con cellule di solito non durano oltre il 3-5 d 5,6,7,8. Recentemente abbiamo segnalato su un metodo di successo per la cultura estesa di cellule gustative roditore 9. Noi qui riferire per la prima volta l&#39;istituzione di un sistema di coltura in vitro di cellule umane isolate papille gustative fungiformi. Le cellule di papille fungiformi umana ottenuti con la biopsia sono stati correttamente mantenuti in coltura per più di otto passaggi (12 mesi) senza perdita di vitalità. Cellule visualizzato molte caratteristiche molecolari e fisiologiche caratteristici delle cellule mature gustative. Gustducin e fosfolipasi C β2, (β2-PLC) mRNA sono stati rilevati in molte cellule di trascrittasi inversa-reazione polimerasica a catena e confermato tramite sequenziamento. Analisi immunocitochimica dimostrato la presenza di rafficaespressione ducin e PLC-β2 in coltura cellule gustative. Colture di cellule umane fungiformi anche mostrato un aumento del calcio intracellulare in risposta a stimoli concentrazioni appropriate di diversi gusti e indicano che i recettori gusto e almeno alcune delle vie di segnalazione erano presenti. Questi risultati indicano che sufficienti cellule gustative di esseri umani adulti può essere generata e mantenuta per almeno otto passaggi. Molte delle cellule conservano caratteristiche fisiologiche e biochimiche di cellule isolate dal acutamente l&#39;epitelio gusto degli adulti per sostenere il loro uso come sistema modello di gusto. Questo sistema consentirà ulteriori studi dei processi coinvolti nella proliferazione, differenziamento e la funzione delle cellule di mammifero recettori gusto in un preparato in vitro. Umano papille gustative fungiformi utilizzato per la determinazione umana coltura cellulare fungiformi sono stati donati per la ricerca, seguendo le apposite consenso informato ai sensi dei protocolli di ricerca che sono stati recensionee approvato dal comitato IRB. Il protocollo (# 0934) è stato approvato dalla Schulman Institutional Review Board Associates Inc., Cincinnati, OH. Protocollo scritto qui di seguito si basa su parametri pubblicati segnalati da Ozdener et al. 2011 10.

Watch this Scientific Journal Video about Isolation and Culture of Human Fungiform Taste Papillae Cells at JoVE.com

Isolation and Culture of Human Fungiform Taste Papillae Cells

Abbiamo puntato a sviluppare un protocollo riproducibile per isolare e mantenere a lungo termine colture di cellule umane papille gustative fungiformi. Le cellule di papille fungiformi umana ottenuti con la biopsia sono stati correttamente mantenuti in coltura per più di otto passaggi (12 mesi) senza perdita di vitalità.

Isolamento e la coltura di cellule umane Gusto papille fungiformi

Taste cells are highly specialized, with unique histological, molecular and physiological characteristics that permit detection of a wide range of simple ...

isolation-and-culture-of-human-fungiform-taste-papillae-cells

Research

JoVE Journal

Neuroscience

14.3K Views.  Monell Chemical Senses Center. Abbiamo puntato a sviluppare un protocollo riproducibile per isolare e mantenere a lungo termine colture di cellule umane papille gustative fungiformi. Le cellule di papille fungiformi umana ottenuti con la biopsia sono stati correttamente mantenuti in coltura per più di otto passaggi (12 mesi) senza perdita di vitalità.

