Damos las gracias a Aimee Myers y Quayson Esi por sus habilidades técnicas y de ayuda. Este trabajo fue apoyado en parte por la NSF 0216310 y Givaudan Inc subvención (NER).

1. La obtención de papilas fungiformes Humanos Sabor <ol><li> Retire cuatro hasta ocho papilas fungiformes humana sabor de la superficie dorsal de la porción anterior de la lengua con microtijeras curvas de primavera. </li><li> Colocar inmediatamente en una solución de aislamiento (26 mM NaHCO 3, 2,5 mM de NaH 2 PO 4, 20 mM de glucosa, 65 mM de NaCl, 20 mM de KCl, y EDTA 1 mM disuelto en agua libre de nucleasa y se esteriliza por filtración). </li></ol> 2. Gusto humano papilas fungiformes digestión El gusto humano papilas fungiformes de células se puede disociar el uso de dos diferentes protocolos de digestión enzimática con ligeras diferencias. <ol><li> Incubar las papilas fungiformes en solución de aislamiento con pronasa (1 mg / ml, Sigma Aldrich) y la elastasa (1 mg / ml de Sigma Aldrich) a temperatura ambiente durante 30-45 minutos (protocolo 1). </li><li> Incubar las papilas fungiformes con colagenasa tipo I (550 U / ml, de Worthington) + elastasa (10 U / ml, a partir de mostohington) + inhibidor de tripsina (0,9 mg / ml, de Worthington) en 2 ml de solución de calcio Ringer libre en 35 ° C método de baño de agua con la circulación durante 30 minutos y una suave oxigenación con O 95% 5.2% de CO 2. (Alternativa para la la digestión, el protocolo de 2) </li><li> Después de la incubación, lavar las papilas con el timbre y triturar las papilas con el fuego, pulido pipeta Pasteur de vidrio de 10 veces. </li><li> Centrifugar durante 3 minutos a 2500 rpm a temperatura ambiente y eliminar la solución de aislamiento y se añade 1 ml de medio de cultivo celular el sabor. </li><li> Traslado digerido las papilas fungiformes en el plato de vidrio. </li><li> Diseccionar las papilas fungiformes suavemente con navaja quirúrgica. </li><li> Añadir 250 ml de papilas disecados en el cilindro de clonación en la cola de rata cubreobjetos colágeno tipo 1, recubierto. </li><li> Añadir 1 ml de medio de cultivo celular sabor en cada pocillo. </li></ol> 3. El cultivo de células humanas las papilas fungiformes gusto <ol><li> Incubar la placa a 36 ° C en un humidificadoincubadora que contiene 5% de CO 2. </li><li> Coloque en un tranquilo incubadora de 2 días antes de que el primer cambio de medio completo. Las células del gusto eventualmente se unirá al cubreobjetos recubiertos, aunque puede que no sea claramente visible en 1 a 3 días. </li><li> Quite el cilindro de la clonación de la placa y el medio completamente y añadir 1 ml de medio de el gusto de células en cada pocillo. </li><li> Sustituir 1/3 de 6-7 días cada medio. No cambie más a menudo a medio y / o en su totalidad. </li><li> Comprobar el crecimiento de células bajo el microscopio cada dos días. La mayoría de las nuevas células crecen por debajo de los grupos de células. Los agregados celulares generalmente desconectar después de 2-3 semanas en la cultura de salir de las células recién generadas. </li><li> Una vez que el 40-50% de la clonación cilindro está cubierto en la expansión de las células del gusto, trypsinize células utilizando 0,25% w / v de tripsina / EDTA durante 2-3 minutos a 36 ° C. </li><li> Transferir las células de los pocillos en tubos de 15 ml, añadir 3 volúmenes de medio de cultivo celular sabor seguido por centrifugación a 3000 rpm durante 5 minutos a temple habitacióntura. </li><li> Eliminar sobrenadante y resuspender las células con 1 ml de medio de sabor de la célula. </li></ol> 4. La propagación de las células humanas las papilas fungiformes gusto <ol><li> Transferir células T25 en placa y añadir 4 ml de medio de sabor celular (paso 0). Mantener las células a 36 ° C en una incubadora humidificada con 5% de CO 2. </li><li> Sustituir 1/3 de 6-7 días hasta que todos los medios células cultivadas gustativas han llegado a 100% de confluencia. En este momento, para permitir a las células del gusto de la cosecha, lavar las células una vez con PBS estéril a continuación trypsinize células utilizando 0,25% w / v de tripsina / EDTA durante 2-3 minutos a 36 ° C. </li><li> Después de la centrifugación como se describió anteriormente, resuspender en medio completo de células gusto y células de transferencia a nuevos matraces T-75 (paso 1). </li><li> Sustituir 1/3 de 6-7 días cada medio. No cambie más a menudo a medio y / o en su totalidad. </li><li> Repita el paso 4.3 y 4.4, cuando las células han alcanzado casi el 100% de confluencia. Dividir las células a no más de dilución 1:4 en un matraz T75para mantener un crecimiento adecuado de las células con el tiempo. </li></ol> 5. La congelación y descongelación cultivadas Humanos células papilas fungiformes papilas gustativas <ol><li> Para congelar las existencias de las células gustativas primarias, después de tripsinización (paso 4.2), añadir 3 ml de medio completo células gustativas y las células de transferencia de hasta 15 tubos de centrífuga estériles ml cónicos. Centrifugar a 2500 rpm durante 5 min a temperatura ambiente. </li><li> Retirar con cuidado las células sobrenadante y resuspender suavemente con un volumen adecuado de medio de congelación que contiene 95% suero bovino fetal (FBS) y 5% de