This work was supported by the National Institutes of Health (R21OD023194 to JX). This work utilized Core Services supported by Center for Advanced Models for Translational Sciences and Therapeutics (CAMTraST) at the University of Michigan Medical Center.

All animal maintenance, care, and use procedures were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Michigan.
1. Preparation of Cells
<ol>
	<li>Acquire human iPSCs (ACS-1030) from the American Type Culture Collection (ATCC). Culture iPScs on artificial extracellular matrix with feeder-free cell culture medium (see Table of Materials) in a cell culture incubator (5% CO2 at 37 &#176;C) following the supplier&#39;s instructions.
	<ol>
		<li>2 h prior to transfection, treat the iPSCs with 10 &#181;M Rho-associated, coiled-coil containing protein kinase (ROCK) inhibitor Y27632 (use of which reduces apoptosis of dissociated human hiPSCs and increases survival and cloning efficiency of hiPSCs without affecting their pluripotency).</li>
		<li>When transfecting, dissociate iPSCs with cell detachment solution (see Table of Materials) to single cells at 37 &#176;C for 5 min. Count the cell number.</li>
	</ol>
	</li>
	<li>Establish a rabbit fibroblast cell culture using a primary culture of rabbit ear skin tissue biopsies, as previously described10.
	<ol>
		<li>A 0.5 cm x 0.5 cm ear skin biopsy is obtained from the tip of the rabbit ear. Shave the hair off the ear tissue.</li>
		<li>Rinse 2x with Dulbecco&#39;s phosphate-buffered saline (DPBS) with 5% penicillin-streptomycin. Transfer the ear tissue to a new 6 cm tissue culture dish, then cut the tissue into small pieces (~1.0 mm x 1.0 mm). Add a few drops of fetal bovine serum to prevent the tissue from drying out.</li>
		<li>Spread the shredded tissue to a 10 cm tissue culture dish, then add 10 mL of culture medium. Rabbit fibroblast cells are cultured in Dulbecco&#39;s Modified Eagle&#39;s Medium (DMEM) with 10% fetal bovine serum. Put the tissue culture dish in the cell culture incubator (5% CO2 at 37 &#176;C).</li>
		<li>Three to five days after plating, use trypsin-EDTA to digest cells at 37 &#176;C for 2 min. Count the cell number.</li>
	</ol>
	</li>
</ol>
2. Design and Synthesis of gRNAs and Donor Oligos
<ol>
	<li>For each gene, design guide RNA based on the sequence of the targeted locus using an online tool (for example, &#60;http://crispor.tefor.net/&#62;).</li>
	<li>Paste in the DNA sequence of interest.</li>
	<li>Select a genome and protospacer-adjacent motif (PAM). Possible guide sequences in input DNA sequences will be displayed on the output page. It is recommended to select gRNA with higher predicted efficiency and lower off-target potentials.</li>
	<li>Synthesize DNA by a commercial vendor for transcribing gRNAs. Perform in vitro transcription of gRNA using a gRNA synthesis kit according to the manufacturer&#39;s instructions.</li>
	<li>Purify the gRNA using an RNA purification micro column included in the gRNA synthesis kit. Measure the concentration, then store the gRNAs at -80 &#176;C.</li>
	<li>Design an ssODN donor template for each mutation site. The ssODNs can be synthesized by commercial vendors such as IDT. In general, each ssODN is 120-160 nucleotides (nt) in length, consisting of 60-80 nt in the left homology arm and 60-80 nt in the right homology arm. To prevent recutting of the edited DNA, a silent mutation at the PAM should be introduced in the ssODN whenever possible. The CRISPR cut site should be located as close to the intended genomic change as possible.</li>
</ol>
3. Tube Electroporation of Cas9 RNP and ssODNs
<ol>
	<li>Prepare the cells as described in section 1.</li>
	<li>Resuspend 2-3 x 105 cells in 20 &#181;L of electroporation buffer. Pipette up and down carefully to produce a single-cell suspension.</li>
	<li>For Cas9 RNP transfection, premix 2 &#181;g of Cas9-NLS protein with 0.67 &#181;g of gRNA at room temperature (RT) for 10-15 min. Next, gently mix the formed RNP complex along with 2 &#181;g of ssODN with cells.</li>
	<li>Transfer the cell mixture to a 20 &#181;L electroporation tube using universal fit pipette tips provided by the tube electroporation kit. To achieve better electroporation, try to avoid the formation of air bubbles during transfer.</li>
	<li>Place the electroporation tube into the slot of the electroporator and press &#34;Go&#34; to finish. Follow manufacturer&#39;s suggested parameters for each cell type. For example, for human iPSCs and rabbit fibroblast cells, the voltage set is 420 V and pulse time is 30 ms. A successful electroporation cycle is indicated by the pulse report on the display screen of the electroporator.</li>
	<li>After the electroporation, transfer the human iPS cells to 1 mL of pre-warmed Y-27632-containing culture medium described in cell culture part. For rabbit fibroblast cells, transfer them to DMEM with 10% fetal bovine serum.</li>
	<li>Plate the resuspended cells to one well of a 12 well cell culture plate.</li>
	<li>Change the culture medium every day. Y-27632 is removed from the human iPSC culture medium 24 h post-electroporation.</li>
</ol>
4. Analysis of Gene Editing Events
<ol>
	<li>Harvest cells 72 h after electroporation. Digest cells from the culture plate using trypsin-EDTA for rabbit fibroblast cells or cell detachment solution for human iPSCs. After centrifuge, resuspend cells with 350 mL of lysis buffer (1 M Tris HCl, 5 M NaCl, 0.5 M EDTA; pH 8.0, 10% SDS, add 20 &#181;L of 20 mg/mL proteinase K stock per 1 mL of lysis buffer), then incubate at 55 &#176;C overnight.</li>
	<li>Extract the genomic DNA with phenol-chloroform using standard procedures.</li>
	<li>Amplify 100-200 bp DNA fragments containing targeted region using high-fidelity DNA polymerase, then purify the DNA fragments from gels using a gel extraction kit or directly from PCR products using a PCR SV mini kit.</li>
	<li>To determine gene editing efficiency by bacterial colony sequencing, ligase the purified PCR products into a pCR4-TOPO vector using a TOPO TA cloning kit. Randomly pick up bacterial clones, then sequence the inserts using a universal sequencing primer provided by the TOPO TA cloning kit.</li>
	<li>To determine gene editing efficiency by deep sequencing, send the purified PCR products (~100-200 bp) from step 4.3 for CRISPR amplicon sequencing in a DNA sequencing core.</li>
</ol>

