Agradecemos Aimee Myers e Quayson Esi de competências técnicas e de ajuda. Este trabalho foi apoiado em parte pela NSF 0216310 e Inc Givaudan subvenção (NER).

1. Obtenção de Papilas gustativas humanas fungiformes <ol><li> Remover 4-8 papilas gosto humano fungiformes a partir da superfície dorsal da porção anterior da língua usando microtesoura mola curvos. </li><li> Colocar-se imediatamente para uma solução de isolamento (26 mM de NaHCO3, 2,5 mM de NaH 2 PO 4, 20 mM de glucose, 65 mM de NaCl, 20 mM de KCl, 1 mM de EDTA e dissolvido em água livre de nuclease e esterilizado por filtração). </li></ol> 2. Digestão humana fungiformes Papilas Taste Human papilas fungiformes célula gosto pode ser dissociada usando dois diferentes protocolos de digestão enzimática com ligeiras diferenças. <ol><li> Incubar papilas fungiformes em solução de isolamento com pronase (1 mg / ml, Sigma Aldrich) e elastase (1 mg / ml Sigma Aldrich) à temperatura ambiente durante 30-45 min (protocolo 1). </li><li> Incubar papilas fungiformes com colagenase tipo I (550 U / mL, a partir de Worthington) + elastase (10 U / mL, a partir de Worthington) + inibidor de tripsina (0,9 mg / mL, a partir de Worthington) em 2 ml de solução de Ringer de cálcio livre em 35 ° C Método banho de água com circulação durante 30 minutos e oxigenação suave com 95% O2 / 5% de CO 2. (Alternativa para digestão, o protocolo 2) </li><li> Após a incubação, lavar papilas com campainha e triturar as papilas com fogo polido pipeta Pasteur de vidro por 10 vezes. </li><li> Centrifugar durante 3 minutos a 2500 rpm à temperatura ambiente e remover a solução de isolamento e adicionar 1 ml de meio de cultura de células sabor. </li><li> Transferência digerido papilas fungiformes em prato de vidro. </li><li> Dissecar papilas fungiformes suavemente com lâmina cirúrgica. </li><li> Adicionar 250 ul de papilas dissecado em cilindro de clonagem para rato lamela colágeno tipo rabo-1 revestido. </li><li> Adicionar 1 ml de meio de cultura de células sabor em cada poço. </li></ol> 3. A cultura de células humanas fungiformes Papila Gosto <ol><li> Incubar em placas a 36 ° C numa atmosfera húmidaincubadora contendo 5% de CO 2. </li><li> Colocar numa incubadora em repouso durante 2 dias antes da primeira mudança de meio completo. Células gustativas acabará por se ligar à lamela revestida, embora possa não ser claramente visíveis em 1 a 3 dias. </li><li> Remover cilindro de clonagem a partir de chapa e meio completamente e adicionar 1 ml de meio de células sabor em cada poço. </li><li> Substitua 1/3 da média a cada 6-7 dias. Não altere médio com mais freqüência e / ou completamente. </li><li> Verifique o crescimento de células ao microscópio em dias alternados. A maioria das novas células crescem por baixo agrupamentos de células. Agrupamentos de células normalmente separar após 2-3 semanas em cultura deixando as células recém-gerado. </li><li> Uma vez que 40-50% do cilindro de clonagem é coberto na expansão de células sabor, trypsinize células usando 0,25% w / v de tripsina / EDTA durante 2-3 minutos a 36 ° C. </li><li> Transferir as células a partir de poços em 15 ml tubos, adicionar 3 volumes de sabor meio de cultura celular, seguido por centrifugação a 3000 rpm durante 5 minutos a têmpera quartotura. </li><li> Remover sobrenadante e ressuspender as células com 1 ml de meio de células sabor. </li></ol> 4. Propagação de células Papila fungiforme Humanos Taste <ol><li> Transferir as células em placa de T25 e adicionar 4 ml de meio de sabor célula (passagem 0). Manter as células a 36 ° C numa incubadora humidificada contendo 5% de CO 2. </li><li> Substituir 1/3 do meio a cada 6-7 dias até que as células cultivadas de sabor atingiram confluência de 100%. Neste momento, para permitir que as células sabor para a colheita, lavar as células uma vez com PBS estéril, em seguida, trypsinize células usando 0,25% w / v de tripsina / EDTA durante 2-3 minutos a 36 ° C. </li><li> Após centrifugação como descrito acima, ressuspender em meio completo e as células sabor célula de transferência para frescos T-75 frascos (passagem 1). </li><li> Substitua 1/3 da média a cada 6-7 dias. Não altere médio com mais freqüência e / ou completamente. </li><li> Repita o passo 4,3 e 4,4 quando as células atingiram perto de 100% de confluência. Dividir as células a não mais do que a diluição de 1:4 em um balão T75para manter o crescimento adequada das células ao longo do tempo. </li></ol> 5. Congelamento e descongelamento humanas cultivadas fungiformes Células Papila Gosto <ol><li> Para congelar estoques de células gustativas primárias, após tripsinização (passo 4.2), adicionar 3 ml de meio de célula completa gosto e transferir as células para estéreis 15 ml tubos de centrífuga cônicos. Centrifugar a 2500 rpm durante 5 min à temperatura ambiente. </li><li> Cuidadosamente remover as células sobrenadante e ressuspender suavemente com um volume adequado de meio de congelação contendo 95% de soro fetal bovino (FBS) e DMSO a 5%. </li><li> Transferência de células para rotulado estéril criotubos, cap, firmemente, e