DMSO. </li><li> Transferir las células a la etiqueta, crioviales estériles tapa, con fuerza, y colóquelo en un contenedor de congelación con isopropanol. Colocar en un congelador -80 ° C durante al menos un día antes de transferir indefinidamente en nitrógeno líquido. </li><li> Para descongelar un vial de células primarias congelados humanos fungiformes papilas gustativas, el lugar a 37 ° C baño de agua hasta que esté descongelado (aproximadamente 1 minuto), mientras trabajaba en un cultivo de células de flujo laminarcampana. </li><li> Transferencia de células y el medio de congelación a un tubo de centrífuga estéril de 15 ml cónico y añadir 5 ml de medio de cultivo celular el sabor. </li><li> Centrifugar las células a 2500 rpm durante 5 min a temperatura ambiente. Elimine con cuidado las células sobrenadante, resuspender suavemente con medio de cultivo completo el sabor de células, y la transferencia a un estéril T-25 frasco de cultivo de tejidos. </li><li> Continuar las células de cultivo de acuerdo con el Paso 3 a 4. </li></ol> 6. Los resultados representativos Los intentos para hacer crecer las biopsias de sabor en la cultura tuvieron éxito 90% del tiempo. Pocos días después de la biopsia y la disociación, las células comenzaron a crecer normalmente y migran hacia el exterior de las piezas de tejido fungiformes disecados que quedaron después del procedimiento de disociación. Aunque las células individuales eran visibles 24-48 horas después de placas (Figura 1A), las células crecieron hasta 2-3 semanas bajo racimos de células adjuntos, en ocasiones generar células hijas (Figura 1B). Desde la biopsia4-8 ción humana papilas fungiformes, los aislamientos iniciales de células primarias humanas fungiformes papilas gustativas llegar a aproximadamente 2000 - 8000 células en 4 semanas en cultivo. La expansión en T25 frascos de cultivo celular (paso 0) por 3-4 semanas adicionales dará lugar a tener células humanas fungiformes papilas gustativas en la cultura adaptada (fig. 1C). Primarios humanos células fungiformes papilas gustativas se puede ampliar en la cultura para producir más de al menos un millón de células por el paso-1 en 3-4 semanas (Figura 1D). Las células primarias del gusto seguirá creciendo durante más de 8 pasajes. La morfología de las células humanas cultivadas fungiformes papilas gustativas en cultivo fue similar a las células cultivadas quimiosensoriales descrito previamente 11,12 .. La mayoría de las células cultivadas de humanos fungiformes papilas gustativas mantiene su aspecto original compacta de cuerpos celulares con o sin uno o más procesos hasta 15-30 días. Después de que llegó a la confluencia la mayor parte del cultivo ceLLS tenía una apariencia polarizada-alargada. Las células maduras del gusto consisten en varios subtipos histológicos diferentes y presentan características de células gustativas específicas. Aquí nos muestran que las células dentro de estas culturas muestran muchas características moleculares y fisiológicos característicos de las células gustativas maduros. Gustducin y fosfolipasa C - β2, (PLC-β2) ARNm se detectaron por reacción en cadena de la polimerasa transcriptasa y productos confirmados por secuenciación (Figura 2). Expresión de gusducina y PLC β2-fue detectado immunocytochemically indicando la presencia de tipo II-como las células (Figura 3 B y D, respectivamente). La prevalencia y los patrones de expresión relativa de gustducin y el PLC-β2 refleja vías de señalización celular y tipos de células no refleja con precisión que se ve en vivo. Los factores que rigen la distribución relativa de los diferentes tipos de células dentro de una papila gustativa son desconocidos, y no puede ser replicado en las condiciones de cultivo. Por lo tanto, b<html> anto las similitudes y diferencias entre las células cultivadas y sus homólogos en vivo ofrecen una oportunidad para examinar la regulación de estas características a nivel molecular, en las condiciones que pueden ser manipulados y controlados. Un criterio importante para un sistema modelo es la presencia de relevantes propiedades funcionales. Las células cultivadas también mostraron aumentos sólidos en el calcio intracelular en respuesta a concentraciones apropiadas de los estímulos de sabor varios (Figura 4). En estos estudios, los estímulos dulces y amargas provocan un aumento del calcio intracelular que puede corresponder a una despolarización. Estas células sabor a las propiedades de las células cultivadas dan soporte a la afirmación de que el modelo de sistema que describimos aquí será un activo valioso para futuros estudios de las vías de transducción y la capacidad regenerativa de las células del gusto humanos. fig1.jpg &quot;/&gt; Figura 1. El apego y la morfología de las células cultivadas de humanos fungiformes papilas gustativas. Primarios humanos fungiformes papilas gustativas cultivos de células cultivadas en placas de colágeno tipo 1, se obtuvieron imágenes recubiertos después de 2 días (a). Humanos células papilas gustativas fungiformes creció hasta 4 semanas en grupos de células anexas, que parecían dar lugar a células hijas. Las células crecieron hasta confluencia típicamente dentro de cuatro semanas (B), y (C y D) representa 2 días y 4 semanas después de la cosecha y resiembra