<ol>
	<li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Mout, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+Cytosolic+Delivery+of+CRISPR/Cas9-Ribonucleoprotein+for+Efficient+Gene+Editing.">Direct Cytosolic Delivery of CRISPR/Cas9-Ribonucleoprotein for Efficient Gene Editing.</a> ACS Nano. 11 (3), 2452-2458 (2017).</li><li>Zuris, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cationic+lipid-mediated+delivery+of+proteins+enables+efficient+protein-based+genome+editing+in+vitro+and+in+vivo.">Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo.</a> Nature Biotechnology. 33 (1), 73-80 (2015).</li><li>Miller, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-Viral+CRISPR/Cas+Gene+Editing+In+Vitro+and+In+Vivo+Enabled+by+Synthetic+Nanoparticle+Co-Delivery+of+Cas9+mRNA+and+sgRNA.">Non-Viral CRISPR/Cas Gene Editing In Vitro and In Vivo Enabled by Synthetic Nanoparticle Co-Delivery of Cas9 mRNA and sgRNA.</a> Angew Chem Int Ed Engl. 56 (4), 1059-1063 (2017).</li><li>Finn, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Single+Administration+of+CRISPR/Cas9+Lipid+Nanoparticles+Achieves+Robust+and+Persistent+In+Vivo+Genome+Editing.">A Single Administration of CRISPR/Cas9 Lipid Nanoparticles Achieves Robust and Persistent In Vivo Genome Editing.</a> Cell Reports. 22 (9), 2227-2235 (2018).</li><li>Liang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+cell-targeted+delivery+of+CRISPR/Cas9+by+aptamer-functionalized+lipopolymer+for+therapeutic+genome+editing+of+VEGFA+in+osteosarcoma.">Tumor cell-targeted delivery of CRISPR/Cas9 by aptamer-functionalized lipopolymer for therapeutic genome editing of VEGFA in osteosarcoma.</a> Biomaterials. 147, 68-85 (2017).</li><li>Luo, Y. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Macrophage-Specific+in+Vivo+Gene+Editing+Using+Cationic+Lipid-Assisted+Polymeric+Nanoparticles.">Macrophage-Specific in Vivo Gene Editing Using Cationic Lipid-Assisted Polymeric Nanoparticles.</a> ACS Nano. 12 (2), 994-1005 (2018).</li><li>Wang, H. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonviral+gene+editing+via+CRISPR/Cas9+delivery+by+membrane-disruptive+and+endosomolytic+helical+polypeptide.">Nonviral gene editing via CRISPR/Cas9 delivery by membrane-disruptive and endosomolytic helical polypeptide.</a> Proceedings of the National Academy of Sciences of the United States of America. 115 (19), 4903-4908 (2018).</li><li>Xu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+homology-directed+gene+editing+by+CRISPR/Cas9+in+human+stem+and+primary+cells+using+tube+electroporation.">Efficient homology-directed gene editing by CRISPR/Cas9 in human stem and primary cells using tube electroporation.</a> Scientific Reports. 8 (1), 11649 (2018).</li><li>Du, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beneficial+effect+of+young+oocytes+for+rabbit+somatic+cell+nuclear+transfer.">Beneficial effect of young oocytes for rabbit somatic cell nuclear transfer.</a> Cloning Stem Cells. 11 (1), 131-140 (2009).</li><li>Allenspach, E., Rawlings, D. J., Scharenberg, A. M., Adam, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> GeneReviews(R). , (1993).</li><li>Friedman, J., et al., Adam, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> GeneReviews(R). , (1993).</li><li>Hidaka, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Most+T790M+mutations+are+present+on+the+same+EGFR+allele+as+activating+mutations+in+patients+with+non-small+cell+lung+cancer.">Most T790M mutations are present on the same EGFR allele as activating mutations in patients with non-small cell lung cancer.</a> Lung Cancer. 108, 75-82 (2017).</li><li>Ma, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correction+of+a+pathogenic+gene+mutation+in+human+embryos.">Correction of a pathogenic gene mutation in human embryos.</a> Nature. 548 (7668), 413-419 (2017).</li><li>Vakulskas, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-fidelity+Cas9+mutant+delivered+as+a+ribonucleoprotein+complex+enables+efficient+gene+editing+in+human+hematopoietic+stem+and+progenitor+cells.">A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells.</a> Nature Medicine. 24 (8), 1216-1224 (2018).</li><li>Song, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+and+Pneumocystis+Infections+in+the+Lungs+of+Gene-Knockout+Rabbits+with+Severe+Combined+Immunodeficiency.">Bacterial and Pneumocystis Infections in the Lungs of Gene-Knockout Rabbits with Severe Combined Immunodeficiency.</a> Frontiers in Immunology. 9, 429 (2018).</li><li>Song, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+immunodeficient+rabbits+by+multiplex+embryo+transfer+and+multiplex+gene+targeting.">Production of immunodeficient rabbits by multiplex embryo transfer and multiplex gene targeting.</a> Scientific Reports. 7 (1), 12202 (2017).</li></ol>

J. C. works at Celetrix LLC, manufacturer of the tube electroporator. L. M., L. J., J. S., D. Y., J. Z., Y. E. C., and J. X. declare no competing interests.