coloque em um recipiente de congelamento contendo isopropanol. Colocar num congelador -80 ° C durante pelo menos um dia antes de transferir indefinidamente para azoto líquido. </li><li> Para descongelar um frasco de congelados humanas primárias fungiformes células sabor, papilas lugar a 37 ° C banho de água até que apenas descongelado (aproximadamente 1 minuto), enquanto que a trabalhar numa cultura de células de fluxo laminarcapa. </li><li> Transferir as células e meio de congelamento a um 15 ml estéril tubo de centrífuga cónico e adicionam-se 5 ml de meio de cultura de células sabor. </li><li> Centrifugar células a 2500 rpm durante 5 min à temperatura ambiente. Com cuidado, elimine o sobrenadante, as células Volte a suspender suavemente com completa meio de cultura de células gosto, e transferir para um frasco estéril cultura T-25 dos tecidos. </li><li> Continuar a células de cultura de acordo com o Passo 3 a 4. </li></ol> 6. Os resultados representativos Tentativas para crescer em cultura de sabor biópsias foram bem sucedidos 90% do tempo. Alguns dias após a biópsia e dissociação, as células tipicamente começou a crescer e migrar para o exterior a partir dos pedaços de tecido dissecado fungiformes que permaneceram após o procedimento de dissociação. Embora as células individuais eram visíveis 24-48 hr após o plaqueamento (Figura 1A), as células cresceram até 2-3 semanas sob agrupamentos de células ligadas, ocasionalmente gerar células filhas (Figura 1B). De biópsiaing 4-8 humana papilas fungiformes, isolados iniciais de células humanas primárias fungiformes papilas gustativas atingem aproximadamente 2000 - 8000 células em 4 semanas em cultura. Expansão em frascos de cultura de células T25 (passagem 0) para 3-4 semanas adicionais irá resultar em ter humanos fungiformes células papilas gustativas em cultura adaptado (Figura 1C). Humanas primárias fungiformes células papilas gustativas podem ainda ser expandidas em cultura para se obter para cima de pelo menos um milhão de células por passagem-1 em 3-4 semanas (Figura 1D). Células gustativas primárias continuará a crescer para mais de 8 passagens. A morfologia das células humanas cultivadas fungiformes gustativas papilas em cultura foi semelhante à cultura de células quimio descrito anteriormente 11,12 .. A maioria humanas cultivadas fungiformes células papilas gustativas mantiveram a sua aparência original compacto de corpos celulares, com ou sem um ou mais processos até 15-30 dias. Depois de terem atingido confluência a maior parte do ce cultivadasLLS tinha uma aparência polarizada-alongada. Células gustativas maduros composto de vários diferentes subtipos histológicos e características apresentam sabor celulares específicos. Aqui nós mostramos que as células dentro destas culturas exibir muitas características moleculares e fisiológicos característicos das células gustativas maduros. Gustducin e fosfolipase C - β2, (PLC-β2) ARNm foram detectados por reacção em cadeia da polimerase com transcriptase reversa e produtos confirmados por sequenciação (Figura 2). Expressão de gustducin e PLC-β2 foi detectada imunocitoquimicamente indicando a presença de tipo II-, como as células (Figura 3 B e D, respectivamente). A prevalência e padrões de expressão relativa de gustducin e PLC-β2 refletindo vias celulares de sinalização e tipos de células não reflectir exactamente observada in vivo. Os factores que regulam a distribuição relativa dos diferentes tipos de células dentro de um botão de sabor são desconhecidos, e não pode ser replicado nas condições de cultura. Portanto, b<html> oth as semelhanças e diferenças entre as células cultivadas e seus homólogos em vivo proporcionam uma oportunidade para examinar a regulamentação destas características em um nível molecular, em condições que podem ser manipulados e monitorados. Um critério importante para um sistema modelo é a presença de relevantes propriedades funcionais. Células de cultura também exibiram aumentos robustos no cálcio intracelular em resposta a concentrações apropriadas de estímulos de sabor vários (Figura 4). Nestes estudos, o estímulo doce e amargo eliciar um aumento de cálcio intracelular, que pode corresponder a uma despolarização. Estas células, como gosto propriedades das células cultivadas dar apoio à afirmação de que o sistema modelo que descrevemos aqui será um recurso valioso para estudos das vias de transdução ea capacidade regeneradora das células gustativas humanas. fig1.jpg &quot;/&gt; Figura 1. Apego e morfologia de células humanas cultivadas fungiformes papilas gustativas. Humanas primárias fungiformes gustativas culturas papilas de células cultivadas em placas de colagénio tipo-1 revestidos foram fotografadas após 2 dias (a). Humanos fungiformes células papilas gustativas cresceu para até 4 semanas em grupos de células unidas, que pareciam dar origem a células-filhas. As células cresceram até à confluência tipicamente dentro de quatro semanas (B), e (C e D) representa dias 2 e 4 semanas após a colheita e reseeding respectivamente. Células de cultura continuou a crescer durante pelo