Name: preparation and gene modification of nonhuman primate hematopoietic stem and progenitor cells
Uploaded: 2019-02-15T14:00:00
Description: Watch this Scientific Journal Video about Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells at JoVE.com

The authors thank Helen Crawford for preparing this manuscript, Jim Woolace for graphic design, and Veronica Nelson and Devikha Chandrasekaran for participating in the development of the protocol. The development of this protocol was supported by grants from the NIH National Institute of Allergy and Infectious Diseases (R01 AI135953 and AI138329 to H.P.K.) and the National Heart, Lung, and Blood Institute (R01 HL136135, HL116217, P01 HL122173, and U19 HL129902 to H.P.K.), as well as NIH P51 OD010425 and, in part through the NIH/NCI Cancer Center, Support Grant P30 CA015704. H.P.K. is a Markey Molecular Medicine Investigator and received support as the inaugural recipient of the Jos&#233; Carreras/E. Donnall Thomas Endowed Chair for Cancer Research and the Fred Hutch Endowed Chair for Cell and Gene Therapy.

Autologous NHP transplants, priming (mobilization), the collection of cells, and gene modification are conducted consistent with previously published protocols26. All experimental procedures are reviewed and approved by the Institutional Animal Care and Use Committee of the Fred Hutchinson Cancer Research Center and the University of Washington (Protocol #3235-01). All studies are carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of t...

LV vector engineering is the best-characterized method to gene-modify cell types such as CD34+ HSPCs, for subsequent transplantation in vivo. The protocol described here is designed to maximize the number of gene-modified HSPCs that persist long-term in vivo, and provide clinical benefits to patients with various malignant, infectious, and genetic diseases. Although gene-editing strategies have emerged over the last decade, LV-modified cells are the best studied in vitro, in animal models, and in patients<sup ...

Stem cell gene therapy is a powerful means to address a wide range of human pathologies. HSPC gene therapy is a particularly attractive approach, due to i) the relative ease of collecting these cells from patients, ii) the wealth of knowledge that is available regarding cell surface phenotypes and ex vivo culture parameters, and, as the field expands, because iii) it presents scientists with an ever-increasing toolbox of gene modification strategies tailored to various diseases of interest. We are actively investigating HSPC gene therapy approaches from multiple angles, including the basic science of HSPC biology, the engraftment of gene-modified HSPCs in preclinical in vivo models, and the application to relevant patient populations. We and others have characterized the cell surface phenotype of functionally distinct HSPC subsets1,2,3, the mobilization and conditioning regimens that maximize HSPC yield and engraftment while minimizing toxicity4,5, and the gene modification and gene-editing strategies that have been tailored to a wide range of malignant, genetic, and infectious diseases6,7,8,9,10. The function and engraftment of gene-modified HSPCs can be evaluated in a number of small- and large-animal models, including mice, dogs, and NHPs. In particular, NHP models are advantageous because many reagents, for example, antibodies specific for HSPC cell surface proteins like CD34 and CD90, can be used interchangeably in human and NHP cells. Furthermore, in contrast to mice, large animals such as NHPs allow a closer approximation of the scale of gene modification necessary for clinical efficacy. Finally, NHPs are the gold standard for the modeling of human pathologies such as HIV-1 infection11 and are an emerging model system for candidate anticancer and anti-HIV immunotherapies12,13.
The purpose of this protocol is to outline methods for purifying, genetically modifying, and preparing NHP HSPC infusion products. Although outside the scope of this protocol, we have previously shown that these products engraft in autologous NHP hosts, give rise to all hematopoietic lineages, and provide therapeutic efficacy in a broad range of disease models1. We have also characterized the clonality of engrafting HSPCs and built a platform to track the kinetics, trafficking, and phenotype of individual HSPCs and their progeny, following autologous transplantation1,14. The methods presented here have been developed with the following goals: i) to isolate highly pure HSPCs and long-term engrafting HSC subsets, ii) to maintain primitive HSCs during ex vivo culture, and iii) to efficiently gene-modify either bulk HSPCs or long-term engrafting HSC subsets. We employ magnetic-assisted cell-sorting (MACS), as well as fluorescence-activated cell sorting (FACS), to isolate phenotypically/functionally distinct HSPC populations, consistent with the methods of many groups2,15,16. The maintenance of primitive HSCs in culture (i.e., minimizing the differentiation of these cells into committed progenitors that give rise to fully differentiated lymphoid and myeloid subsets) is an essential facet of the protocol described here. Although we have previously characterized approaches to expand HSPCs while retaining a primitive phenotype17,18, here, we describe a protocol that focuses on maintaining HSCs via a minimal (48 h) and defined ex vivo culture.
The efficient modification of HSPCs and HSC subsets is a central goal of this protocol. Among several approaches we have reported, two are by far the most investigated in clinical trials: LV-mediated gene modification and nuclease-mediated gene editing1,6,19.&#160;Gene-editing strategies use one of a number of nuclease platforms to specifically modify a targeted gene of interest, for example, C-C chemokine receptor type 5 (CCR5) for the treatment of HIV infection7,19 or Bcl11A for the treatment of hemoglobinopathies6. Here, we focus on LV-mediated gene modification, in which transgenic cargoes integrate semirandomly into the genome1,8,20. A key advantage of LV approaches is the ability to deliver large amounts of genetic material (up to 8 or 9 kilobases). Although gene-editing strategies are being developed to target a transgene of interest to integrate only at a specified locus by homologous donor recombination (HDR), these methods require further development in vitro and in small animal models. In contrast, LV vectors have been used extensively in NHPs and in patients21,22. Importantly, the protocol described here, which uses primed BM as a starting HSPC source, can be easily and broadly adapted, for example, to isolate PBSCs. As described above, we take advantage of the high degree of genetic similarity between NHPs and humans to use reagents that are applicable to both species. Finally, this approach has been adapted to modify other hematopoietic subsets, namely T cells12,23,24; the advent of efficacious T-cell immunotherapy approaches has relied heavily on the same LV platform utilized in this protocol. These methods are appropriate for any researcher interested in either HSPC biology or LV-mediated gene modification. For example, the HSPC purification protocol presented here could be used to characterize novel HSC-enriched subsets, as described previously1,15,25. Likewise, the LV transduction methods presented here could similarly be applied and further developed for numerous other cell types and experimental questions, both in in vitro and in vivo models.
In summary, we present methods to isolate and genetically modify NHP HSPCs. These methods can be easily adapted for other species and other sources of HSPCs. This thoroughly vetted protocol shows great promise in the modeling of efficacious therapies for numerous human diseases.