The tube electroporation method was effective in delivering CRISPR/Cas9 RNP and ssODNs to rabbit and human cells, leading to robust precise gene editing (PGE). The primary difference between TE and other conventional electroporation devices is the use of a tube, in which two electrodes are on the top and bottom of the tube and the sample is loaded in full then sealed upon electroporation (Figure 1). In contrast, in a conventional cuvette, the electrodes are on the sides and the sample is not fully sealed during electroporation. This new design reduces air bubble generation and compresses air bubble size, which consequently improves even distribution of electric voltage, and as a result leads to reduced cell death and high transfection efficiency9. In the present work, high PGE rates (15%-37%) were achieved targeting EGFR, Mybpc3 and HBB genes in human iPSCs. These results are consistent with a prior report in which high PGE rates were achieved in human stem cells9.
Disease-causing mutations were targeted in IL2RG and SPR genes in rabbit cells. Recently, IL2RG-knockout rabbits have been produced as models for human X-linked severe combined immunodeficiency (SCID-X1)16,17. The present work shows that patient IL2RG mutations (e.g., C231Y and Q235X) can be efficiently generated in rabbit cells, demonstrating the feasibility of creating SCID-X1 rabbit models carrying patient mutations. It was also demonstrated that SPR R150G mutations can be efficiently created in rabbit cells. This mutation causes motor and cognitive deficits in children12. These IL2RG and SPR mutation rabbit models, once generated, may serve as valuable preclinical models for translational studies. They may also be used to establish gene editing-based therapeutics for these monogenic diseases.
One concern for CRISPR/Cas9-mediated gene editing applications is the off-target editing events. Indel rates were analyzed at predicted top off-target sites for sgRNAs used in this study (Table S1), using methods previously described9. In total, seven potential top off-target loci were analyzed for sg-rb-IL2RG-01, five for sg-rb-SPR, seven for sg-hEGFR, five for sg-hMybpc3, and seven for sg-hHBB), using the primers listed in Table S2. No off-target indels were revealed by the T7E1 assays (Figure S1), indicating minimal off-target risks for CRISPR/Cas9-mediated gene editing using these sgRNAs. It also indicates that the tube electroporation method itself does not cause or increase off-target edits. Nevertheless, efforts should be dedicated to reduce or eliminate undesirable off-target edits. Whole-genome sequencing may be necessary to exclude such events for cells that are intended to be used in clinical applications.
At the technical level, the following are considered key factors to achieving efficient precise genome editing by CRISPR/Cas9 RNP tube electroporation. First, it is advised to select an efficient sgRNA with predicted low off-target potential. It is important to validate the indel efficiency of the selected sgRNA before using it for PEG applications. It is not rare that a software predicted good sgRNA fails at the validation step.
Second, to achieve high PGE, it is recommended to induce a PAM mutation to the ssODN donor whenever possible. The rationale is that by doing so, CRISPR/Cas9 re-cutting after donor template integration is prevented. In certain cases, the PGE itself introduces PAM mutations. In other cases, it is possible to introduce silent mutations to the PAM sequence. In the event that a PAM mutation is not possible, it is advised to try to include several silent mutations in the donor that corresponds to the sgRNA sequence.
Thirdly, particularly relevant to TE, it is important to avoid the formation of air bubbles when transferring cells and RNP mixture to the electroporation tube. While the design of a TE tube already minimizes air bubble formation, careful handling will further reduce and may even complete avoid air bubble formation. A trouble shooting guide for frequent problems that may be encountered in the application of tube electroporation for CRISPR/Cas9 ribonucleoprotein mediated precise gene editing is provided in Table 2.
In conclusion, it is demonstrated here that tube electroporation is an effective means for the delivery of CRISPR/Cas9 RNP and ssODNs to mammalian cells to achieve high PGE rates. This new TE transfection technique and its robust precise gene editing rate may facilitate the development of gene editing applications.

CRISPR/Cas9 is the most commonly used programmable nuclease for gene editing. It works through single guide RNA (sgRNA)-mediated recognition of both target sequences and an adjacent protospacer adjacent motif (PAM) sequence in the genome. The Cas9 nuclease generates a double-stranded DNA break (DSB) located three nucleotides upstream of the PAM sequence1. The DSBs are repaired either through error-prone non-homologous end joining (NHEJ) or homology-directed repair (HDR) pathways. To achieve precise gene editing through the HDR pathway, donor templates are often provided in the format of plasmid DNA (pDNA) or single-stranded oligodeoxynucleotide (ssODN).
CRISPR/Cas9 and the sgRNA can be delivered to the cells in three formats: the ribonucleoprotein (RNP) complex of Cas9 protein and gRNA2,3; Cas9 mRNA and sgRNA4,5; or plasmid DNA (pDNA) that contains the necessary promoters, driven sgRNA, and Cas9 coding region6,7,8. Many groups have demonstrated that when CRISPR/Cas9 is delivered as RNP, the gene editing efficiency often outperforms those achieved in pDNA or mRNA formats, attributable to the much smaller size of RNP compared to the nucleic acids9. Furthermore, it has been previously shown that a novel tube electroporation (TE) machine is particularly effective in gene editing applications in several cell types9.
Presented in the present work is a step-by-step protocol in utilizing TE for the delivery of CRISPR/Cas9 RNP to mammalian cells of different species at several clinically relevant loci. This novel TE transfection technique and high HDR rate phenomenon may find broad applications in biomedical research.