menos 8 meses. Barra de escala = 50 nm. Parte da Figura 1 foi também apresentado na Ozdener et. ai. 10. <img alt="A Figura 2" src="/files/ftp_upload/3730/3730fig2.jpg" /> Figura 2. RT-PCR, os resultados demonstraram a presença de células específicas de sabor mRNAs de biomarcadores (gustducin e PLC-β2,). RNA total de cultura de células humanas fungiformes foi transc reversoribed utilizando o Sistema de Síntese Superscript Primeiro Strand para RT-PCR (Invitrogen) e usado para a PCR, amplificando com primers específicos concebidos para a detecção de gustducin e PLC-β2. Os iniciadores (Tabela 1) foram escolhidos para abranger um ou mais intrões. Cada mRNA foi detectada em culturas de células humanas fungiformes gustativas papilas de passagem 4 ou 5 com produtos de amplificação do tamanho esperado, confirmado por sequenciação. MRNA específico não foi detectada em experiências de controlo sem transcriptase reversa indicando que não há contaminação de ADN genómico. Os produtos de PCR foram separados em géis de agarose a 2% e os produtos amplificados no gel foram excisadas com uma lâmina de barbear. O DNA foi extraído a partir do gel utilizando QIAquick Gel Extraction Kit (Qiagen). Os produtos de PCR foram sequenciados na Universidade de instalações Pensilvânia de sequenciação. C-PCR e C-RT são experiências de controlo para a PCR e transcriptase reversa, respectivamente. Parte da Figura 2 foi também apresentado na Ozdener et. ai. <sup&gt; 10. <img alt="A Figura 3" src="/files/ftp_upload/3730/3730fig3.jpg" /> Figura 3. Imunocoloração de culto fungiformes gosto humano papilas passagem células 4 ou 5 mostrou a presença de biomarcadores celulares gosto. Humanas cultivadas fungiformes células sabor papilas (5 dias de idade) foram fixadas com paraformaldeído a 4%, e incubados com anticorpos primários (Tabela 2) durante a noite a 4 ° C. As imagens foram adquiridas com um SCT-SP2 confocal Leica microscópio de varredura por laser. Aproximadamente, 60% de culturas de células fungiformes papilas gustativas foram marcadas com gustducin (B) e 20-30% com PLC-β2 (D). Imagens de transmissão de células correspondentes são mostradas (A e C). Para os controlos, imunocoloração com anticorpo específico de imunoglobulina demonstraram a ausência de reactividade imuno inespecífica (dados não mostrados). Barra de escala = 50 nm. Parteda Figura 3 foi também apresentado na Ozdener et. ai. 10. <img alt="A Figura 4" src="/files/ftp_upload/3730/3730fig4.jpg" /> Figura 4. Humanas cultivadas células gustativas fungiformes papilas de passagem 4 ou 5 respondem a estímulos diferentes. Humanas cultivadas fungiformes células sabor papilas (4-5 dias de idade) foram carregados com 1 mM de Fura-2 AM (Molecular Probes) e 10 mg / ml de Pluronic F127 (Molecular Probes). Alterações nos níveis de cálcio intracelular ([Ca 2 +] i) em culturas de células humanas fungiformes papilas gustativas foram medidos usando técnicas de imagem padrão manuais. As células foram visualizadas utilizando um microscópio invertido de fluorescência em comprimentos de onda de excitação de 340 nm e 380 nm e um comprimento de onda de emissão estabelecido por um filtro passa banda centrada a 510 nm. Os estímulos foram dissolvidos em solução do banho e, em seguida, o pH ea osmolaridade reajustado, se necessário. Humanas cultivadas células papilas gustativas fungiformes respondeu a estímulos doce e amargo. Graphs ilustram as respostas representativas de [2] i Ca níveis em células individuais durante a exposição a (A) denatónio (2 mM), (B) A sucralose (1 mM). Cada traço representa únicas células individuais. <table border="1"><tbody><tr><td> Gene </td><td> Seqüência </td><td colspan="2"> Condição PCR </td><td> O tamanho esperado (Pb) </td><td> Referência </td></tr><tr><td> β-Actina </td><td> GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG </td><td> 7 min 45 seg 45 seg 45 seg 7 min </td><td> 95 94 53 72 72 </td><td> 234 </td><td> NM_001101.3 </td></tr><tr><td> Gustducin </td><td> TCTGGGTATGTGCCAAATGA GGCCCAGTGTATTCTGGAAA </td><td> 7 min 45 seg 45 seg 45 seg 7 min </td><td> 95 94 53 72 72 </td><td> 386 </td><td> NM_001102386 </td></tr><tr><td> PLC-β2 </td><td> GTCACCTGAAGGCATGGTCT TTAAAGGCGCTTTCTGCAAT </td><td> 3 min 30 seg 30 seg 60 seg 7 min </td><td> 95 94 53 72 72 </td><td> 333 </td><td> NM_004573 </td></tr></tbody></table> Tabela 1. Primers e condições utilizadas para a detecção de moléculas de sabor específico. <table border="1"><tbody><tr><td> O anticorpo primário </td><td> Fonte </td><td> Anfitrião </td><td> Diluição </td><td> Anticorpo secundário </td><td> Fonte </td><td> Anfitrião </td&gt; <td> Diluição </td></tr><tr><td> Gustducin </td><td> Santacruz </td><td> Coelho </td><td> 1:500 </td><td> Anti-IgG de coelho Alexa 633 </td><td> Molecular Probes </td><td> Cabra </td><td> 1:500 </td></tr><tr><td> PLC-2 β </td><td> Santacruz </td><td> Coelho </td><td> 1:500 </td><td> Anti-IgG de coelho Alexa 633 </td><td> Molecular Probes </td><td> Cabra </td><td> 1:500 </td></tr></tbody></table> Anticorpos Tabela 2. Utilizado para detecção da expressão de moléculas específicas.