<table>
	<tbody>
		<tr>
			<td>Stemspam SFEM II (&#34;HSPC&#34;) Media</td>
			<td>StemCell</td>
			<td>09655</td>
			<td></td>
		</tr>
		<tr>
			<td>Hank&#39;s Balanced Salt Solution</td>
			<td>Gibco</td>
			<td>14175095</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate-Buffered Saline</td>
			<td>Gibco</td>
			<td>14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin/Streptomycin</td>
			<td>Gibco</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>Dimethyl Sulfoxide</td>
			<td>Sigma Aldrich</td>
			<td>D2650-100</td>
			<td></td>
		</tr>
		<tr>
			<td>100% Ethanol</td>
			<td>Decon labs</td>
			<td>M18027161M</td>
			<td></td>
		</tr>
		<tr>
			<td>Cyclosporine</td>
			<td>Sigma</td>
			<td>30024-25MG</td>
			<td></td>
		</tr>
		<tr>
			<td>500 mM EDTA</td>
			<td>Invitrogen</td>
			<td>15575-038</td>
			<td></td>
		</tr>
		<tr>
			<td>Heat-Inactivated Fetal Bovine Serum</td>
			<td>Sigma Aldrich</td>
			<td>PS-0500-A</td>
			<td></td>
		</tr>
		<tr>
			<td>CH-296/ RetroNectin (2.5 mL, 1 &#181;g/&#181;L)</td>
			<td>TaKaRA</td>
			<td>T100B</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin</td>
			<td>Sigma</td>
			<td>A7906-100g</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Sigma</td>
			<td>H9897</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat anti-mouse IgM magnetic beads</td>
			<td>Miltenyi Biotec</td>
			<td>130-047-301</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant HumanStem Cell Factor (SCF)</td>
			<td>Peprotech</td>
			<td>300-07</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant Human Thrombopoietin (TPO)</td>
			<td>Peprotech</td>
			<td>300-18</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant Human FMS-like tyrosine kinase 3 (FLT-3)</td>
			<td>Peprotech</td>
			<td>300-19</td>
			<td></td>
		</tr>
		<tr>
			<td>Protamine sulfate</td>
			<td>Sigma</td>
			<td>P-4505</td>
			<td></td>
		</tr>
		<tr>
			<td>14 mL Polypropylene Round-Bottom Tube</td>
			<td>Corning</td>
			<td>352059</td>
			<td></td>
		</tr>
		<tr>
			<td>Colony Gel 1402</td>
			<td>ReachBio</td>
			<td>1402</td>
			<td></td>
		</tr>
		<tr>
			<td>QuadroMACS Separators</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-976</td>
			<td></td>
		</tr>
		<tr>
			<td>MACS L25 Columns</td>
			<td>Miltenyi biotec</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mM PGE2</td>
			<td>Cayman Chemical</td>
			<td>14753-5mg</td>
			<td></td>
		</tr>
		<tr>
			<td>TC-treated T-75 flasks</td>
			<td>Bioexpress</td>
			<td>T-3001-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Non-TC-treated T-75 flasks</td>
			<td>Thermo-Fisher</td>
			<td>13680-57</td>
			<td></td>
		</tr>
		<tr>
			<td>20 ml syringes</td>
			<td>BD Biosciences</td>
			<td>302830</td>
			<td></td>
		</tr>
		<tr>
			<td>16.5 G needles</td>
			<td>BD Precision</td>
			<td>305198</td>
			<td></td>
		</tr>
		<tr>
			<td>Syringe Tip Cap</td>
			<td>BD Biosciences</td>
			<td>305819</td>
			<td></td>
		</tr>
		<tr>
			<td>QuickExtract DNA Solution</td>
			<td>Epicentre</td>
			<td>QE09050</td>
			<td></td>
		</tr>
		<tr>
			<td>8-tube strip cap PCR Tubes</td>
			<td>USA scientific</td>