<table border="0" cellpadding="0" cellspacing="0" style="width:1364px;" width="1364">
	<tbody>
		<tr height="18">
			<td height="18" style="height:19px;width:279px;">Accutase</td>
			<td style="width:240px;">STEMCELL Technologies</td>
			<td style="width:246px;">792</td>
			<td style="width:600px;">Cell detachment solution for human iPSCs, first used in Step 1.1.2.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:279px;">Cas9 Nuclease 3NLS</td>
			<td style="width:240px;">IDT</td>
			<td style="width:246px;">1074182</td>
			<td style="width:600px;">Cas9 protein, first used in Step 3.3.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:279px;">DMEM</td>
			<td style="width:240px;">Thermo Fisher</td>
			<td style="width:246px;">11965092</td>
			<td style="width:600px;">For cell culture, first used in Step 1.2.3.&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DPBS</td>
			<td style="width:240px;">Thermo Fisher</td>
			<td>1708075</td>
			<td>For preparing cell culture, first used in Step 1.2.2.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EDTA</td>
			<td>Lonza</td>
			<td>51201</td>
			<td>For making lysis buffer, first used in Step 4.1.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:279px;">Electroporation buffer</td>
			<td style="width:240px;">Celetrix</td>
			<td style="width:246px;">13&#8211;0104</td>
			<td style="width:600px;">The electroporation buffer, first used in Step 3.2.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:22px;width:279px;">Electroporation tubes</td>
			<td style="width:240px;">Celetrix</td>
			<td style="width:246px;">20 &#956;L: 12&#8211;0107; 120 &#956;L: 12&#8211;0104</td>
			<td style="width:600px;">The electroporation tube, first used in Step 3.4.&#160;</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:279px;">Electroporator</td>
			<td style="width:240px;">Celetrix</td>
			<td style="width:246px;">CTX-1500A LE</td>
			<td style="width:600px;">The tube electroporation machine, first used in Step 3.5</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:279px;">Fetal bovine serum</td>
			<td style="width:240px;">Sigma Aldrich</td>
			<td style="width:246px;">12003C</td>
			<td style="width:600px;">For cell culture, first used in Step 1.2.2.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Forma CO2 Incubators</td>
			<td style="width:240px;">Thermo Fisher</td>
			<td>Model 370</td>
			<td>For cell culture, first used in Step 1.1.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:279px;">Gel Extraction Kit</td>
			<td style="width:240px;">Qiagen</td>
			<td style="width:246px;">28115</td>
			<td style="width:600px;">For gel purification, first used in Step 4.3.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Human&#160; induced pluripotent stem cells</td>
			<td>American Type Culture Collection</td>
			<td>ACS-1030</td>
			<td>Human iPSCs, first used in Step 1.1.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:279px;">Matrigel&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td style="width:240px;">Corning</td>
			<td style="width:246px;">354277</td>
			<td style="width:600px;">Artificial extracellular matrix; for precoating cell culture plate, first used in Step 1.1.&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:279px;">mTeSR 1 medium&#160;</td>
			<td style="width:240px;">STEMCELL Technologies</td>
			<td style="width:246px;">85850</td>
			<td style="width:600px;">Feeder-free cell culture medium for human iPSCs, first used in Step 1.1.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:279px;">PCR SV mini</td>
			<td style="width:240px;">GeneAll</td>
			<td style="width:246px;">103-102</td>
			<td style="width:600px;">For PCR product purification, first used in Step 4.3.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin-Streptomycin</td>
			<td style="width:240px;">Thermo Fisher</td>
			<td>15140163</td>
			<td>For preparing cell culture, first used in Step 1.2.2.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phenol-chloroform</td>
			<td style="width:240px;">Thermo Fisher</td>
			<td>15593031</td>
			<td>For DNA extraction, first used in Step 4.2.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:279px;">Precision gRNA Synthesis Kit</td>
			<td style="width:240px;">Invitrogen</td>
			<td style="width:246px;">A29377</td>
			<td style="width:600px;">For the generation of full length gRNA (guide RNA), first used in Step 2.4.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K Solution</td>
			<td style="width:240px;">Thermo Fisher</td>
			<td>AM2548</td>
			<td>For DNA extraction, first used in Step 4.1.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:279px;">Q5 high-fidelity DNA polymerase</td>
			<td style="width:240px;">NEB</td>
			<td style="width:246px;">M0491</td>
			<td style="width:600px;">For PCR amplification, first used in Step 4.3.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium dodecyl sulfate</td>
			<td>Sigma Aldrich</td>
			<td>L3771</td>
			<td>For making lysis buffer, first used in Step 4.1.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:279px;">TA Cloning Kit&#160;</td>
			<td style="width:240px;">Thermo Fisher</td>
			<td style="width:246px;">K457502</td>
			<td style="width:600px;">For TA clone sequencing, first used in Step 4.4.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tissue Culture Dish (10 cm)</td>
			<td>FALCON</td>
			<td>353003</td>
			<td>For cell culture, first used in Step 1.2.3.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tissue Culture Dish (12 well)</td>
			<td>FALCON</td>
			<td>353043</td>
			<td>For cell culture, first used in Step 3.7.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tissue Culture Dish (6 cm)</td>
			<td>FALCON</td>
			<td>353004</td>
			<td>For cell culture, first used in Step 1.2.2.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tris HCl</td>
			<td>Thermo Fisher</td>
			<td>BP1757-500</td>
			<td>For making lysis buffer, first used in Step 4.1.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trypsin-EDTA</td>
			<td style="width:240px;">Thermo Fisher</td>
			<td>25200056</td>
			<td>For cell digestion, first used in Step 1.2. 4.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Universal Fit Pipette Tips&#160;</td>
			<td style="width:240px;">Celetrix</td>
			<td>14-0101</td>
			<td>For electroporation, first used in Step 3.4.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:279px;">Y27632</td>
			<td style="width:240px;">LC Labs</td>
			<td style="width:246px;">Y-5301</td>
			<td style="width:600px;">The apoptosis inhibotor, first used in Step 1.1.1.&#160;</td>
		</tr>
	</tbody>
</table>

crispr/cas9 ribonucleoprotein-mediated precise gene editing by tube electroporation

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of CRISPR/Cas9 elements into the target cells by transfection is a prerequisite for efficient gene editing. This protocol demonstrates that tube electroporation (TE) machine-mediated delivery of CRISPR/Cas9 ribonucleoprotein (RNP), along with single-stranded oligodeoxynucleotide (ssODN) donor templates to different types of mammalian cells, leads to robust precise gene editing events. First, TE was applied to deliver CRISPR/Cas9 RNP and ssODNs to induce disease-causing mutations in the interleukin 2 receptor subunit gamma (IL2RG) gene and sepiapterin reductase (SPR) gene in rabbit fibroblast cells. Precise mutation rates of 3.57%-20% were achieved as determined by bacterial TA cloning sequencing. The same strategy was then used in human iPSCs on several clinically relevant genes including epidermal growth factor receptor (EGFR), myosin binding protein C, cardiac (Mybpc3), and hemoglobin subunit beta (HBB). Consistently, highly precise mutation rates were achieved (11.65%-37.92%) as determined by deep sequencing (DeepSeq). The present work demonstrates that tube electroporation of CRISPR/Cas9 RNP represents an efficient transfection protocol for gene editing in mammalian cells.