respectivamente. Las células cultivadas siguió creciendo por lo menos 8 meses. Las barras de escala = 50 nm. Parte de la Figura 1 se presenta también en Ozdener et. col. 10. <img alt="Figura 2" src="/files/ftp_upload/3730/3730fig2.jpg" /> Figura 2. RT-PCR demostró la presencia de ARNm específicos del gusto de biomarcadores celulares (gustducin y el PLC β2-,). ARN total de cultivos de células humanas fungiformes era transc inversaribed utilizando el Superíndice el primer sistema de síntesis de la hebra para RT-PCR (Invitrogen) y se utiliza para la PCR mediante la amplificación con los cebadores específicos diseñados para la detección de gustducin y el PLC β2-. Los cebadores (Tabla 1) fueron elegidos para abarcar uno o más intrones. Cada mRNA se detectó en cultivos de células humanas fungiformes papilas gustativas del pasaje 4 o 5 con los productos de amplificación del tamaño esperado, confirmado por secuenciación. ARNm específico no fue detectado en los experimentos de control sin transcriptasa inversa indica que no hay contaminación de ADN genómico. Productos de PCR se separaron en geles de agarosa al 2% y los productos amplificados en el gel fueron extirpados con una maquinilla de afeitar. Se extrajo el ADN a partir del gel utilizando QIAquick gel extracción kit (Qiagen). Productos de PCR fueron secuenciados en la Universidad de Pensilvania instalaciones de secuenciación. C-PCR y RT-C son los experimentos de control de la PCR y la transcriptasa inversa, respectivamente. Parte de la figura 2 también se presentó en Ozdener et. col. <sup&gt; 10. <img alt="Figura 3" src="/files/ftp_upload/3730/3730fig3.jpg" /> Figura 3. La inmunotinción de cultivo gusto humano las células de las papilas fungiformes el paso 4 o 5 mostraron la presencia de biomarcadores de células gustativas. Cultivadas humanos fungiformes células papilas gustativas (5 días de edad) se fijaron con paraformaldehído al 4%, y se incubaron con anticuerpos primarios (Tabla 2) durante la noche a 4 ° C. Las imágenes fueron adquiridas con una Leica TCS-SP2 microscopio confocal de barrido láser. Aproximadamente, el 60% de las células cultivadas fungiformes papilas gustativas se marcaron con gustducin (B) y un 20-30% con el PLC-β2 (D). Imágenes de transmisión de celdas correspondientes se muestran (A y C). Para los controles, inmunotinción con anticuerpo inmunoglobulina específica demostró la ausencia de reactividad inespecífica inmuno (datos no presentados). Las barras de escala = 50 nm. Partede la Figura 3 se presentan también en Ozdener et. col. 10. <img alt="Figura 4" src="/files/ftp_upload/3730/3730fig4.jpg" /> Figura 4. Cultivadas humanos fungiformes células papilas gustativas de paso de 4 o 5 responden a diferentes estímulos. Cultivadas de las células humanas fungiformes papilas gustativas (4-5 días de edad) fueron cargados con 1 mM Fura-2 AM (Molecular Probes) y 10 mg / ml de Pluronic F127 (Molecular Probes). Los cambios en los niveles de calcio intracelular ([Ca 2 +] i) en cultivos de células humanas fungiformes papilas gustativas se midieron utilizando las técnicas de imagen manual. Las células se visualizaron utilizando un microscopio invertido de fluorescencia a longitudes de onda de excitación de 340 nm y 380 nm y una longitud de onda de emisión establecido por un filtro de paso de banda centrado a 510 nm. Los estímulos se disolvieron en solución del baño y luego reajustó el pH y la osmolaridad, si es necesario. Cultivadas de las células humanas fungiformes papilas gustativas responde a los estímulos dulces y amargas. Graphs ilustran las respuestas representativas de [Ca +2] i niveles en células individuales durante la exposición a (A) denatonio (2 mM), (B) sucralosa (1 mM). Cada traza representa solo las células individuales. <table border="1"><tbody><tr><td> Gene </td><td> Secuencia </td><td colspan="2"> PCR condiciones </td><td> El tamaño esperado (Pb) </td><td> Referencia </td></tr><tr><td> β-actina </td><td> GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG </td><td> 7 min 45 seg 45 seg 45 seg 7 min </td><td> 95 94 53 72 72 </td><td> 234 </td><td> NM_001101.3 </td></tr><tr><td> Gustducin </td><td> TCTGGGTATGTGCCAAATGA GGCCCAGTGTATTCTGGAAA </td><td> 7 min 45 seg 45 seg 45 seg 7 min </td><td> 95 94 53 72 72 </td><td> 386 </td><td> NM_001102386 </td></tr><tr><td> PLC-β2 </td><td> GTCACCTGAAGGCATGGTCT TTAAAGGCGCTTTCTGCAAT </td><td> 3 min 30 seg 30 seg 60 seg 7 min </td><td> 95 94 53 72 72 </td><td> 333 </td><td> NM_004573 </td></tr></tbody></table> Tabla 1. Los cebadores y las condiciones utilizadas para la detección de moléculas de sabor específicas. <table border="1"><tbody><tr><td> Anticuerpo primario </td><td> Fuente </td><td> Anfitrión </td><td> Dilución </td><td> Anticuerpo secundario </td><td> Fuente </td><td> Anfitrión </td&gt; <td> Dilución </td></tr><tr><td> Gustducin </td><td> SantaCruz </td><td> Conejo </td><td> 1:500 </td><td> Anti-IgG de conejo Alexa 633 </td><td> Molecular Probes </td><td> Cabra </td><td> 1:500 </td></tr><tr><td> PLC-β 2 </td><td> SantaCruz </td><td> Conejo </td><td> 1:500 </td><td> Anti-IgG de conejo Alexa 633 </td><td> Molecular Probes </td><td> Cabra </td><td> 1:500 </td></tr></tbody></table> Anticuerpos Tabla 2. Utilizado para detectar la expresión de moléculas específicas.