<ol>
	<li>Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ+cultures+of+embryonic+rat+tongue+support+tongue+and+gustatory+papilla+morphogenesis+in+vitro+without+intact+sensory+ganglia.">Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia.</a> J. Comp. Neurol. 377, 324-340 (1997).</li><li>Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain+difference+in+amiloride-sensitivity+of+salt-induced+responses+in+mouse+non-dissociated+taste+cells.">Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells.</a> Neurosci. Lett. 277, 13-16 (1999).</li><li>Caicedo, A., Jafri, M. S., Roper, S. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+Ca2++imaging+reveals+neurotransmitter+receptors+for+glutamate+in+taste+receptor+cells.">In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells.</a> J. Neurosci. 20, 7978-7985 (2000).</li><li>Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+method+to+obtain+cells+of+taste+buds+from+fungiform+papillae+of+mice.">A reliable method to obtain cells of taste buds from fungiform papillae of mice.</a> Acta Histochem. 112, 107-112 (2010).</li><li>Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+isolating+and+patch-clamping+single+mammalian+taste+receptor+cells.">A method for isolating and patch-clamping single mammalian taste receptor cells.</a> Brain Res. 503, 326-329 (1989).</li><li>Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+culture+of+rat+taste+bud+cells+that+retain+molecular+markers+for+taste+buds+and+permit+functional+expression+of+foreign+genes.">Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes.</a> Neuroscience. 106, 217-225 (2001).</li><li>Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+rat+taste+buds+in+primary+culture.">Maintenance of rat taste buds in primary culture.</a> Chem. Senses. 26, 861-873 (2001).</li><li>Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+lineage+relationships+in+taste+buds.">Analysis of cell lineage relationships in taste buds.</a> J. Neurosci. 22, 4522-4529 (2002).</li><li>Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+long-term+maintenance+of+rat+taste+cells+in+culture.">Characterization and long-term maintenance of rat taste cells in culture.</a> Chem. Senses. 31, 279-290 (2006).</li><li>Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Human+Fungiform+Papillae+Cells+in+Culture.">Characterization of Human Fungiform Papillae Cells in Culture.</a> Chem. Senses. 36, 601-612 (2011).</li><li>Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characteristics+of+odorant+elicited+calcium+changes+in+cultured+human+olfactory+neurons.">Characteristics of odorant elicited calcium changes in cultured human olfactory neurons.</a> J. Neurosci. Res. 62, 737-749 (2000).</li><li>Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+culture+of+neuronal+cells+from+adult+human+olfactory+epithelium.">Continuous culture of neuronal cells from adult human olfactory epithelium.</a> J. Mol. Neurosci. 3, 137-146 (1992).</li><li>Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomal+comparison+of+human+dermal+lymphatic+endothelial+cells+ex+vivo+and+in+vitro.">Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro.</a> Physiol. Genomics. 17, 179-192 (2007).</li><li>Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+neural+stem+cells+from+mesenchymal+stemcells:+evidence+for+a+bipotential+stem+cell+population.">Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population.</a> Stem Cells Dev. 17, 1109-1121 (2008).</li><li>Sandow, S. L., Grayson, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limits+of+isolation+and+culture:+intact+vascular+endothelium+and+BKCa.">Limits of isolation and culture: intact vascular endothelium and BKCa.</a> Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).</li></ol>