TE of Cas9 RNP and ssODNs to rabbit fibroblast cells
The overall process of TE-mediated delivery of Cas9 RNP to mammalian cells is illustrated in Figure 1. First, C231Y and Q235X mutations were produced in the IL2RG gene, and the R150G mutation was produced in the SPR gene in rabbit fibroblast cells. Loss-of-function mutations in IL2RG and SPR genes are known to cause primary immunodeficiency11 and motor and cognitive deficits12, respectively.
The specific sgRNA designs are illustrated in Figure 2A. The primers used to amplify the targeted regions are listed in Table 3. Sequences of ssODNs are shown in Table 1. The gene editing rates were determined by bacterial TA cloning (Figure 2B). At the IL2RG C231 locus, out of the 28 clones that were sequenced, one (3.57%) carried the precise C231Y mutation, four (14.28%) carried insertion or deletion (indel) mutations, and the remaining 23 (82%) were wild-type. At the IL2RG Q235 locus, out of the 27 clones that were sequenced, two (7.41%) carried the precise Q235X mutation, three carried indel mutations (11.11%) and the remaining were wild-type. At the SPG R150 locus, of the 20 clones sequenced, five (25%) carried the precise R150G mutation, 10 (50%) carried indel mutations, and the remaining were wild-type.
TE of Cas9 RNP and ssODNs to human iPSCs
TE was then used to deliver Cas9 RNP and ssODNs to human iPSCs and target clinically relevant loci in EGFR, Mybpc3, and HBB genes. Point mutations in the EGFR T790 proximal region confer resistance to EGFR tyrosine kinase inhibitors in patients of non-small cell lung cancer (NSCLC) harboring activating mutations of EGFR13. A frameshift mutation in exon 16 in Mybpc3 is implicated in hypertrophic cardiomyopathy14. The E6V point mutation in the HBB gene leads to sickle cell disease15.
The specific sgRNA designs are illustrated in Figure 3A. The primers used to amplify the targeted regions are listed in Table 3. Sequences of ssODNs are shown in Table 1. The gene editing rates were determined by DeepSeq (Figure 3B). At the EGFR locus, 15.68% of alleles carried the precise point mutations (6,315 reads), 22.75% carried indel mutations (9,162 reads), and the remaining 61.57% were wild-type (24,797 reads). At the Mybpc3 locus, 37.92% carried the precise 4-bp TGAA deletion (11,654 reads), 2.24% carried indel mutations (410 reads) and the remaining 59.84% were wild-type (18,692 reads). At the HBB locus, 11.65% carried the precise E6V mutation (6,565 reads), 23.35% carried indel mutations (13,163 reads) and the remaining 65% were wild-type (36,644 reads).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59512/59512fig1.jpg" /> 
Figure 1: Flow chart of tube electroporation of Cas9 RNP.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59512/59512fig2.jpg" /> 
Figure 2: Gene editing of rabbit fibroblast cells. (A) Illustration of target sequences. Boxes indicate targeted loci. Underlined letters correspond to gRNA sequences. Red colored letters indicate PAM sequences. (B) TA cloning results of gene editing events. Boxes indicate precisely mutated loci. Indel sequence shown is only representative of one allele type. Other indel sequences are not shown. <a href="https://www.jove.com/files/ftp_upload/59512/59512fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59512/59512fig3.jpg" /> 
Figure 3: Gene editing of human iPSCs. (A) Illustration of target sequences. Boxes indicate targeted loci. Underlined letters correspond to gRNA sequence. Red colored letters indicate PAM sequences. (B) Deepseq results of gene editing events. Boxes indicate precisely mutated loci. Red colored letters indicate silent mutations that were introduced in the donor templates. Indel sequence shown is only representative of one allele type. Other indel sequences are not shown. <a href="https://www.jove.com/files/ftp_upload/59512/59512fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Locus&#160;</td>
			<td colspan="8" rowspan="2">Oligo sequence 
			&#160;</td>
		</tr>
		<tr>
			<td>(targeted mutation)</td>
		</tr>
		<tr>
			<td>Rabbit IL2RG (C231Y)</td>
			<td colspan="8">AGCGTGGATGGGCAGAAACTCTACACGTTCCGAGTCCGGAGCCGTTTTAACCCTTTGTATGGGAGTGCTCAGCATTGGAGT 
			GAATGGAGCCACCCGATCCACTGGGGGAGCAAAACTTCAAAGGGTAAAATGGGCCT</td>
		</tr>
		<tr>
			<td>Rabbit IL2RG (Q235X)</td>
			<td colspan="8">AGCGTGGATGGGCAGAAACTCTACACGTTCCGAGTCCGGAGCCGTTTTAACCCTTTGTGTGGGAGTGCTTAGCATTGGAGT 
			GAATGGAGCCACCCGATCCACTGGGGGAGCAAAACTTCAAAGGGTAAAATGGGCCT</td>
		</tr>
		<tr>
			<td>Rabbit SPR</td>
			<td colspan="8" rowspan="2">gacctccatgctctgcctgacctcctgcatcctgaaggcgtttcctgccagtcctggCctcagcgggactgtggtgaacatctcgtcgctgtgtgccctgcagcccttcaagggctggg 
			cgctgtac</td>
		</tr>
		<tr>
			<td>(R150G)</td>
		</tr>
		<tr>
			<td>Human EGFR</td>
			<td colspan="8" rowspan="2">ACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCTACAGTCCAACTGATTACCC 
			AGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATATTGGCTCCCAGTAC</td>
		</tr>
		<tr>
			<td>(Point mutations proximate to T790)</td>
		</tr>
		<tr>
			<td>Human Mybpc3</td>
			<td colspan="8" rowspan="2">GCCCCCTGTGCTCATCACGCGCCCCTTGGAGGACCAGCTGGTGATGGTGGGGCAGCGGGTGGAGTTTGCGAGGTATCGGA 
			GGAGGGGGCGCAAGTCAAATGGTGAGTTCCAGAAGCACGGGGCATGGGTGTTGGGGGCAT</td>
		</tr>
		<tr>
			<td>(4-bp deletion)</td>
		</tr>
		<tr>
			<td>Human HBB&#160;</td>
			<td colspan="8" rowspan="2">TCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGTGGAGAAGTCTGCAGTTACTGCC 
			CTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAG</td>
		</tr>
		<tr>
			<td>(E6V)</td>
		</tr>
	</tbody>
</table>
Table 1: Sequences of ssODNs. 
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step</td>
			<td>Problem</td>
			<td>Possible reasons</td>
			<td>Solutions</td>
		</tr>
		<tr>
			<td>2.1</td>
			<td>Low indel rate</td>
			<td>Poor guide RNA design, Guide RNA stocks &#62;6 months,&#160; low guide RNA concentration</td>
			<td>Redesign guide RNA, produce/order new guide RNA.</td>
		</tr>
		<tr>
			<td>2.3</td>
			<td>Low PGE efficiency</td>
			<td>poor donor DNA design, low efficient guide RNA, incorrect amount of donor DNA or poor quality DNA</td>
			<td>Increase homology arm length, introduce PAM mutation, introduce silent mutations to the donor DNA, use a more efficient guide RNA, Optimize the ratio of Cas9 protein over guide RNA.</td>
		</tr>
		<tr>
			<td>3.4</td>
			<td>Failed transfection</td>
			<td>Air bubbles formed during transferring cells-buffer mixture to electroporation tube, incorrect voltage/duration setting</td>
			<td>Try to avoid the formation of air bubbles, adjust the voltage/duration setting.</td>
		</tr>
		<tr>
			<td>3.6</td>
			<td>low cell viability after electroporation</td>
			<td>Low survival of single human ipsc</td>
			<td>Add ROCK inhibitor after electroporation, increase number of cells.</td>
		</tr>
		<tr>
			<td>4.1</td>
			<td>Failed PCR</td>
			<td>High GC contents, or repetitive sequence</td>
			<td>Optimize PCR condition, add DMSO to PCR system.</td>
		</tr>
	</tbody>
</table>
Table 2: Troubleshooting guides for frequent problems. 
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>sequence</td>
			<td>note</td>
		</tr>
		<tr>
			<td>Rb-IL2RG-F</td>
			<td>CATGACAGTGACAGGGTCCC</td>
			<td rowspan="2">For amplifying rabbit IL2RG DNA fragment</td>
		</tr>
		<tr>
			<td>Rb-IL2RG-R</td>
			<td>TGCCAGAGACACAAGCGAAC</td>
		</tr>
		<tr>
			<td>Rb-SPR-F</td>
			<td>GTACTTTGGAGGGACAGAGG</td>
			<td rowspan="2">For amplifying rabbit SPR DNA fragment</td>
		</tr>
		<tr>
			<td>RB-SPR-R</td>
			<td>CTCAGCACCCTGACACTGGG</td>
		</tr>
		<tr>
			<td>H-EGFR-F</td>
			<td>TGATGGCCAGCGTGGACAAC</td>
			<td rowspan="2">For amplifying human EGFR DNA fragment</td>
		</tr>
		<tr>
			<td>H-EGFR-R</td>
			<td>ACCAGTTGAGCAGGTACTGGG</td>
		</tr>
		<tr>
			<td>H-Mybpc3-F</td>
			<td>ATGCCCCGTGCTTCTGGAAC</td>
			<td rowspan="2">For amplifying human Mybpc3 DNA fragment</td>
		</tr>
		<tr>
			<td>H-Mybpc3-R</td>
			<td>TCAGGGGAGCCAACCCTCAT</td>
		</tr>
		<tr>
			<td>H-HBB-F</td>
			<td>TAACCTTGATACCAACCTGC</td>
			<td rowspan="2">For amplifying human HBB DNA fragment</td>
		</tr>
		<tr>
			<td>H-HBB-R</td>
			<td>CATTTGCTTCTGACACAACT</td>
		</tr>
	</tbody>
</table>
Table 3: Primers used in step 4.3.