<ol>
	<li>Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ+cultures+of+embryonic+rat+tongue+support+tongue+and+gustatory+papilla+morphogenesis+in+vitro+without+intact+sensory+ganglia.">Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia.</a> J. Comp. Neurol. 377, 324-340 (1997).</li><li>Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain+difference+in+amiloride-sensitivity+of+salt-induced+responses+in+mouse+non-dissociated+taste+cells.">Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells.</a> Neurosci. Lett. 277, 13-16 (1999).</li><li>Caicedo, A., Jafri, M. S., Roper, S. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+Ca2++imaging+reveals+neurotransmitter+receptors+for+glutamate+in+taste+receptor+cells.">In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells.</a> J. Neurosci. 20, 7978-7985 (2000).</li><li>Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+method+to+obtain+cells+of+taste+buds+from+fungiform+papillae+of+mice.">A reliable method to obtain cells of taste buds from fungiform papillae of mice.</a> Acta Histochem. 112, 107-112 (2010).</li><li>Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+isolating+and+patch-clamping+single+mammalian+taste+receptor+cells.">A method for isolating and patch-clamping single mammalian taste receptor cells.</a> Brain Res. 503, 326-329 (1989).</li><li>Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+culture+of+rat+taste+bud+cells+that+retain+molecular+markers+for+taste+buds+and+permit+functional+expression+of+foreign+genes.">Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes.</a> Neuroscience. 106, 217-225 (2001).</li><li>Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+rat+taste+buds+in+primary+culture.">Maintenance of rat taste buds in primary culture.</a> Chem. Senses. 26, 861-873 (2001).</li><li>Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+lineage+relationships+in+taste+buds.">Analysis of cell lineage relationships in taste buds.</a> J. Neurosci. 22, 4522-4529 (2002).</li><li>Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+long-term+maintenance+of+rat+taste+cells+in+culture.">Characterization and long-term maintenance of rat taste cells in culture.</a> Chem. Senses. 31, 279-290 (2006).</li><li>Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Human+Fungiform+Papillae+Cells+in+Culture.">Characterization of Human Fungiform Papillae Cells in Culture.</a> Chem. Senses. 36, 601-612 (2011).</li><li>Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characteristics+of+odorant+elicited+calcium+changes+in+cultured+human+olfactory+neurons.">Characteristics of odorant elicited calcium changes in cultured human olfactory neurons.</a> J. Neurosci. Res. 62, 737-749 (2000).</li><li>Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+culture+of+neuronal+cells+from+adult+human+olfactory+epithelium.">Continuous culture of neuronal cells from adult human olfactory epithelium.</a> J. Mol. Neurosci. 3, 137-146 (1992).</li><li>Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomal+comparison+of+human+dermal+lymphatic+endothelial+cells+ex+vivo+and+in+vitro.">Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro.</a> Physiol. Genomics. 17, 179-192 (2007).</li><li>Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+neural+stem+cells+from+mesenchymal+stemcells:+evidence+for+a+bipotential+stem+cell+population.">Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population.</a> Stem Cells Dev. 17, 1109-1121 (2008).</li><li>Sandow, S. L., Grayson, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limits+of+isolation+and+culture:+intact+vascular+endothelium+and+BKCa.">Limits of isolation and culture: intact vascular endothelium and BKCa.</a> Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).</li></ol>