			<td>1402-2708</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well Thermocycler</td>
			<td>Thermo-Fisher</td>
			<td>4375786</td>
			<td></td>
		</tr>
		<tr>
			<td>Pre-Separation filters</td>
			<td>Miltenyi Biotec</td>
			<td>130-041-407</td>
			<td></td>
		</tr>
		<tr>
			<td>Strainer, Cell; BD Falcon; Sterile; Nylon mesh; Mesh size: 70um; Color: white; 50/CS</td>
			<td>fisher scientific</td>
			<td>352350</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultracomp ebeads</td>
			<td>eBioscience</td>
			<td>01-2222-42</td>
			<td></td>
		</tr>
		<tr>
			<td>MACSmix Tube Rotator</td>
			<td>Miltenyi</td>
			<td>130-090-753</td>
			<td></td>
		</tr>
		<tr>
			<td>3 mL Luer-Lock Syringes</td>
			<td>Thermo-Fisher</td>
			<td>14823435</td>
			<td></td>
		</tr>
		<tr>
			<td>35 mm x 10 mm cell culture dish</td>
			<td>Corning</td>
			<td>430165</td>
			<td></td>
		</tr>
		<tr>
			<td>60 mm x 15 mm cell culture dish</td>
			<td>Corning</td>
			<td>430196</td>
			<td></td>
		</tr>
		<tr>
			<td>150 mm x 25 mm cell culture dish</td>
			<td>Corning</td>
			<td>430599</td>
			<td></td>
		</tr>
		<tr>
			<td>Non TC treated flasks</td>
			<td>Falcon</td>
			<td>353133</td>
			<td></td>
		</tr>
		<tr>
			<td>Qiagen DNA extraction</td>
			<td>Qiagen</td>
			<td>51104</td>
			<td></td>
		</tr>
		<tr>
			<td>PE Anti-Human CD90 (Thy1) Clone:5E10</td>
			<td>Biolegend</td>
			<td>328110</td>
			<td></td>
		</tr>
		<tr>
			<td>PE-CF594 Mouse Anti-Human CD34 Clone:563</td>
			<td>BD horizon</td>
			<td>562449</td>
			<td></td>
		</tr>
		<tr>
			<td>APC-H7 Mouse Anti-Human CD45RA Clone: 5H9</td>
			<td>BD Pharmingen</td>
			<td>561212</td>
			<td></td>
		</tr>
		<tr>
			<td>V450 Mouse Anti-NHP CD45 Clone:d058-1283</td>
			<td>BD Biosciences</td>
			<td>561291</td>
			<td></td>
		</tr>
		<tr>
			<td>Autologous Serum</td>
			<td>Collected from autologous host and cryopreserved prior to mobilization and collection of CD34+ HSPCs</td>
			<td>N/A</td>
			<td>Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010).</td>
		</tr>
		<tr>
			<td>Virus-Conditioned Media (VCM)</td>
			<td>Kiem Lab, FHCRC Co-operative Center for Excellence in Hematology (CCEH)</td>
			<td>N/A</td>
			<td>Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010).</td>
		</tr>
		<tr>
			<td>Anti-CD34 antibody, Clone 12.8</td>
			<td>Kiem Lab</td>
			<td>N/A</td>
			<td>Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010).</td>
		</tr>
		<tr>
			<td>Lenti F primer: AGAGATGGGTGCGAGAGCGTCA</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td>Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).</td>
		</tr>
		<tr>
			<td>Lenti R primer: TGCCTTGGTGGGTGCTACTCCTAA</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td>Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).</td>
		</tr>
		<tr>
			<td>Actin F primer: TCCTGTGGCACTCACGAAACT</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td>Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).</td>
		</tr>
		<tr>
			<td>Actin R primer: GAAGCATTTGCGGTGGACGAT</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td>Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).</td>
		</tr>
	</tbody>
</table>