Watch this Scientific Journal Video about CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation at JoVE.com

CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

CRISPR/Cas9 ribonucleoprotein-boru Elektroporasyon tarafından aracılı hassas gen düzenleme

Presented here is a protocol for efficient CRISPR/Cas9 ribonucleoprotein-mediated gene editing in mammalian cells using tube electroporation.

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of ...

crisprcas9-ribonucleoprotein-mediated-precise-gene-editing-tube

Research

JoVE Journal

Genetics

13.7K Görüntüleme.  University of Michigan Medical Center. Cas9 elemanlarının güvenli ve etkili bir şekilde hücrelere teslim ilerler, gen düzenleme temelli tedaviler için çok önemlidir. Burada gösterdiğimiz protokoller bu yönde yeni bir yaklaşım sergiliyor. Protokol, tüp elektroporasyon adı verilen yeni bir elektroporasyon yöntemini kullanmaktadır.Bu yüksek hücresel sağkalım oranları yanı sıra gen düzenleme oranları yol açar. Tüp elektroporasyon yöntemi virüs, ilaç ve muhabir zenginleştirme ücretsizdir. Bunlar...

Video: CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the identification and verification of a drug resistance gene in the Apicomplexan parasite Toxoplasma gondii, the method of Quantitative Trait Locus (QTL) mapping using a Whole Genome Sequence (WGS) -based genetic map and the method of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 -based gene editing. The approach of QTL mapping allows one to test if there is a correlation between a genomic region(s) and a phenotype. Two datasets are required to run a QTL scan, a genetic map based on the progeny of a recombinant cross and a quantifiable phenotype assessed in each of the progeny of that cross. These datasets are then formatted to be compatible with R/qtl software that generates a QTL scan to identify significant loci correlated with the phenotype. Although this can greatly narrow the search window of possible candidates, QTLs span regions containing a number of genes from which the causal gene needs to be identified. Having WGS of the progeny was critical to identify the causal drug resistance mutation at the gene level. Once identified, the candidate mutation can be verified by genetic manipulation of drug sensitive parasites. The most facile and efficient method to genetically modify T. gondii is the CRISPR/Cas9 system. This system comprised of just 2 components both encoded on a single plasmid, a single guide RNA (gRNA) containing a 20 bp sequence complementary to the genomic target and the Cas9 endonuclease that generates a double-strand DNA break (DSB) at the target, repair of which allows for insertion or deletion of sequences around the break site. This article provides detailed protocols to use CRISPR/Cas9 based genome editing tools to verify the gene responsible for sinefungin resistance and to construct transgenic parasites.