No hay conflictos de interés declarado.

Hemos mantenido las células obtenidas a partir de las papilas fungiformes humana gusto por más de 8 pasajes, que abarca un período de 12 meses. Estas culturas generar nuevas células, muchos de los que maduran in vitro a la etapa en la que expresan marcadores de varios tipos de células maduras sabor brote, además de importantes propiedades moleculares y fisiológicas de las células receptoras del gusto. La presencia de gusducina y el PLC-β2 inmunoreactividad en los subconjuntos de células en cultivo es ...

<table border="1"><tbody><tr><td> Nombre del reactivo </td><td> Empresa </td></tr><tr><td> MCDB 123 </td><td> Sigma-Aldrich </td></tr><tr><td> Iscove medio DMEM </td><td> Mediatech </td></tr><tr><td> Elastasa </td><td> Sigma-Aldrich </td></tr><tr><td> Pronasa E </td><td> Sigma-Aldrich </td></tr><tr><td> Elastasa </td><td> Worthington </td></tr><tr><td> Soja inhibidor de tripsina </td><td> Worthington </td></tr><tr><td> La colagenasa tipo 1 </td><td> Worthington </td></tr><tr><td> Cola de rata colágeno tipo 1 </td><td> BD Ciencias </td></tr><tr><td> Fura-2 PM </td><td> Molecular Probes </td></tr><tr><td> Superíndice primer capítulo de síntesis del sistema de RT-PCR </td><td> Invitrogen </td></tr><tr><td> Leica TCS SP2 microscopio confocal espectral </td><td> Leica Microsystems, Inc. </td&gt; </tr><tr><td> Descubrimiento-1 imagen de la estación y el software Metamorph </td><td> Molecular Devices </td></tr><tr><td> Pequeñas punta fina fórceps y tijeras adicionales de primavera </td><td> Herramientas de Bellas Ciencia </td></tr></tbody></table>

isolation and culture of human fungiform taste papillae cells

Las células del gusto son altamente especializado, con características histológicas, moleculares y fisiológicos que permiten la detección de una amplia gama de estímulos simples y moléculas químicas complejas contenidas en los alimentos. En papilas humana, individual fungiformes contener de cero a un máximo de 20 papilas gustativas. No existe un protocolo establecido para el cultivo de células gustativas humanos, aunque la capacidad de mantener las células del gusto papilas en la cultura de los ciclos múltiples de la célula sería de considerable utilidad para la caracterización de las propiedades moleculares, regeneradoras y funcionales de estas células sensoriales únicas. Los primeros estudios de las células gustativas se han realizado utilizando recién células aisladas en cultivo primario, cultivos de explantes de los roedores, o semi-intactas las papilas gustativas en cortes de tejido 1,2,3,4. Aunque cada una de estas preparaciones tiene ventajas, el desarrollo de cultivos a largo plazo se han proporcionado beneficios significativos, en particular para los estudios de células sabor proliferación y diferenciaciónrentiation. Varios grupos, incluyendo el nuestro, se han interesado en el desarrollo y establecimiento de modelos de cultivo de células gustativas. La mayoría de los intentos de las células gustativas de la cultura han informado de viabilidad limitada, con las células por lo general no duran más allá de 3-5 días 5,6,7,8. Recientemente hemos informado de un método exitoso para el cultivo prolongado de las células gustativas de roedores 9. Estamos aquí informe por primera vez el establecimiento de un sistema de cultivo in vitro de células aisladas de humanos fungiformes papilas gustativas. Las células de las papilas fungiformes humana obtenidas por biopsia se mantuvieron con éxito en la cultura durante más de ocho pasos (12 meses) sin pérdida de viabilidad. Las células muestran muchas características moleculares y fisiológicos característicos de las células gustativas maduros. Gustducin y la fosfolipasa C β2, (PLC-β2) mRNA se detectó en muchas células por reacción en cadena de la polimerasa-transcriptasa y confirmados por secuenciación. Análisis de inmunohistoquímica demostraron la presencia de ráfagasducin y el PLC β2-expresión en las células gustativas cultivadas. Cultivadas células fungiformes humanos también mostraron aumentos en el calcio intracelular en respuesta a concentraciones apropiadas de los estímulos de sabor que indican que varios receptores del sabor y al menos algunas de las vías de señalización estaban presentes. Estos resultados indican que suficientes células del gusto de los humanos adultos pueden ser generados y mantenidos durante al menos ocho pasajes. Muchas de las células conservan las características fisiológicas y bioquímicas de las células aisladas de forma aguda el epitelio gusto de adultos para apoyar su uso como un sistema modelo de gusto. Este sistema permitirá realizar más estudios sobre los procesos implicados en la proliferación, diferenciación y función de mamíferos, células receptoras del gusto de una preparación in vitro. Papilas fungiformes el gusto humano utiliza para el establecimiento de la cultura humana de células fungiformes fueron donados para la investigación tras el consentimiento informado adecuado bajo protocolos de investigación que fueron revisadosy aprobado por el comité del IRB. El protocolo (# 0934) fue aprobado por los Asociados Schulman Junta de Revisión Institucional Inc., Cincinnati, OH. Protocolo escrito a continuación se basa en los parámetros publicados reportados por Ozdener et al. 2011 10.

