Name: inducing and characterizing vesicular steatosis in differentiated heparg cells
Uploaded: 2019-07-18T13:30:00
Description: Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

We thank prof. Christian Trepo (INSERM U871, Lyon, France), who kindly provided HepaRG cells. We are grateful to Rita Appodia for administrative help. This work was supported by MIUR- Ministero dell&#8217;istruzione, dell&#39;universita&#768; e della ricerca (FIRB 2011&#8211;2016 RBAP10XKNC) and Sapienza University of Rome (prot. C26A13T8PS; prot. C26A142MCH; prot. C26A15LSXL).

1. Preparation of Culture Media and Reagents
<ol>
	<li>Proliferating medium: supplement William&#39;s E medium with GlutaMAX, 10% fetal bovine serum (FBS), 1% penicillin/streptomycin, 5 &#956;g/mL insulin and 0.5 &#956;M hydrocortisone hemisuccinate.</li>
	<li>Differentiation medium: supplement William&#39;s E medium with GlutaMAX, 10% FBS, 1% penicillin/streptomycin, 5 &#956;g/mL insulin, 50 &#956;M hydrocortisone hemisuccinate and 2% DMSO.</li>
	<li>Freezing medium: supplement proliferating medium with 10% DMSO.</li>...

<ol>
	<li>Starley, B. Q., Calcagno, C. J., Harrison, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonalcoholic+fatty+liver+disease+and+hepatocellular+carcinoma:+a+weighty+connection.">Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection.</a> Hepatology. 51 (5), 1820-1832 (2010).</li><li>Byrne, C. D., Targher, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NAFLD:+a+multisystem+disease.">NAFLD: a multisystem disease.</a> Journal of Hepatology. 62 (1), 47-64 (2015).</li><li>Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+basis+and+mechanisms+of+progression+of+non-+alcoholic+steatohepatitis.">Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis.</a> Trends in Molecular Medicine. 14, 72-81 (2008).</li><li>Chalasani, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diagnosis+and+management+of+nonalcoholic+fatty+liver+disease:+Practice+guidance+from+the+American+Association+for+the+Study+of+Liver+Diseases.">The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases.</a> Hepatology. 67 (1), 328-357 (2018).</li><li>Banini, B. A., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+future+pharmacologic+treatment+of+nonalcoholic+steatohepatitis.">Current and future pharmacologic treatment of nonalcoholic steatohepatitis.</a> Current Opinion in Gastroenterology. 33 (3), 134-141 (2017).</li><li>Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+pharmacological+therapies+for+nonalcoholic+fatty+liver+disease/nonalcoholic+steatohepatitis.">Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis.</a> World Journal of Gastroenterology. 21 (13), 3777-3785 (2015).</li><li>Younossi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+burden+of+NAFLD+and+NASH:+trends,+predictions,+risk+factors+and+prevention.">Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention.</a> Nature Reviews Gastroenterology &amp; Hepatology. 15 (1), 11-20 (2018).</li><li>Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preclinical+models+of+non-alcoholic+fatty+liver+disease.">Preclinical models of non-alcoholic fatty liver disease.</a> Journal of Hepatology. 68 (2), 230-237 (2018).</li><li>Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+mouse+models+for+the+study+of+nonalcoholic+fatty+liver+disease.">Genetically modified mouse models for the study of nonalcoholic fatty liver disease.</a> World Journal of. Gastroenterology. 18 (11), 1141-1153 (2012).</li><li>Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+scientific+discovery:+the+need+for+preclinical+models+of+nonalcoholic+steatohepatitis.">Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis.</a> Hepatology International. 12 (1), 6-16 (2018).