Não há conflitos de interesse declarados.

Temos mantido células obtidas a partir de papilas humano fungiformes sabor durante mais de 8 passagens, abrangendo um período de 12 meses. Estas culturas gerar novas células, muitos dos quais amadurecem in vitro para a fase em que expressam vários marcadores de maduros gustativas tipos de células da gema, para além de chave propriedades moleculares e fisiológicos de células receptoras gustativas. A presença de gustducin e PLC-β2 imunorreactividade em subconjuntos de células de cultura é consistente ...

<table border="1"><tbody><tr><td> Nome do reagente </td><td> Companhia </td></tr><tr><td> MCDB 123 </td><td> Sigma-Aldrich </td></tr><tr><td> DMEM Iscove Médio </td><td> Mediatech </td></tr><tr><td> Elastase </td><td> Sigma-Aldrich </td></tr><tr><td> E Pronase </td><td> Sigma-Aldrich </td></tr><tr><td> Elastase </td><td> Worthington </td></tr><tr><td> Inibidor de tripsina de soja </td><td> Worthington </td></tr><tr><td> Colagenase tipo 1 </td><td> Worthington </td></tr><tr><td> Rat colágeno tipo 1 cauda </td><td> BD Ciências </td></tr><tr><td> Fura-2 PM </td><td> Molecular Probes </td></tr><tr><td> Superscript Synthesis System Primeiro Strand para RT-PCR </td><td> Invitrogen </td></tr><tr><td> Leica TCS SP2 microscópio confocal Spectral </td><td> Leica Microsystems Inc. </td&gt; </tr><tr><td> Descoberta-1 imagem estação e Metamorph software </td><td> Molecular Devices </td></tr><tr><td> Pequenas fina ponta de uma pinça e tesouras extras de primavera </td><td> Belas Ferramentas Ciência </td></tr></tbody></table>

isolation and culture of human fungiform taste papillae cells

Células de sabor são altamente especializados, com únicas histológicos, características moleculares e fisiológicas que permitem a detecção de uma ampla gama de estímulos simples e moléculas químicas complexas contidos nos alimentos. Em humanos papilas fungiformes, individual contêm de zero a até 20 papilas gustativas. Não há protocolo estabelecido para a cultura de células humanas de sabor, embora a capacidade de manter as células sabor papilas em cultura durante vários ciclos celulares seria de utilidade considerável para caracterizar as propriedades moleculares, regenerativa, e funcional destas células únicas sensoriais. Estudos anteriores de células gustativas ter sido feito usando recém células isoladas em cultura primária, as culturas de explante de roedores, ou gomos semi-intactas gosto em fatias de tecido 1,2,3,4. Embora cada uma destas preparações tem vantagens, o desenvolvimento de culturas a longo prazo teria fornecido benefícios significativos, particularmente para os estudos de gosto a proliferação celular e diferentiation. Vários grupos, inclusive o nosso, têm sido interessados ​​no desenvolvimento e estabelecimento de modelos de cultura de células gustativas. A maioria das tentativas de células gustativas cultura relataram viabilidade limitada, com células normalmente não duradouros além d 3-5 5,6,7,8. Nós recentemente relatado em um método de sucesso para a cultura prolongada de células de roedores gustativas 9. Nós relatamos aqui pela primeira vez o estabelecimento de um sistema de cultura in vitro de células humanas isoladas fungiformes papilas gustativas. As células de humano papilas fungiformes obtidos por biópsia com êxito foram mantidas em cultura durante mais de oito passagens (12 meses) sem perda de viabilidade. Células exibido muitas características moleculares e fisiológicos característicos de células sabor maduros. Gustducin e fosfolipase C β2, (PLC-β2) ARNm foram detectados em muitas células por reacção em cadeia da polimerase com transcriptase reversa e confirmado por sequenciação. Análise imunocitoquímica demonstrou a presença de rajadaducin e PLC-β2 expressão em células gustativas cultivadas. Culturas de células de fungiformes humanos também exibiram aumentos na concentração de cálcio intracelular em resposta a concentrações apropriadas de estímulos de sabor, indicando que vários receptores de sabor e pelo menos algumas das vias de sinalização estavam presentes. Estes resultados indicam que as células suficientes sabor a partir de seres humanos adultos pode ser gerado e mantido durante pelo menos oito passagens. Muitas das células retêm as características fisiológicas e bioquímicas de células agudamente isoladas a partir do epitélio sabor adulto para apoiar a sua utilização como um sistema modelo gosto. Este sistema irá permitir estudos mais detalhados de os processos envolvidos na diferenciação, proliferação e função das células receptoras de mamíferos sabor num na preparação in vitro. Papilas fungiformes gosto humano utilizado para estabelecer cultura de células humanas fungiformes foram doados para pesquisa após consentimento informado apropriado ao abrigo de protocolos de pesquisa que foram analisadase aprovado pelo comitê de IRB. O protocolo (# 0934) foi aprovado por Schulman Associates Institucional Review Board Inc., Cincinnati, OH. Protocolo escrito abaixo é baseado em parâmetros publicados relatados por Ozdener et al. 2011 10.