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Details are presented on how QTL mapping with a whole genome sequence based genetic map can be used to identify a drug resistance gene in Toxoplasma gondii and how this can be verified with the CRISPR/Cas9 system that efficiently edits a genomic target, in this case the drug resistance gene.

QTL Haritalama ve CRISPR / Cas9 Düzenlemesi, bir İlaç Direnç Geninin Belirlenmesi için<emToksoplasma gondii</em

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Genetik

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

Memeli Hücrelerinde CRISPR / Cas9 aracılı Gen Knockout&#39;larının Seçime Bağlı ve Bağımsız Üretimi

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point mutations, which often are responsible for a variety of human inherited disorders. Using a well-established cell-based model system, the point mutation of a single-copy mutant eGFP gene integrated into HCT116 cells has been repaired using this combinatorial approach. The analysis of corrected and uncorrected cells reveals both the precision of gene editing and the development of genetic lesions, when indels are created in uncorrected cells in the DNA sequence surrounding the target site. Here, the specific methodology used to analyze this combinatorial approach to the gene editing of a point mutation, coupled with a detailed experimental strategy to measuring indel formation at the target site, is outlined. This protocol outlines a foundational approach and workflow for investigations aimed at developing CRISPR/Cas9-based gene editing for human therapy. The conclusion of this work is that on-site mutagenesis takes place as a result of CRISPR/Cas9 activity during the process of point mutation repair. This work puts in place a standardized methodology to identify the degree of mutagenesis, which should be an important and critical aspect of any approach destined for clinical implementation.

This protocol outlines the workflow of a CRISPR/Cas9-based gene editing system for the repair of point mutations in mammalian cells. Here, we use a combinatorial approach to gene editing with a detailed follow-on experimental strategy for measuring indel formation at the target site&#8212;in essence, analyzing onsite mutagenesis.

Yerinde mutagenisitesinin CRISPR/Cas9 ve SsODN insan hücrelerinde tarafından katalize nokta mutasyon onarım bir fonksiyonu olarak incelemek için standart bir metodoloji

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene function. Gene knockout has been used to study these gene functions in vivo. The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system is a powerful tool used to edit genomic DNA sequences to alter gene function. While the traditional approach has been to introduce CRISPR/Cas9 mRNA into the single cell embryos through microinjection, this can be a slow and inefficient process in catfish. Here, a detailed protocol for microinjection of channel catfish embryos with CRISPR/Cas9 protein is described. Briefly, eggs and sperm were collected and then artificial fertilization performed. Fertilized eggs were transferred to a Petri dish containing Holtfreter's solution. Injection volume was calibrated and then guide RNAs/Cas9 targeting the toll/interleukin 1 receptor domain-containing adapter molecule (TICAM 1) gene and rhamnose binding lectin (RBL) gene were microinjected into the yolk of one-cell embryos. The gene knockout was successful as indels were confirmed by DNA sequencing. The predicted protein sequence alterations due to these mutations included frameshift and truncated protein due to premature stop codons.

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

A simple and efficient microinjection protocol for gene editing in channel catfish embryos using the CRISPR/Cas9 system is presented. In this protocol, guide RNAs and Cas9 protein were microinjected into the yolk of one-cell embryos. This protocol has been validated by knocking out two channel catfish immune-related genes.

CRISPR/Cas9 Protein gen düzenleme için mikroenjeksiyon kanal yayın balığı, Ictalurus yılan, embriyo içine

The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene ...

A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells and mediating high levels of gene expression. However, their ability to integrate into the host cell genome enhances the risk of insertional mutagenicity and thus raises safety concerns and limits their usage in clinical settings. Further, the persistent expression of gene-editing components delivered by these integration-competent lentiviral vectors (ICLVs) increases the probability of promiscuous gene targeting. As an alternative, a new generation of integrase-deficient lentiviral vectors (IDLVs) has been developed that addresses many of these concerns. Here the production protocol of a new and improved IDLV platform for CRISPR-mediated gene editing and list the steps involved in the purification and concentration of such vectors is described and their transduction and gene-editing efficiency using HEK-293T cells was demonstrated. This protocol is easily scalable and can be used to generate high titer IDLVs that are capable of transducing cells in vitro and in vivo. Moreover, this protocol can be easily adapted for the production of ICLVs.

We describe the production strategy of integrase-deficient lentiviral vectors (IDLVs) as vehicles for delivering CRISPR/Cas9 to cells. With an ability to mediate quick and robust gene editing in cells, IDLVs present a safer and equally effective vector platform for gene delivery compared to integrase-competent vectors.

Integrase-eksik Lentiviral vektörler üretimi için CRISPR/Cas9-aracılı Gene hücre bölünmesi içinde nakavt için bir iletişim kuralı

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development of a customizable platform to rapidly generate gene modifications in a wide variety of organisms, including zebrafish. CRISPR-based genome editing uses a single guide RNA (sgRNA) to target a CRISPR-associated (Cas) endonuclease to a genomic DNA (gDNA) target of interest, where the Cas endonuclease generates a double-strand break (DSB). Repair of DSBs by error-prone mechanisms lead to insertions and/or deletions (indels). This can cause frameshift mutations that often introduce a premature stop codon within the coding sequence, thus creating a protein-null allele. CRISPR-based genome engineering requires only a few molecular components and is easily introduced into zebrafish embryos by microinjection. This protocol describes the methods used to generate CRISPR reagents for zebrafish microinjection and to identify fish exhibiting germline transmission of CRISPR-modified genes. These methods include in vitro transcription of sgRNAs, microinjection of CRISPR reagents, identification of indels induced at the target site using a PCR-based method called a heteroduplex mobility assay (HMA), and characterization of the indels using both a low throughput and a powerful next-generation sequencing (NGS)-based approach that can analyze multiple PCR products collected from heterozygous fish. This protocol is streamlined to minimize both the number of fish required and the types of equipment needed to perform the analyses. Furthermore, this protocol is designed to be amenable for use by laboratory personal of all levels of experience including undergraduates, enabling this powerful tool to be economically employed by any research group interested in performing CRISPR-based genomic modification in zebrafish.