</li><li>Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+human+hepatic+cell+lines+for+in+vitro+testing+and+research+purposes.">Immortalized human hepatic cell lines for in vitro testing and research purposes.</a> Methods in Molecular Biology. 1250, 53-76 (2015).</li><li>G&#243;mez-Lech&#243;n, M. J., Donato, M. T., Castell, J. V., Jover, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatocytes+in+primary+culture:+the+choice+to+investigate+drug+metabolism+in+man.">Human hepatocytes in primary culture: the choice to investigate drug metabolism in man.</a> Current Drug Metabolism. 5 (5), 443-462 (2004).</li><li>Marion, M. J., Hantz, O., Durantel, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+HepaRG+cell+line:+biological+properties+and+relevance+as+a+tool+for+cell+biology,+drug+metabolism,+and+virology+studies.">The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies.</a> Methods in Molecular Biology. 640, 261-272 (2010).</li><li>Gripon, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+a+human+hepatoma+cell+line+by+hepatitis+B+virus.">Infection of a human hepatoma cell line by hepatitis B virus.</a> Proceedings of the National Academy of Sciences. 99 (24), 15655-15660 (2002).</li><li>Anth&#233;rieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+vesicular+steatosis+by+amiodarone+and+tetracycline+is+associated+with+up-regulation+of+lipogenic+genes+in+HepaRG+cells.">Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells.</a> Hepatology. 53 (6), 1895-1905 (2011).</li><li>Rouge, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PPAR+agonists+reduce+steatosis+in+oleic+acid-overloaded+HepaRG+cells.">PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells.</a> Toxicology and Applied Pharmacology. 276 (1), 73-81 (2014).</li><li>Belloni, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+a+phospho-STAT3-miRNAs+pathway+improves+vesicular+hepatic+steatosis+in+an+in+vitro+and+in+vivo+model.">Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model.</a> Scientific Reports. 8, 13638 (2018).</li><li>Nunn, A. D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+histone+deacetylase+inhibiting+drug+Entinostat+induces+lipid+accumulation+in+differentiated+HepaRG+cells.">The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells.</a> Scientific Reports. 6, 28025 (2016).</li><li>Donato, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytometric+analysis+for+drug-induced+steatosis+in+HepG2+cells.">Cytometric analysis for drug-induced steatosis in HepG2 cells.</a> Chemico-Biological Interactions. 181 (3), 417-423 (2009).</li><li>Hellerer, T., Ax&#228;ng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+of+lipid+storage+in+Caenorhabditis+elegans+using+coherent+anti-Stokes+Raman+scattering+(CARS)+microscopy.">Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy.</a> Proceedings of the National Academy of Sciences. 104 (37), 14658-14663 (2007).</li><li>Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+evaluation+of+hepatic+microvesicular+steatosis+with+multimodal+coherent+anti-Stokes+Raman+scattering+microscopy.">Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy.</a> PLoS One. 7 (11), 51092 (2012).</li><li>Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+hepatoma+HepaRG+cells:+a+highly+differentiated+model+for+studies+of+liver+metabolism+and+toxicity+of+xenobiotics.">The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics.</a> Chemico-Biological Interactions. 168 (1), 66-73 (2007).</li><li>Nelson, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatic+HepaRG+cells+maintain+an+organotypic+phenotype+with+high+intrinsic+CYP450+Activity/metabolism+and+significantly+outperform+standard+HepG2/C3A+cells+for+pharmaceutical+and+therapeutic+applications.">Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications.</a> Basic &amp; Clinical Pharmacology &amp; Toxicology. 120 (1), 30-37 (2017).</li><li>Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+human+hepatocytes,+HepG2+cells,+and+HepaRG+cells+at+the+mRNA+level+and+CYP+activity+in+response+to+inducers+and+their+predictivity+for+the+detection+of+human+hepatotoxins.">Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins.</a> Cell Biology and Toxicology. 28 (2), 69-87 (2012).</li><li>Pusl, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+sensitize+hepatocytes+to+bile+acid-induced+apoptosis.">Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis.</a> Biochemical and Biophysical Research Communications. 371 (3), 441-445 (2008).</li><li>Gentile, C. L., Pagliassotti, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+fatty+acids+in+the+development+and+progression+of+nonalcoholic+fatty+liver+disease.">The role of fatty acids in the development and progression of nonalcoholic fatty liver disease.</a> The Journal of Nutritional Biochemistry. 19 (9), 567-576 (2008).</li><li>Mei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+roles+of+unsaturated+and+saturated+fatty+acids+on+autophagy+and+apoptosis+in+hepatocytes.">Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes.</a> Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).</li><li>Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+induce+JNK-dependent+hepatocyte+lipoapoptosis.">Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis.</a> Journal of Biological Chemistry. 281, 12093-12101 (2006).</li><li>Moravcov&#225;, A., &#268;ervinkov&#225;, Z., Ku&#269;era, O., Mezera, V., Rychtrmoc, D., Lotkov&#225;, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+oleic+and+palmitic+acid+on+induction+of+steatosis+and+cytotoxicity+on+rat+hepatocytes+in+primary+culture.">The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture.</a> Physiological Research. 64, 627-636 (2015).</li><li>Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pitfall+in+using+BODIPY+dyes+to+label+lipid+droplets+for+fluorescence+microscopy.">A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy.</a> Histochemistry and Cell Biology. 133 (4), 477-480 (2010).</li><li>Rinia, H. A., Burger, K. N., Bonn, M., M&#252;ller, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+label-free+imaging+of+lipid+composition+and+packing+of+individual+cellular+lipid+droplets+using+multiplex+CARS+microscopy.">Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy.</a> Biophysical Journal. 95 (10), 4908-4914 (2008).</li><li>Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+in+situ+imaging+of+oil+body+dynamics+and+chemistry+in+germination.">Label-free in situ imaging of oil body dynamics and chemistry in germination.</a> Journal of The Royal Society Interface. 13 (123), (2016).</li><li>J&#252;ngst, C., Winterhalder, M. J., Zumbusch, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+long+term+lipid+droplet+tracking+with+CARS+microscopy.">Fast and long term lipid droplet tracking with CARS microscopy.</a> Journal of Biophotonics. 4 (6), 435-441 (2011).</li><li>Welte, M. A., Gould, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplet+functions+beyond+energy+storage.">Lipid droplet functions beyond energy storage.</a> Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862 (10), 1260-1272 (2017).</li><li>Cohen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+as+organelles.">Lipid droplets as organelles.</a> International Review of Cell and Molecular Biology. 337, 83-110 (2018).</li><li>Farese, R. V., Walther, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+finally+get+a+little+R-E-S-P-E-C-T.">Lipid droplets finally get a little R-E-S-P-E-C-T.</a> Cell. 139 (5), 855-860 (2009).</li></ol>