Watch this Scientific Journal Video about Isolation and Culture of Human Fungiform Taste Papillae Cells at JoVE.com

Isolation and Culture of Human Fungiform Taste Papillae Cells

Nosso objetivo foi desenvolver um protocolo reprodutível para isolar e manter a longo prazo culturas de células humanas fungiformes papilas gustativas. As células de humano papilas fungiformes obtidos por biópsia com êxito foram mantidas em cultura durante mais de oito passagens (12 meses) sem perda de viabilidade.

Isolamento e Cultura de Células Papila fungiforme Humanos Taste

Taste cells are highly specialized, with unique histological, molecular and physiological characteristics that permit detection of a wide range of simple ...

isolation-and-culture-of-human-fungiform-taste-papillae-cells

Research

JoVE Journal

Neuroscience

14.3K visualizações.  Monell Chemical Senses Center. Nosso objetivo foi desenvolver um protocolo reprodutível para isolar e manter a longo prazo culturas de células humanas fungiformes papilas gustativas. As células de humano papilas fungiformes obtidos por biópsia com êxito foram mantidas em cultura durante mais de oito passagens (12 meses) sem perda de viabilidade.

Vídeo: Isolation and Culture of Human Fungiform Taste Papillae Cells

Isolation and Culture of Neural Crest Stem Cells from Human Hair Follicles

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a well-characterized niche for adult stem cells1. This segment of the outer root sheath contains a number of different types of stem cells, including epithelial stem cells2, melanocyte stem cells3 and neural crest like stem cells4-7. Hair follicles represent an accessible and rich source for different types of human stem cells. We and others have isolated neural crest stem cells (NCSCs) from human fetal and adult hair follicles4,5. These human stem cells are label-retaining cells and are capable of self-renewal through asymmetric cell division in vitro. They express immature neural crest cell markers but not differentiation markers. Our expression profiling study showed that they share a similar gene expression pattern with murine skin immature neural crest cells. They exhibit clonal multipotency that can give rise to myogenic, melanocytic, and neuronal cell lineages after in vitro clonal single cell culture. Differentiated cells not only acquire lineage-specific markers but also demonstrate appropriate functions in ex vivo conditions. In addition, these NCSCs show differentiation potential toward mesenchymal lineages. Differentiated neuronal cells can persist in mouse brain and retain neuronal differentiation markers. It has been shown that hair follicle derived NCSCs can help nerve regrowth, and they improve motor function in mice transplanted with these stem cells following transecting spinal cord injury8. Furthermore, peripheral nerves have been repaired with stem cell grafts9, and implantation of skin-derived precursor cells adjacent to crushed sciatic nerves has resulted in remyelination10. Therefore, the hair follicle/skin derived NCSCs have already shown promising results for regenerative therapy in preclinical models.
Somatic cell reprogramming to induced pluripotent stem (iPS) cells has shown enormous potential for regenerative medicine. However, there are still many issues with iPS cells, particularly the long term effect of oncogene/virus integration and potential tumorigenicity of pluripotent stem cells have not been adequately addressed. There are still many hurdles to be overcome before iPS cells can be used for regenerative medicine. Whereas the adult stem cells are known to be safe and they have been used clinically for many years, such as bone marrow transplant. Many patients have already benefited from the treatment. Autologous adult stem cells are still preferred cells for transplantation. Therefore, the readily accessible and expandable adult stem cells in human skin/hair follicles are a valuable source for regenerative medicine.

This article presents a robust protocol for isolation and culture of neural crest stem cells from human hair follicles.

Isolamento e Cultura de células da crista neural-tronco de folículos capilares humanos

Hair follicles undergo lifelong growth and hair cycle is a well-controlled process involving stem cell proliferation and quiescence. Hair bulge is a ...

Neurociência

Isolation and Expansion of Human Glioblastoma Multiforme Tumor Cells Using the Neurosphere Assay

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in glioblastoma mutliforme (GBM), is to identify and isolate tumor initiating cell population(s) to investigate their role in tumor formation, progression, and recurrence. Understanding tumor initiating cell populations will provide clues to finding effective therapeutic approaches for these tumors. The neurosphere assay (NSA) due to its simplicity and reproducibility has been used as the method of choice for isolation and propagation of many of this tumor cells. This protocol demonstrates the neurosphere culture method to isolate and expand stem-like cells in surgically resected human GBM tumor tissue. The procedures include an initial chemical digestion and mechanical dissociation of tumor tissue, and subsequently plating the resulting single cell suspension in NSA culture. After 7-10 days, primary neurospheres of 150-200 &mu;m in diameter can be observed and are ready for further passaging and expansion.

This video protocol demonstrates the isolation and expansion of stem like cells from surgically resected human glioblastoma mutliforme (GBM) tumor tissue using the neurosphere assay culture method.

Isolamento e Expansão da Human Glioblastoma Multiforme Células Tumorais Utilizando o Ensaio Neurosphere

Stem-like cells have been isolated in tumors such as breast, lung, colon, prostate and brain. A critical issue in all these tumors, especially in ...