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Targeted genome editing in the model system Danio rerio (zebrafish) has been greatly facilitated by the emergence of CRISPR-based approaches. Herein, we describe a streamlined, robust protocol for generation and identification of CRISPR-derived nonsense alleles that incorporates the heteroduplex mobility assay and identification of mutations using next-generation sequencing.

Verimli üretim ve Model sistem Danio rerio kimlik CRISPR/Cas9 tarafından oluşturulan Gene altını gizleme

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Fare ve insan hematopoetik progenitör hücre tarafından CRISPR/Cas9 yüksek verimli Gene bozulma

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical regions, is caused by infection with Plasmodium parasites. The development of more effective drugs to combat malaria can be accelerated by improving our understanding of the biology of this complex parasite. Genetic manipulation of these parasites is key to understanding their biology; however, historically the genome of P. falciparum has been difficult to manipulate. Recently, CRISPR/Cas9 genome editing has been utilized in malaria parasites, allowing for easier protein tagging, generation of conditional protein knockdowns, and deletion of genes. CRISPR/Cas9 genome editing has proven to be a powerful tool for advancing the field of malaria research. Here, we describe a CRISPR/Cas9 method for generating glmS-based conditional knockdown mutants in P. falciparum. This method is highly adaptable to other types of genetic manipulations, including protein tagging and gene knockouts.

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

We describe a method for generating glmS-based conditional knockdown mutants in Plasmodium falciparum using CRISPR/Cas9 genome editing.

CRISPR/Cas9 gen düzenleme yapmak koşullu mutantlar, insan sıtma parazit P. falciparum için

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical ...

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target against T. cruzi, it is important to validate the essentiality of the target gene in the mammalian stage of the parasite, the amastigote. Amastigotes of T. cruzi replicate inside the host cell; thus, it is difficult to conduct a knockout experiment without going through other developmental stages. Recently, our group reported a growth condition in which the amastigote can replicate axenically for up to 10 days without losing its amastigote-like properties. By using this temporal axenic amastigote culture, we successfully introduced gRNAs directly into the Cas9-expressing amastigote to cause gene knockouts and analyzed their phenotypes exclusively in the amastigote stage. In this report, we describe a detailed protocol to produce in vitro derived extracellular amastigotes, and to utilize the axenic culture in a CRISPR/Cas9-mediated knockout experiment. The growth phenotype of knockout amastigotes can be evaluated either by cell counts of the axenic culture, or by replication of intracellular amastigote after host cell invasion. This method bypasses the parasite stage differentiation normally involved in producing a transgenic or a knockout amastigote. Utilization of the temporal axenic amastigote culture has the potential to expand the experimental freedom of stage-specific studies in T. cruzi.

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Here, we describe a protocol to introduce a gene knockout into the extracellular amastigote of Trypanosoma cruzi, using the CRISPR/Cas9 system. The growth phenotype can be followed up either by cell counting of axenic amastigote culture or by proliferation of intracellular amastigotes after host cell invasion.

CRISPR/Cas9 sistemi kullanılarak Trypanosoma cruzi 'Nin Amastigote aşamasına doğrudan bir gene Knockout tanıtımı

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target ...

CRISPR-Cas9-Mediated Genome Editing in the Filamentous Ascomycete Huntiella omanensis

The CRISPR-Cas9 genome editing system is a molecular tool that can be used to introduce precise changes into the genomes of model and non-model species alike. This technology can be used for a variety of genome editing approaches, from gene knockouts and knockins to more specific changes like the introduction of a few nucleotides at a targeted location. Genome editing can be used for a multitude of applications, including the partial functional characterization of genes, the production of transgenic organisms and the development of diagnostic tools. Compared to previously available gene editing strategies, the CRISPR-Cas9 system has been shown to be easy to establish in new species and boasts high efficiency and specificity. The primary reason for this is that the editing tool uses an RNA molecule to target the gene or sequence of interest, making target molecule design straightforward, given that standard base pairing rules can be exploited. Similar to other genome editing systems, CRISPR-Cas9-based methods also require efficient and effective transformation protocols as well as access to good quality sequence data for the design of the targeting RNA and DNA molecules. Since the introduction of this system in 2013, it has been used to genetically engineer a variety of model species, including Saccharomyces cerevisiae, Arabidopsis thaliana, Drosophila melanogaster and Mus musculus. Subsequently, researchers working on non-model species have taken advantage of the system and used it for the study of genes involved in processes as diverse as secondary metabolism in fungi, nematode growth and disease resistance in plants, among many others. This protocol detailed below describes the use of the CRISPR-Cas9 genome editing protocol for the truncation of a gene involved in the sexual cycle of Huntiella omanensis, a filamentous ascomycete fungus belonging to the Ceratocystidaceae family.

CRISPR-Cas9-Mediated Genome Editing in the Filamentous Ascomycete Huntiella omanensis

The CRISPR-Cas9 genome editing system is an easy-to-use genome editor that has been used in model and non-model species. Here we present a protein-based version of this system that was used to introduce a premature stop codon into a mating gene of a non-model filamentous ascomycete fungus.

Filamentöz Ascomycete Huntiella omanensis'te CRISPR-Cas9 Aracılı Genom Düzenleme

The CRISPR-Cas9 genome editing system is a molecular tool that can be used to introduce precise changes into the genomes of model and non-model species ...