This protocol describes how to differentiate HepaRG cells and how to induce vesicular steatosis by sodium oleate treatment (Figure 1A). Indeed, compared to other human hepatocellular carcinoma (HCC) cell lines, the HepaRG cell line exhibits features of adult human hepatocytes, representing a valuable alternative to ex vivo cultivated primary human hepatocytes13,14,15. The HepaRG cel...

Hepatic steatosis is defined as intrahepatic fat accumulation, within triglyceride-containing lipid droplets, of at least 5% of liver weight. Prolonged hepatic lipid storage is a potentially reversible process, however, it can lead to liver metabolic dysfunction, inflammation and advanced forms of nonalcoholic fatty liver disease (NAFLD), the predominant cause of chronic liver disease in many parts of the world1,2. NAFLD is a multifactorial disease that may evolve to the more aggressive non-alcoholic steatohepatitis (NASH), which in turn can progress to cirrhosis and, in a small percentage of patients, to hepatocellular carcinoma (HCC)1,3. No approved therapy is currently available as a specific treatment for NAFLD and the combination of diet and lifestyle modifications remains the pillar of NAFLD and NASH management4,5,6.
The molecu&#173;lar mechanisms leading to the development of hepatic steatosis in the pathogenesis of NAFLD still remain to be elucidated7. In this context, mouse models have been developed to study human steatosis disease progression. A myriad of different models exists, and each one has its advantages and disadvantages, including genetic, nutritional and chemically induced models combining different approaches. Genetically modified (transgenic or knockout) mice spontaneously develop liver disease. However, it should be noted that these mutations are very rare in humans and deletion or over-expression of a single gene (e.g., ob/ob mouse) may not mimic the etiology of the multifactorial human disease at the molecular level8,9. Likewise, the disease acquired by mice after dietary or pharmacological manipulation may not mimic the effects of human diets associated with development of NAFLD in man8. Animal models have, however, facilitated developments in the understanding of NAFLD and this approach is currently the most frequently used strategy in laboratory research. Nevertheless, the replication in humans of results obtained in animal models has repeatedly failed, causing poor translation into the clinic10.
Therefore, in vitro models of NAFLD may play a fundamental role in elucidating the molecular mechanisms of NAFLD progression, and they represent a valuable tool to screen a large number of compounds. Primary cell cultures, immortalized cell lines and liver biopsies have been extensively used for research purposes11. Primary human hepatocytes closely resemble human clinical conditions, but there is a limited number of donors, and primary cell cultures show poor reproducibility due to the variability of the cells. These observations, together with ethical and logistic issues, have resulted in the use of human primary hepatocytes being limited12. Thus, hepatic cell lines represent a convenient alternative, having several essential advantages over primary culture, as hepatic cell lines grow steadily, have an almost unlimited life-span, and have a stable phenotype. Moreover, cell lines are easily accessible and the culture conditions of hepatic cell lines are simpler than those of primary hepatocytes and are standardized among different laboratories.
Here, we describe in detail an in vitro cell-based model of liver vesicular steatosis, represented by hepatic differentiated HepaRG cells treated with the fatty acid sodium oleate. The HepaRG cell line was established from a female patient affected by hepatitis C infection and an Edmondson grade I well-differentiated liver tumor14. The HepaRG cell line is a human bipotent progenitor cell line capable of differentiating upon exposure to 2% dimethyl sulfoxide (DMSO) toward two different cell phenotypes: biliary-like and hepatocyte-like cells. Differentiated HepaRG cells (dHepaRG) share some features and properties with adult hepatocytes and possess the ability to stably express liver-specific genes such as Albumin, AldolaseB, Cytochrome P450 2E1 (CYP2E1), and Cytochrome P450 3A4 (CYP3A4)13 (step 3). Treatment of dHepaRG cells with the fatty acid salt sodium oleate (250 &#956;M) for 5 days lead to the generation of cytoplasmic lipid droplets, mimicking the effects of fatty liver14,15,17,18 (step 4). Accumulation of lipid droplets can be easily detected by Oil Red O staining (step 5), a lysochrome fat-soluble dye that stains neutral triglycerides and lipids red-orange. To efficiently quantify lipids in fatty dHepaRG, here we illustrate cytofluorimetric analysis after staining with 4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene (Bodipy 505/515) (step 6), a lipophilic fluorescent probe that localizes to intracellular lipid bodies and has been used to label lipid droplets19. Moreover, here we show how to evaluate steatosis by quantitative polymerase chain reaction (qPCR) (step 7) gene expression deregulation of several metabolic genes in dHepaRG cells. To further characterize and quantify the accumulation of lipid droplets after sodium oleate treatment, we performed coherent anti-Stokes Raman scattering (CARS) microscopy (step 8), an innovative technique that enables the visualization and quantification of lipid droplets without labeling20,21.