Isolation and Culture of Hippocampal Neurons from Prenatal Mice

Primary cultures of rat and murine hippocampal neurons are widely used to reveal cellular mechanisms in neurobiology. By isolating and growing individual neurons, researchers are able to analyze properties related to cellular trafficking, cellular structure and individual protein localization using a variety of biochemical techniques. Results from such experiments are critical for testing theories addressing the neural basis of memory and learning. However, unambiguous results from these forms of experiments are predicated on the ability to grow neuronal cultures with minimum contamination by other brain cell types. In this protocol, we use specific media designed for neuron growth and careful dissection of embryonic hippocampal tissue to optimize growth of healthy neurons while minimizing contaminating cell types (i.e. astrocytes). Embryonic mouse hippocampal tissue can be more difficult to isolate than similar rodent tissue due to the size of the sample for dissection. We show detailed dissection techniques of hippocampus from embryonic day 19 (E19) mouse pups. Once hippocampal tissue is isolated, gentle dissociation of neuronal cells is achieved with a dilute concentration of trypsin and mechanical disruption designed to separate cells from connective tissue while providing minimum damage to individual cells. A detailed description of how to prepare pipettes to be used in the disruption is included. Optimal plating densities are provided for immuno-fluorescence protocols to maximize successful cell culture. The protocol provides a fast (approximately 2 hr) and efficient technique for the culture of neuronal cells from mouse hippocampal tissue.

We provide a protocol for the culture of highly purified hippocampal neurons from prenatal mouse brains without the use of a feeder glial cell layer.

Isolamento e Cultura de neurônios do hipocampo de ratos pré-natal

Primary cultures of rat and murine hippocampal neurons are widely used to reveal cellular mechanisms in neurobiology. By isolating and growing individual ...

Isolation and Culture of Rat Embryonic Neural Cells: A Quick Protocol

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied successfully to the isolation of mouse and human primary neurons and neural progenitors. Dissociated neurons are maintained in serum-free medium up to several weeks. These cultures can be used for nucleofection, immunocytochemistry, nucleic acids preparation, as well as electrophysiology. Older neuronal cultures can also be transfected with a good efficiency rate by lentiviral transduction and, less efficiently, with calcium phosphate or lipid-based methods such as lipofectamine.

We describe a rapid methodology to isolate and culture hippocampal and cortical neurons from rodent embryos. This protocol allows us to perform experiments in which nearly pure neuronal cultures are required.

Isolamento e cultivo de células neurais embrionárias de ratos: um protocolo rápido

We are describing a quick method to dissociate and culture hippocampal or cortical neurons from E15-17 rat embryos. The procedure can be applied ...

Isolation and Culture of Neural Crest Cells from Embryonic Murine Neural Tube

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to mesenchymal transition (EMT) and migrates throughout the embryo, giving rise to diverse cell types 1-3. NC also has the unique ability to influence the differentiation and maturation of target organs4-6. When explanted in vitro, NC progenitors undergo self-renewal, migrate and differentiate into a variety of tissue types including neurons, glia, smooth muscle cells, cartilage and bone. 
NC multipotency was first described from explants of the avian neural tube7-9. In vitro isolation of NC cells facilitates the study of NC dynamics including proliferation, migration, and multipotency. Further work in the avian and rat systems demonstrated that explanted NC cells retain their NC potential when transplanted back into the embryo10-13. Because these inherent cellular properties are preserved in explanted NC progenitors, the neural tube explant assay provides an attractive option for studying the NC in vitro. 
To attain a better understanding of the mammalian NC, many methods have been employed to isolate NC populations. NC-derived progenitors can be cultured from post-migratory locations in both the embryo and adult to study the dynamics of post-migratory NC progenitors11,14-20, however isolation of NC progenitors as they emigrate from the neural tube provides optimal preservation of NC cell potential and migratory properties13,21,22. Some protocols employ fluorescence activated cell sorting (FACS) to isolate a NC population enriched for particular progenitors11,13,14,17. However, when starting with early stage embryos, cell numbers adequate for analyses are difficult to obtain with FACS, complicating the isolation of early NC populations from individual embryos. Here, we describe an approach that does not rely on FACS and results in an approximately 96% pure NC population based on a Wnt1-Cre activated lineage reporter23. 
The method presented here is adapted from protocols optimized for the culture of rat NC11,13. The advantages of this protocol compared to previous methods are that 1) the cells are not grown on a feeder layer, 2) FACS is not required to obtain a relatively pure NC population, 3) premigratory NC cells are isolated and 4) results are easily quantified. Furthermore, this protocol can be used for isolation of NC from any mutant mouse model, facilitating the study of NC characteristics with different genetic manipulations. The limitation of this approach is that the NC is removed from the context of the embryo, which is known to influence the survival, migration and differentiation of the NC2,24-28.

Isolation of embryonic neural crest from the neural tube facilitates the use of in vitro methods for studying migration, self-renewal, and multipotency of neural crest.

Isolamento e cultivo de células da crista neural do tubo neural embrionário murino

The embryonic neural crest (NC) is a multipotent progenitor population that originates at the dorsal aspect of the neural tube, undergoes an epithelial to ...