Video: Isolation and Culture of Human Fungiform Taste Papillae Cells

Isolation and Culture of Neural Crest Stem Cells from Human Hair Follicles

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a well-characterized niche for adult stem cells1. This segment of the outer root sheath contains a number of different types of stem cells, including epithelial stem cells2, melanocyte stem cells3 and neural crest like stem cells4-7. Hair follicles represent an accessible and rich source for different types of human stem cells. We and others have isolated neural crest stem cells (NCSCs) from human fetal and adult hair follicles4,5. These human stem cells are label-retaining cells and are capable of self-renewal through asymmetric cell division in vitro. They express immature neural crest cell markers but not differentiation markers. Our expression profiling study showed that they share a similar gene expression pattern with murine skin immature neural crest cells. They exhibit clonal multipotency that can give rise to myogenic, melanocytic, and neuronal cell lineages after in vitro clonal single cell culture. Differentiated cells not only acquire lineage-specific markers but also demonstrate appropriate functions in ex vivo conditions. In addition, these NCSCs show differentiation potential toward mesenchymal lineages. Differentiated neuronal cells can persist in mouse brain and retain neuronal differentiation markers. It has been shown that hair follicle derived NCSCs can help nerve regrowth, and they improve motor function in mice transplanted with these stem cells following transecting spinal cord injury8. Furthermore, peripheral nerves have been repaired with stem cell grafts9, and implantation of skin-derived precursor cells adjacent to crushed sciatic nerves has resulted in remyelination10. Therefore, the hair follicle/skin derived NCSCs have already shown promising results for regenerative therapy in preclinical models.
Somatic cell reprogramming to induced pluripotent stem (iPS) cells has shown enormous potential for regenerative medicine. However, there are still many issues with iPS cells, particularly the long term effect of oncogene/virus integration and potential tumorigenicity of pluripotent stem cells have not been adequately addressed. There are still many hurdles to be overcome before iPS cells can be used for regenerative medicine. Whereas the adult stem cells are known to be safe and they have been used clinically for many years, such as bone marrow transplant. Many patients have already benefited from the treatment. Autologous adult stem cells are still preferred cells for transplantation. Therefore, the readily accessible and expandable adult stem cells in human skin/hair follicles are a valuable source for regenerative medicine.

This article presents a robust protocol for isolation and culture of neural crest stem cells from human hair follicles.

L&#39;isolamento e la coltura di cellule staminali neurali Crest di follicoli dei capelli umani

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a ...

Ricerca

Neuroscienze

Isolation and Expansion of Human Glioblastoma Multiforme Tumor Cells Using the Neurosphere Assay

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in glioblastoma mutliforme (GBM), is to identify and isolate tumor initiating cell population(s) to investigate their role in tumor formation, progression, and recurrence. Understanding tumor initiating cell populations will provide clues to finding effective therapeutic approaches for these tumors. The neurosphere assay (NSA) due to its simplicity and reproducibility has been used as the method of choice for isolation and propagation of many of this tumor cells. This protocol demonstrates the neurosphere culture method to isolate and expand stem-like cells in surgically resected human GBM tumor tissue. The procedures include an initial chemical digestion and mechanical dissociation of tumor tissue, and subsequently plating the resulting single cell suspension in NSA culture. After 7-10 days, primary neurospheres of 150-200 &mu;m in diameter can be observed and are ready for further passaging and expansion.

This video protocol demonstrates the isolation and expansion of stem like cells from surgically resected human glioblastoma mutliforme (GBM) tumor tissue using the neurosphere assay culture method.

Isolamento ed espansione di cellule umane Glioblastoma Multiforme Tumore del saggio di neurosfere

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in ...

Isolation and Culture of Rat Embryonic Neural Cells: A Quick Protocol

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied successfully to the isolation of mouse and human primary neurons and neural progenitors. Dissociated neurons are maintained in serum-free medium up to several weeks. These cultures can be used for nucleofection, immunocytochemistry, nucleic acids preparation, as well as electrophysiology. Older neuronal cultures can also be transfected with a good efficiency rate by lentiviral transduction and, less efficiently, with calcium phosphate or lipid-based methods such as lipofectamine.

We describe a rapid methodology to isolate and culture hippocampal and cortical neurons from rodent embryos. This protocol allows us to perform experiments in which nearly pure neuronal cultures are required.

Isolamento e la coltura di cellule embrionali neuronali di ratto: un protocollo veloce

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied ...