<table border="0" cellpadding="0" cellspacing="0" style="width:799px;" width="797">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Hyclone HyClone Fetal Clone II&#160;</td>
			<td style="width:240px;">GE Healthcare</td>
			<td style="width:143px;">SH30066</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">William&#8217;s E medium with GlutaMAX&#160;</td>
			<td style="width:240px;">Thermofisher</td>
			<td>32551087</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/streptomycin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>P4333</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Insulin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>I9278</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">hydrocortisone hemisuccinate</td>
			<td style="width:240px;">SIGMA</td>
			<td>H2270</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">DMSO, dimethyl sulfoxide</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">D2438&#160;&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Sodium Oleate</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O7501&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Methanol</td>
			<td style="width:240px;">SIGMA</td>
			<td>179337</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Isopropanol</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">278475</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BODIPY 505/515</td>
			<td>Thermofisher</td>
			<td>D3921</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">PBS</td>
			<td style="width:240px;">Thermofisher</td>
			<td>14190-250</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution</td>
			<td style="width:240px;">SIGMA</td>
			<td>252549</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">RNAse free DNAseI</td>
			<td style="width:240px;">Promega</td>
			<td>M198A&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glass-bottomed dishes</td>
			<td style="width:240px;">Willco Wells</td>
			<td style="width:143px;">GWST-5040</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Oil Red solution</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O625</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">CellTiter 96 AQueous One Solution</td>
			<td style="width:240px;">Promega&#160;</td>
			<td style="width:143px;">G3582</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">q-PCR oligo name</td>
			<td>Sequence</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ACACB FOR</td>
			<td>CAAGCCGATCACCAAGAGTAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">ACACB REV</td>
			<td>CCCTGAGTTATCAGAGGCTGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin FOR</td>
			<td style="width:240px;">GCACTCTTCCAGCCTTCCT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin REV</td>
			<td style="width:240px;">AGGTCTTTGCGGATGTCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN FOR</td>
			<td>TGCTTGAATGTGCTGATGACAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN REV</td>
			<td>AAGGCAAGTCAGCAGGCATCTCATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB FOR</td>
			<td>GCATCTGTCAGCAGAATGGA&#160;</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB REV</td>
			<td>TAGACAGCAGCCAGGACCTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB FOR</td>
			<td>CCTCCGTTTTGGTGGTAGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB REV</td>
			<td>&#160;CCTAAAAGCTGGGAAGCTGA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 FOR</td>
			<td>CTCAGCTTCATGCAGGGTTA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 REV</td>
			<td>GGTGCTCCAGTAGTCTTTCAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A FOR</td>
			<td>TCATCAAGAAATGTCGCACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A REV</td>
			<td>GCCTCGTATGTGAGGCAAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 FOR</td>
			<td>TTGAAGCCTCTCGTTGACCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 REV</td>
			<td>CGTGGTGGGATACAGCCAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 FOR</td>
			<td>CTTCATCCAATGGACTGCATAAAT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 REV</td>
			<td>TCCCAAGTATAACACTCTACACAGACAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH FOR</td>
			<td>TGACAACTTTGGTATCGTGGAAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH REV</td>
			<td>AGGGATGATGTTCTGGAGAGCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM FOR</td>
			<td>TCTTTGGGTTTGCGGAATGTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM REV</td>
			<td>ATGCACATCTCGCTCTTGAATAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 FOR</td>
			<td>CCTGAACCTTCCAAAGATGGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 REV</td>
			<td>ACCTCAAACTCCAAAAGACCAGTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 FOR</td>
			<td>ACAGACAGGAAACCCAAGCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 REV</td>
			<td>TGGAGGTGAGAAGGAACATACACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 FOR</td>
			<td>TTGCAGTTGCCAATACCTATGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 REV</td>
			<td>CCAGTCACAGTAGTCGTCACA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 FOR</td>
			<td>AATGAGTTGGAGGGGCTGGGGGACATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 REV</td>
			<td>GGTCACCTAAACGAACGAAGTAGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD FOR</td>
			<td>TCTAGCTCCTATACCACCACCA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD REV</td>
			<td>TCGTCTCCAACTTATCTCCTCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 FOR</td>
			<td>TGCTCATCAACCGCAACGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 REV</td>
			<td>CCGACTCTCTTCCTTCATCTCCTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S FOR</td>
			<td>CGCCGCTAGAGGTGAAATTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S REV</td>
			<td>TTGGCAAATGCTTTCGCTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