preparation and gene modification of nonhuman primate hematopoietic stem and progenitor cells

Hematopoietic stem and progenitor cell (HSPC) transplantation has been a cornerstone therapy for leukemia and other cancers for nearly half a century, underlies the only known cure of human immunodeficiency virus (HIV-1) infection, and shows immense promise in the treatment of genetic diseases such as beta thalassemia. Our group has developed a protocol to model HSPC gene therapy in nonhuman primates (NHPs), allowing scientists to optimize many of the same reagents and techniques that are applied in the clinic. Here, we describe methods for purifying CD34+ HSPCs and long-term persisting hematopoietic stem cell (HSC) subsets from primed bone marrow (BM). Identical techniques can be employed for the purification of other HSPC sources (e.g., mobilized peripheral blood stem cells [PBSCs]). Outlined is a 2 day protocol in which cells are purified, cultured, modified with lentivirus (LV), and prepared for infusion back into the autologous host. Key readouts of success include the purity of the CD34+ HSPC population, the ability of purified HSPCs to form morphologically distinct colonies in semisolid media, and, most importantly, gene modification efficiency. The key advantage to HSPC gene therapy is the ability to provide a source of long-lived cells that give rise to all hematopoietic cell types. As such, these methods have been used to model therapies for cancer, genetic diseases, and infectious diseases. In each case, therapeutic efficacy is established by enhancing the function of distinct HSPC progeny, including red blood cells, T cells, B cells, and/or myeloid subsets. The methods to isolate, modify, and prepare HSPC products are directly applicable and translatable to multiple diseases in human patients.

The protocol described above is designed to isolate and gene-modify NHP CD34+ HSPCs, which can subsequently be infused back into the autologous host (Figure 1 and Figure 2). When following this protocol, we usually obtain up to 8 x 109 total WBCs from primed BM from pigtail macaques and, sometimes, double that amount from rhesus macaques. In both species, the number of CD34+ HSPCs that we enrich i...

Watch this Scientific Journal Video about Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells at JoVE.com

Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells

The goal of this protocol is to isolate nonhuman primate CD34+ cells from primed bone marrow, to gene-modify these cells with lentiviral vectors, and to prepare a product for infusion into the autologous host. The total protocol length is approximately 48 h.

Hematopoietic stem and progenitor cell (HSPC) transplantation has been a cornerstone therapy for leukemia and other cancers for nearly half a century, ...

Research

JoVE Journal

Genetics

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Sample Preparation and Analysis of RNASeq-based Gene Expression Data from Zebrafish

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of ...

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

A Combinatorial Single-cell Approach to Characterize the Molecular and Immunophenotypic Heterogeneity of Human Stem and Progenitor Populations

Immunophenotypic characterization and molecular analysis have long been used to delineate heterogeneity and define distinct cell populations. FACS is ...

Isolation, Characterization and MicroRNA-based Genetic Modification of Human Dental Follicle Stem Cells

To date, several stem cell types at different developmental stages are in the focus for the treatment of degenerative diseases. Yet, certain aspects, such ...