Watch this Scientific Journal Video about Isolation and Culture of Human Fungiform Taste Papillae Cells at JoVE.com

Isolation and Culture of Human Fungiform Taste Papillae Cells

El objetivo fue desarrollar un protocolo reproducible para aislar y mantener a largo plazo de cultivos de células humanas las papilas fungiformes gusto. Las células de las papilas fungiformes humana obtenidas por biopsia se mantuvieron con éxito en la cultura durante más de ocho pasos (12 meses) sin pérdida de viabilidad.

Aislamiento y cultivo de células humanas las papilas fungiformes gusto

Taste cells are highly specialized, with unique histological, molecular and physiological characteristics that permit detection of a wide range of simple ...

isolation-and-culture-of-human-fungiform-taste-papillae-cells

Research

JoVE Journal

Neuroscience

14.3K vistas.  Monell Chemical Senses Center. El objetivo fue desarrollar un protocolo reproducible para aislar y mantener a largo plazo de cultivos de células humanas las papilas fungiformes gusto. Las células de las papilas fungiformes humana obtenidas por biopsia se mantuvieron con éxito en la cultura durante más de ocho pasos (12 meses) sin pérdida de viabilidad.

Video: Isolation and Culture of Human Fungiform Taste Papillae Cells

Isolation and Culture of Neural Crest Stem Cells from Human Hair Follicles

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a well-characterized niche for adult stem cells1. This segment of the outer root sheath contains a number of different types of stem cells, including epithelial stem cells2, melanocyte stem cells3 and neural crest like stem cells4-7. Hair follicles represent an accessible and rich source for different types of human stem cells. We and others have isolated neural crest stem cells (NCSCs) from human fetal and adult hair follicles4,5. These human stem cells are label-retaining cells and are capable of self-renewal through asymmetric cell division in vitro. They express immature neural crest cell markers but not differentiation markers. Our expression profiling study showed that they share a similar gene expression pattern with murine skin immature neural crest cells. They exhibit clonal multipotency that can give rise to myogenic, melanocytic, and neuronal cell lineages after in vitro clonal single cell culture. Differentiated cells not only acquire lineage-specific markers but also demonstrate appropriate functions in ex vivo conditions. In addition, these NCSCs show differentiation potential toward mesenchymal lineages. Differentiated neuronal cells can persist in mouse brain and retain neuronal differentiation markers. It has been shown that hair follicle derived NCSCs can help nerve regrowth, and they improve motor function in mice transplanted with these stem cells following transecting spinal cord injury8. Furthermore, peripheral nerves have been repaired with stem cell grafts9, and implantation of skin-derived precursor cells adjacent to crushed sciatic nerves has resulted in remyelination10. Therefore, the hair follicle/skin derived NCSCs have already shown promising results for regenerative therapy in preclinical models.
Somatic cell reprogramming to induced pluripotent stem (iPS) cells has shown enormous potential for regenerative medicine. However, there are still many issues with iPS cells, particularly the long term effect of oncogene/virus integration and potential tumorigenicity of pluripotent stem cells have not been adequately addressed. There are still many hurdles to be overcome before iPS cells can be used for regenerative medicine. Whereas the adult stem cells are known to be safe and they have been used clinically for many years, such as bone marrow transplant. Many patients have already benefited from the treatment. Autologous adult stem cells are still preferred cells for transplantation. Therefore, the readily accessible and expandable adult stem cells in human skin/hair follicles are a valuable source for regenerative medicine.

This article presents a robust protocol for isolation and culture of neural crest stem cells from human hair follicles.

Aislamiento y cultivo de células troncales de la cresta neural de los folículos del cabello humano

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a ...

Investigación

Neurociencias

Isolation and Expansion of Human Glioblastoma Multiforme Tumor Cells Using the Neurosphere Assay

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in glioblastoma mutliforme (GBM), is to identify and isolate tumor initiating cell population(s) to investigate their role in tumor formation, progression, and recurrence. Understanding tumor initiating cell populations will provide clues to finding effective therapeutic approaches for these tumors. The neurosphere assay (NSA) due to its simplicity and reproducibility has been used as the method of choice for isolation and propagation of many of this tumor cells. This protocol demonstrates the neurosphere culture method to isolate and expand stem-like cells in surgically resected human GBM tumor tissue. The procedures include an initial chemical digestion and mechanical dissociation of tumor tissue, and subsequently plating the resulting single cell suspension in NSA culture. After 7-10 days, primary neurospheres of 150-200 &mu;m in diameter can be observed and are ready for further passaging and expansion.

This video protocol demonstrates the isolation and expansion of stem like cells from surgically resected human glioblastoma mutliforme (GBM) tumor tissue using the neurosphere assay culture method.