Isolation and Culture of Neural Crest Cells from Embryonic Murine Neural Tube

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to mesenchymal transition (EMT) and migrates throughout the embryo, giving rise to diverse cell types 1-3. NC also has the unique ability to influence the differentiation and maturation of target organs4-6. When explanted in vitro, NC progenitors undergo self-renewal, migrate and differentiate into a variety of tissue types including neurons, glia, smooth muscle cells, cartilage and bone. 
NC multipotency was first described from explants of the avian neural tube7-9. In vitro isolation of NC cells facilitates the study of NC dynamics including proliferation, migration, and multipotency. Further work in the avian and rat systems demonstrated that explanted NC cells retain their NC potential when transplanted back into the embryo10-13. Because these inherent cellular properties are preserved in explanted NC progenitors, the neural tube explant assay provides an attractive option for studying the NC in vitro. 
To attain a better understanding of the mammalian NC, many methods have been employed to isolate NC populations. NC-derived progenitors can be cultured from post-migratory locations in both the embryo and adult to study the dynamics of post-migratory NC progenitors11,14-20, however isolation of NC progenitors as they emigrate from the neural tube provides optimal preservation of NC cell potential and migratory properties13,21,22. Some protocols employ fluorescence activated cell sorting (FACS) to isolate a NC population enriched for particular progenitors11,13,14,17. However, when starting with early stage embryos, cell numbers adequate for analyses are difficult to obtain with FACS, complicating the isolation of early NC populations from individual embryos. Here, we describe an approach that does not rely on FACS and results in an approximately 96% pure NC population based on a Wnt1-Cre activated lineage reporter23. 
The method presented here is adapted from protocols optimized for the culture of rat NC11,13. The advantages of this protocol compared to previous methods are that 1) the cells are not grown on a feeder layer, 2) FACS is not required to obtain a relatively pure NC population, 3) premigratory NC cells are isolated and 4) results are easily quantified. Furthermore, this protocol can be used for isolation of NC from any mutant mouse model, facilitating the study of NC characteristics with different genetic manipulations. The limitation of this approach is that the NC is removed from the context of the embryo, which is known to influence the survival, migration and differentiation of the NC2,24-28.

Isolation of embryonic neural crest from the neural tube facilitates the use of in vitro methods for studying migration, self-renewal, and multipotency of neural crest.

Isolamento e la coltura delle cellule della cresta neurale da Embryonic Murine tubo neurale

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to ...

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Isolamento e la coltura di astrociti corticali mouse

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Isolamento e coltura di cellule endoteliali dal embrionali Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Denver Papillae Protocol for Objective Analysis of Fungiform Papillae

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure consistent scoring between scorers. This protocol builds off of a need that has arisen from the last two decades of taste research using FP as a proxy for taste pore density. FP density has historically been analyzed using Miller &#38; Reedy&#8217;s 1990 characterizations of their morphology: round, stained lighter, large, and elevated. In this work, the authors forewarned that stricter definitions of FP morphology needed to be outlined. Despite this call to action, follow up literature has been scarce, with most studies continuing to cite Miller &#38; Reedy&#8217;s original work. Consequently, FP density reports have been highly variable and, combined with small sample sizes, may contribute to the discrepant conclusions on the role of FP in taste sensitivity. The Genetics of Taste Lab explored this apparent inconsistency in counting and found that scorers were individually prioritizing the importance of these characteristics differently and had no guidance for when a papilla had some, but not all, of the reported qualities of FP. The result of this subjectivity is highly variable FP counts of the same tongue image. The Denver Papillae Protocol has been developed to remedy this consequence through use of a dichotomous key that further defines and prioritizes the importance of the characteristics put forth by Miller &#38; Reedy. The proposed method could help create a standard way to quantify FP for researchers in the field of taste and nutritional studies.

Here we present a protocol to measure fungiform papilla density from digital photographs. This method builds prioritization and objective characteristic metrics into the original descriptive work on fungiform papillae by Miller &#38; Reedy (1990).

Denver Papille protocollo per l&#39;analisi Obiettivo papille fungiformi

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure ...

Isolation and Culture of Adult Neural Stem Cells from the Mouse Subcallosal Zone

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation into three types of cells: neurons, astrocytes, and oligodendrocytes. Identifying aNSC-derived regions and characterizing the aNSC properties are critical for the potential use of aNSCs and for the elucidation of their role in neural regeneration. The subcallosal zone (SCZ), located between white matter and the hippocampus, has recently been reported to contain aNSCs and continuously give rise to neuroblasts. A low percentage of aNSCs from the SCZ is differentiated into neurons; most cells are differentiated into glial cells, such as oligodendrocytes and astrocytes. These cells are suggested to have a therapeutic potential for traumatic cortical injury. This protocol describes in detail the process to generate SCZ-aNSCs from an adult mouse brain. A brain matrix with intervals of 1 mm is used to obtain the SCZ-containing coronal slices and to precisely dissect the SCZ from the whole brain. The SCZ sections are initially subjected to a neurosphere culture. A well-developed culture system allows for the verification of their characteristics and can increase research on NSCs. A neurosphere culture system provides a useful tool for determining proliferation and collecting the genuine NSCs. A monolayer culture is also an in vitro system to assay proliferation and differentiation. Significantly, this culture system provides a more homogenous environment for NSCs than the neurosphere culture system. Thus, using a discrete brain region, these culture systems will be helpful for expanding our knowledge about aNSCs and their applications for therapeutic uses.