inducing and characterizing vesicular steatosis in differentiated heparg cells

Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive fat accumulation leads to non-alcoholic fatty liver disease (NAFLD), &#160;which is potentially reversible and may evolve into non-alcoholic steatohepatitis (NASH) and eventually cirrhosis and hepatocellular carcinoma (HCC). The molecular mechanisms linking lipid accumulation in hepatocytes with the progression to NASH, irreversible liver damage, fibrosis, cirrhosis, and even HCC still remains unclear. To this end, several in vitro and in vivo models have been developed to elucidate the pathological processes that cause NAFLD. In the present study, we describe a cellular model for the induction of liver vesicular steatosis that consists of DMSO-differentiated human hepatic HepaRG cells treated with the fatty acid salt sodium oleate. Indeed, sodium oleate-treated HepaRG cells accumulate lipid droplets in the cytoplasm and show typical features of steatosis. This in vitro human model represents a valuable alternative to in vivo mice models as well as to the primary human hepatocytes. We also present a comparison of several methods for the quantification and evaluation of fat accumulation in HepaRG cells, including Oil Red O staining, cytofluorimetric Bodipy measurement, metabolic gene expression analysis by qPCR, and coherent anti-Stokes Raman scattering (CARS) microscopy. CARS imaging combines the chemical specificity of Raman spectroscopy, a chemical analysis technique well-known in materials science applications, with the benefits of high-speed, high-resolution non-linear optical microscopies to allow precise quantification of lipid accumulation and lipid droplet dynamics. The establishment of an efficient in vitro model for the induction of vesicular steatosis, alongside an accurate method for the quantification and characterization of lipid accumulation, could lead to the development of early stage diagnosis of NAFLD via the identification of molecular markers, and to the generation of new treatment strategies.

This protocol describes an efficient method to induce and characterize vesicular steatosis in DMSO-differentiated HepaRG cells by sodium oleate treatment (Figure 1A).
Differentiation of HepaRG cells. 
To efficiently induce differentiation, proliferating cells must be seeded at a low density (2.5 x 104 cells/cm2) in the proliferation medium. When seeded at low density, the cells actively divide and acquir...

Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells

In this study, we describe a detailed protocol for inducing liver vesicular steatosis in differentiated HepaRG cells with the fatty acid salt sodium oleate and employ methods for detection and quantification of lipid accumulation, including coherent anti-Stokes Raman scattering (CARS) microscopy, cytofluorimetric analysis, Oil red O staining, and qPCR.&#160;

Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive ...

Research

JoVE Journal

Medicine

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Inducing Myointimal Hyperplasia Versus Atherosclerosis in Mice: An Introduction of Two Valid Models

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque ...

Minimal Invasive Surgical Procedure of Inducing Myocardial Infarction in Mice

Myocardial infarction still remains the main cause of death in western countries, despite considerable progress in the stent development area in the last ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoma is a disease of the central nervous system affecting retinal ganglion cells (RGCs). RGC axons making up the optic nerve carry visual input to the ...

Inducing Ischemia-reperfusion Injury in the Mouse Ear Skin for Intravital Multiphoton Imaging of Immune Responses

Ischemia-reperfusion injury (IRI) occurs when there is transient hypoxia due to the obstruction of blood flow (ischemia) followed by a subsequent ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Inducing Acute Lung Injury in Mice by Direct Intratracheal Lipopolysaccharide Instillation

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. ...

A Revised Method for Inducing Secondary Lymphedema in the Hindlimb of Mice

Animal models are of paramount importance in the research of lymphedema in order to understand the pathophysiology of the disease but also to explore ...