El aislamiento y la expansión de las células de glioblastoma humano multiforme tumor mediante el ensayo de neuroesfera

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in ...

Isolation and Culture of Rat Embryonic Neural Cells: A Quick Protocol

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied successfully to the isolation of mouse and human primary neurons and neural progenitors. Dissociated neurons are maintained in serum-free medium up to several weeks. These cultures can be used for nucleofection, immunocytochemistry, nucleic acids preparation, as well as electrophysiology. Older neuronal cultures can also be transfected with a good efficiency rate by lentiviral transduction and, less efficiently, with calcium phosphate or lipid-based methods such as lipofectamine.

We describe a rapid methodology to isolate and culture hippocampal and cortical neurons from rodent embryos. This protocol allows us to perform experiments in which nearly pure neuronal cultures are required.

Aislamiento y cultivo de células neuronales de ratas embrionarias: un protocolo rápido

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied ...

Isolation and Culture of Neural Crest Cells from Embryonic Murine Neural Tube

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to mesenchymal transition (EMT) and migrates throughout the embryo, giving rise to diverse cell types 1-3. NC also has the unique ability to influence the differentiation and maturation of target organs4-6. When explanted in vitro, NC progenitors undergo self-renewal, migrate and differentiate into a variety of tissue types including neurons, glia, smooth muscle cells, cartilage and bone. 
NC multipotency was first described from explants of the avian neural tube7-9. In vitro isolation of NC cells facilitates the study of NC dynamics including proliferation, migration, and multipotency. Further work in the avian and rat systems demonstrated that explanted NC cells retain their NC potential when transplanted back into the embryo10-13. Because these inherent cellular properties are preserved in explanted NC progenitors, the neural tube explant assay provides an attractive option for studying the NC in vitro. 
To attain a better understanding of the mammalian NC, many methods have been employed to isolate NC populations. NC-derived progenitors can be cultured from post-migratory locations in both the embryo and adult to study the dynamics of post-migratory NC progenitors11,14-20, however isolation of NC progenitors as they emigrate from the neural tube provides optimal preservation of NC cell potential and migratory properties13,21,22. Some protocols employ fluorescence activated cell sorting (FACS) to isolate a NC population enriched for particular progenitors11,13,14,17. However, when starting with early stage embryos, cell numbers adequate for analyses are difficult to obtain with FACS, complicating the isolation of early NC populations from individual embryos. Here, we describe an approach that does not rely on FACS and results in an approximately 96% pure NC population based on a Wnt1-Cre activated lineage reporter23. 
The method presented here is adapted from protocols optimized for the culture of rat NC11,13. The advantages of this protocol compared to previous methods are that 1) the cells are not grown on a feeder layer, 2) FACS is not required to obtain a relatively pure NC population, 3) premigratory NC cells are isolated and 4) results are easily quantified. Furthermore, this protocol can be used for isolation of NC from any mutant mouse model, facilitating the study of NC characteristics with different genetic manipulations. The limitation of this approach is that the NC is removed from the context of the embryo, which is known to influence the survival, migration and differentiation of the NC2,24-28.

Isolation of embryonic neural crest from the neural tube facilitates the use of in vitro methods for studying migration, self-renewal, and multipotency of neural crest.

Aislamiento y cultivo de células de la cresta neural de embriones murinos del Tubo Neural

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to ...

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Aislamiento y cultivo de astrocitos corticales de ratones

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Aislamiento y cultivo de células endoteliales del cerebro anterior embrionarias

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Denver Papillae Protocol for Objective Analysis of Fungiform Papillae

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure consistent scoring between scorers. This protocol builds off of a need that has arisen from the last two decades of taste research using FP as a proxy for taste pore density. FP density has historically been analyzed using Miller &#38; Reedy&#8217;s 1990 characterizations of their morphology: round, stained lighter, large, and elevated. In this work, the authors forewarned that stricter definitions of FP morphology needed to be outlined. Despite this call to action, follow up literature has been scarce, with most studies continuing to cite Miller &#38; Reedy&#8217;s original work. Consequently, FP density reports have been highly variable and, combined with small sample sizes, may contribute to the discrepant conclusions on the role of FP in taste sensitivity. The Genetics of Taste Lab explored this apparent inconsistency in counting and found that scorers were individually prioritizing the importance of these characteristics differently and had no guidance for when a papilla had some, but not all, of the reported qualities of FP. The result of this subjectivity is highly variable FP counts of the same tongue image. The Denver Papillae Protocol has been developed to remedy this consequence through use of a dichotomous key that further defines and prioritizes the importance of the characteristics put forth by Miller &#38; Reedy. The proposed method could help create a standard way to quantify FP for researchers in the field of taste and nutritional studies.

Here we present a protocol to measure fungiform papilla density from digital photographs. This method builds prioritization and objective characteristic metrics into the original descriptive work on fungiform papillae by Miller &#38; Reedy (1990).

Protocolo papilas Denver para el Análisis Objetivo de papilas fungiformes

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure ...