Establishing culture systems for the expansion of adult neural stem cells (aNSCs) allows for the examination and application of aNSCs for therapy. The subcallosal zone (SCZ) has recently been recognized as a novel neuroblast-forming region in adult mice. Here, methods for the isolation, expansion, and differentiation of SCZ-aNSCs are described.

Isolamento e la coltura di adulti neurali cellule staminali dal Subcallosal Zona mouse

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation ...

Isolation and Culture of Embryonic Mouse Neural Stem Cells

Neural stem cells (NSCs) are multipotent and can give rise to the three major cell types of the central nervous system (CNS). In vitro culture and expansion of NSCs provide a suitable source of cells for neuroscientists to study the function of neurons and glial cells along with their interactions. There are several reported techniques for the isolation of neural stem cells from adult or embryo mammalian brains. During the microsurgical operation to isolate NSCs from different regions of the embryonic CNS, it is very important to reduce the damage to the brain cells to obtain the highest ratio of live and expandable stem cells. A possible technique for stress reduction during isolation of these cells from the mouse embryo brain is the reduction of surgical time. Here, we demonstrate a developed technique for rapid isolation of these cells from the E13 mouse embryo ganglionic eminence. Surgical procedures include harvesting E13 mouse embryos from the uterus, cutting the frontal fontanelle of the embryo with a bent needle tip, extracting the brain from the skull, microdissection of the isolated brain to harvest the ganglionic eminence, dissociation of the harvested tissue in NSC medium to gain a single cell suspension, and finally plating cells in suspension culture to generate neurospheres.

Here, we introduce a novel microsurgical technique for the isolation of neural stem cells from the E13 mouse embryo ganglionic eminence.

Isolamento e coltura di cellule staminali neurali embrionali del Mouse

Neural stem cells (NSCs) are multipotent and can give rise to the three major cell types of the central nervous system (CNS). In vitro culture and ...

Isolation and Culture of Chick Ciliary Ganglion Neurons

Chick ciliary ganglia (CG) are part of the parasympathetic nervous system and are responsible for the innervation of the muscle tissues present in the eye. This ganglion is constituted by a homogenous population of ciliary and choroidal neurons that innervate striated and smooth muscle fibers, respectively. Each of these neuronal types regulate specific eye structures and functions. Over the years, neuronal cultures of the chick ciliary ganglia were shown to be effective cell models in the study of muscle-nervous system interactions, which communicate through cholinergic synapses. Ciliary ganglion neurons are, in its majority, cholinergic. This cell model has been shown to be useful comparatively to previously used heterogeneous cell models that comprise several neuronal types, besides cholinergic. Anatomically, the ciliary ganglion is localized between the optic nerve (ON) and the choroid fissure (CF). Here, we describe a detailed procedure for the dissection, dissociation and in vitro culture of ciliary ganglia neurons from chick embryos. We provide a step-by-step protocol in order to obtain highly pure and stable cellular cultures of CG neurons, highlighting key steps of the process. These cultures can be maintained in vitro for 15 days and, hereby, we show the normal development of CG cultures. The results also show that these neurons can interact with muscle fibers through neuro-muscular cholinergic synapses.

Chick ciliary ganglia (CG) are part of the parasympathetic nervous system. Neuronal cultures of chick CG neurons were shown to be effective cell models in the study of nerve muscle interactions. We describe a detailed protocol for the dissection, dissociation and in vitro culture of CG neurons from chick embryos.

Isolamento e cultura dei neuroni del Ganglione Ciliario

Chick ciliary ganglia (CG) are part of the parasympathetic nervous system and are responsible for the innervation of the muscle tissues present in the ...