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Isolamento e Cultura de astrócitos corticais de rato

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Isolamento e cultura de células endoteliais da Embryonic posencéfalo

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Denver Papillae Protocol for Objective Analysis of Fungiform Papillae

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure consistent scoring between scorers. This protocol builds off of a need that has arisen from the last two decades of taste research using FP as a proxy for taste pore density. FP density has historically been analyzed using Miller &#38; Reedy&#8217;s 1990 characterizations of their morphology: round, stained lighter, large, and elevated. In this work, the authors forewarned that stricter definitions of FP morphology needed to be outlined. Despite this call to action, follow up literature has been scarce, with most studies continuing to cite Miller &#38; Reedy&#8217;s original work. Consequently, FP density reports have been highly variable and, combined with small sample sizes, may contribute to the discrepant conclusions on the role of FP in taste sensitivity. The Genetics of Taste Lab explored this apparent inconsistency in counting and found that scorers were individually prioritizing the importance of these characteristics differently and had no guidance for when a papilla had some, but not all, of the reported qualities of FP. The result of this subjectivity is highly variable FP counts of the same tongue image. The Denver Papillae Protocol has been developed to remedy this consequence through use of a dichotomous key that further defines and prioritizes the importance of the characteristics put forth by Miller &#38; Reedy. The proposed method could help create a standard way to quantify FP for researchers in the field of taste and nutritional studies.

Here we present a protocol to measure fungiform papilla density from digital photographs. This method builds prioritization and objective characteristic metrics into the original descriptive work on fungiform papillae by Miller &#38; Reedy (1990).

Denver Papilas Protocolo para Objective Analysis de papilas fungiformes

The goal of the Denver Papillae Protocol is to use a dichotomous key to define and prioritize the characteristics of fungiform papillae (FP) to ensure ...

Isolation and Culture of Adult Neural Stem Cells from the Mouse Subcallosal Zone

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation into three types of cells: neurons, astrocytes, and oligodendrocytes. Identifying aNSC-derived regions and characterizing the aNSC properties are critical for the potential use of aNSCs and for the elucidation of their role in neural regeneration. The subcallosal zone (SCZ), located between white matter and the hippocampus, has recently been reported to contain aNSCs and continuously give rise to neuroblasts. A low percentage of aNSCs from the SCZ is differentiated into neurons; most cells are differentiated into glial cells, such as oligodendrocytes and astrocytes. These cells are suggested to have a therapeutic potential for traumatic cortical injury. This protocol describes in detail the process to generate SCZ-aNSCs from an adult mouse brain. A brain matrix with intervals of 1 mm is used to obtain the SCZ-containing coronal slices and to precisely dissect the SCZ from the whole brain. The SCZ sections are initially subjected to a neurosphere culture. A well-developed culture system allows for the verification of their characteristics and can increase research on NSCs. A neurosphere culture system provides a useful tool for determining proliferation and collecting the genuine NSCs. A monolayer culture is also an in vitro system to assay proliferation and differentiation. Significantly, this culture system provides a more homogenous environment for NSCs than the neurosphere culture system. Thus, using a discrete brain region, these culture systems will be helpful for expanding our knowledge about aNSCs and their applications for therapeutic uses.

Establishing culture systems for the expansion of adult neural stem cells (aNSCs) allows for the examination and application of aNSCs for therapy. The subcallosal zone (SCZ) has recently been recognized as a novel neuroblast-forming region in adult mice. Here, methods for the isolation, expansion, and differentiation of SCZ-aNSCs are described.

Isolamento e Cultura de células estaminais adultas neurais do Subcallosal Zona Rato

Adult neural stem cells (aNSCs) can be used for the regeneration of damaged brain tissue. NSCs have the potential for differentiation and proliferation ...

Isolation and Culture of Embryonic Mouse Neural Stem Cells

Neural stem cells (NSCs) are multipotent and can give rise to the three major cell types of the central nervous system (CNS). In vitro culture and expansion of NSCs provide a suitable source of cells for neuroscientists to study the function of neurons and glial cells along with their interactions. There are several reported techniques for the isolation of neural stem cells from adult or embryo mammalian brains. During the microsurgical operation to isolate NSCs from different regions of the embryonic CNS, it is very important to reduce the damage to the brain cells to obtain the highest ratio of live and expandable stem cells. A possible technique for stress reduction during isolation of these cells from the mouse embryo brain is the reduction of surgical time. Here, we demonstrate a developed technique for rapid isolation of these cells from the E13 mouse embryo ganglionic eminence. Surgical procedures include harvesting E13 mouse embryos from the uterus, cutting the frontal fontanelle of the embryo with a bent needle tip, extracting the brain from the skull, microdissection of the isolated brain to harvest the ganglionic eminence, dissociation of the harvested tissue in NSC medium to gain a single cell suspension, and finally plating cells in suspension culture to generate neurospheres.

Here, we introduce a novel microsurgical technique for the isolation of neural stem cells from the E13 mouse embryo ganglionic eminence.