Isolation and Culture of Adult Neural Stem Cells from the Mouse Subcallosal Zone

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation into three types of cells: neurons, astrocytes, and oligodendrocytes. Identifying aNSC-derived regions and characterizing the aNSC properties are critical for the potential use of aNSCs and for the elucidation of their role in neural regeneration. The subcallosal zone (SCZ), located between white matter and the hippocampus, has recently been reported to contain aNSCs and continuously give rise to neuroblasts. A low percentage of aNSCs from the SCZ is differentiated into neurons; most cells are differentiated into glial cells, such as oligodendrocytes and astrocytes. These cells are suggested to have a therapeutic potential for traumatic cortical injury. This protocol describes in detail the process to generate SCZ-aNSCs from an adult mouse brain. A brain matrix with intervals of 1 mm is used to obtain the SCZ-containing coronal slices and to precisely dissect the SCZ from the whole brain. The SCZ sections are initially subjected to a neurosphere culture. A well-developed culture system allows for the verification of their characteristics and can increase research on NSCs. A neurosphere culture system provides a useful tool for determining proliferation and collecting the genuine NSCs. A monolayer culture is also an in vitro system to assay proliferation and differentiation. Significantly, this culture system provides a more homogenous environment for NSCs than the neurosphere culture system. Thus, using a discrete brain region, these culture systems will be helpful for expanding our knowledge about aNSCs and their applications for therapeutic uses.

Establishing culture systems for the expansion of adult neural stem cells (aNSCs) allows for the examination and application of aNSCs for therapy. The subcallosal zone (SCZ) has recently been recognized as a novel neuroblast-forming region in adult mice. Here, methods for the isolation, expansion, and differentiation of SCZ-aNSCs are described.

Aislamiento y cultivo de células madre adultas neural de la Zona subcallosal Ratón

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation ...

Isolation and Culture of Embryonic Mouse Neural Stem Cells

Neural stem cells (NSCs) are multipotent and can give rise to the three major cell types of the central nervous system (CNS). In vitro culture and expansion of NSCs provide a suitable source of cells for neuroscientists to study the function of neurons and glial cells along with their interactions. There are several reported techniques for the isolation of neural stem cells from adult or embryo mammalian brains. During the microsurgical operation to isolate NSCs from different regions of the embryonic CNS, it is very important to reduce the damage to the brain cells to obtain the highest ratio of live and expandable stem cells. A possible technique for stress reduction during isolation of these cells from the mouse embryo brain is the reduction of surgical time. Here, we demonstrate a developed technique for rapid isolation of these cells from the E13 mouse embryo ganglionic eminence. Surgical procedures include harvesting E13 mouse embryos from the uterus, cutting the frontal fontanelle of the embryo with a bent needle tip, extracting the brain from the skull, microdissection of the isolated brain to harvest the ganglionic eminence, dissociation of the harvested tissue in NSC medium to gain a single cell suspension, and finally plating cells in suspension culture to generate neurospheres.

Here, we introduce a novel microsurgical technique for the isolation of neural stem cells from the E13 mouse embryo ganglionic eminence.

Aislamiento y cultivo de las células madre neurales embrionarias de ratón

Neural stem cells (NSCs) are multipotent and can give rise to the three major cell types of the central nervous system (CNS). In vitro culture and ...

Isolation and Culture of Chick Ciliary Ganglion Neurons

Chick ciliary ganglia (CG) are part of the parasympathetic nervous system and are responsible for the innervation of the muscle tissues present in the eye. This ganglion is constituted by a homogenous population of ciliary and choroidal neurons that innervate striated and smooth muscle fibers, respectively. Each of these neuronal types regulate specific eye structures and functions. Over the years, neuronal cultures of the chick ciliary ganglia were shown to be effective cell models in the study of muscle-nervous system interactions, which communicate through cholinergic synapses. Ciliary ganglion neurons are, in its majority, cholinergic. This cell model has been shown to be useful comparatively to previously used heterogeneous cell models that comprise several neuronal types, besides cholinergic. Anatomically, the ciliary ganglion is localized between the optic nerve (ON) and the choroid fissure (CF). Here, we describe a detailed procedure for the dissection, dissociation and in vitro culture of ciliary ganglia neurons from chick embryos. We provide a step-by-step protocol in order to obtain highly pure and stable cellular cultures of CG neurons, highlighting key steps of the process. These cultures can be maintained in vitro for 15 days and, hereby, we show the normal development of CG cultures. The results also show that these neurons can interact with muscle fibers through neuro-muscular cholinergic synapses.

Chick ciliary ganglia (CG) are part of the parasympathetic nervous system. Neuronal cultures of chick CG neurons were shown to be effective cell models in the study of nerve muscle interactions. We describe a detailed protocol for the dissection, dissociation and in vitro culture of CG neurons from chick embryos.

Aislamiento y cultura de chick Ciliary Ganglion Neurons

Chick ciliary ganglia (CG) are part of the parasympathetic nervous system and are responsible for the innervation of the muscle tissues present in the ...