We thank prof. Christian Trepo (INSERM U871, Lyon, France), who kindly provided HepaRG cells. We are grateful to Rita Appodia for administrative help. This work was supported by MIUR- Ministero dell&#8217;istruzione, dell&#39;universita&#768; e della ricerca (FIRB 2011&#8211;2016 RBAP10XKNC) and Sapienza University of Rome (prot. C26A13T8PS; prot. C26A142MCH; prot. C26A15LSXL).

1. Preparation of Culture Media and Reagents
<ol>
	<li>Proliferating medium: supplement William&#39;s E medium with GlutaMAX, 10% fetal bovine serum (FBS), 1% penicillin/streptomycin, 5 &#956;g/mL insulin and 0.5 &#956;M hydrocortisone hemisuccinate.</li>
	<li>Differentiation medium: supplement William&#39;s E medium with GlutaMAX, 10% FBS, 1% penicillin/streptomycin, 5 &#956;g/mL insulin, 50 &#956;M hydrocortisone hemisuccinate and 2% DMSO.</li>
	<li>Freezing medium: supplement proliferating medium with 10% DMSO.</li>
	<li>Sodium oleate: dissolve in 99% methanol at a 100 mM concentration, stir O/N, and store at -20 &#176;C.</li>
	<li>Oil Red O: prepare a stock solution. Weigh 0.35 g of Oil Red O and dissolve in 100 mL of isopropanol. Stir O/N, filter (0.2 &#181;m), and store at RT. Prepare a working solution: mix 6 mL of Oil Red O Stock solution with 4 mL of ddH2O. Let sit at room temperature (RT) for 20 min, and then filter with a 0.2 &#181;m filter. Proper filtration is highly recommended for successful staining to avoid background.</li>
	<li>Bodipy (505/515): dissolve Bodipy (505/515) dye in DMSO at a 100 &#181;M stock concentration, store at -20 &#176;C in dark, and use at a final 100 nM concentration.</li>
	<li>Acquire transparent glass-bottomed dishes for CARS experiments.</li>
</ol>
2. Thawing, Amplification, and Cryopreservation of HepaRG Cells
<ol>
	<li>Thaw nitrogen cryopreserved HepaRG cells by immersing a batch in a 37 &#176;C bath until defrosted. Select a low passage batch (&#60;20). HepaRG cells are commercially available.</li>
	<li>Rapidly transfer the cells into a 15 mL tube containing 10 mL of proliferating medium and centrifuge for 5 min (200 x g, 4 &#176;C).</li>
	<li>Discard the supernatant and resuspend the cells with 5 mL of proliferating medium.</li>
	<li>Count the cells and dilute in order to plate 2.5 x 104 cells/cm2.</li>
	<li>Renew the medium every 2 or 3 days. Cells proliferate with a doubling time of around 24 h.</li>
	<li>Detach HepaRG cells when at 80% confluency by 3-5 min incubation with trypsin solution 0.05%. Collect the cells in proliferating medium and centrifuge for 5 min (200 x g, 4 &#176;C).</li>
	<li>Discard the supernatant and resuspend the cells with 5 mL of proliferating medium.</li>
	<li>Count the cells and dilute in order to plate 2.5 x 104 cells/cm2.</li>
	<li>At this stage, amplify the cells by repeating steps 2.5-2.8 in order to reach an appropriate number of cells to start experiments, or cryopreserve as in step 2.10.</li>
	<li>To cryopreserve HepaRG cells, detach the cells 24 h after plating by 3-5 min incubation with trypsin solution 0.05%. Collect the cells in proliferating medium and centrifuge for 5 min (200 x g, 4 &#176;C). Discard the supernatant, resuspend the cells in 1 mL/batch of freezing medium, 1.5 x 106 cells/batch and cryopreserve the batches in liquid nitrogen.</li>
</ol>
3. Differentiation of HepaRG Cells (Day 0&#8211;21) (Figure 1A)
<ol>
	<li>Day 0. Seed HepaRG cells at low density (2.5 x 104 cells/cm2) into culture treated dishes with appropriate volume of proliferation medium (Figure 1B). Two dishes need to be plated for each assay (Oil Red O staining, FACS analysis, qPCR): one for control cells and one for oleate-treated cells. If performing CARS measurements (step 8), seed the cells in parallel into transparent glass-bottomed dishes. As a control, harvest one untreated dish (proliferating cells Day 0) to perform gene expression analysis of differentiation marker genes (see step 3.6).</li>
	<li>Day 2 and Day 4. Change the medium with appropriate volume of proliferation medium and let the cells grow until confluence.</li>
	<li>Day 7. Cells must be 100% confluent (Figure 1C). Wash the cells once with 1x phosphate-buffered saline (PBS). Remove 1x PBS and add an appropriate volume of differentiation medium.</li>
	<li>Day 8, 9, 12, 15, 18. &#160;Wash the cells once with 1x PBS. Remove 1x PBS and add an appropriate volume of differentiation medium.</li>
	<li>Day 21. Observe HepaRG cells under a microscope and ensure that the cells are confluent differentiated cultures (Figure 1D).</li>
	<li>As a control, harvest one control dish (differentiated cells Day 21) to perform gene expression analysis (step 7) of differentiation marker genes (Figure 1E).</li>
	<li>At Day 21, differentiated HepaRG cells can be cryopreserved in liquid-nitrogen.&#160;&#160;</li>
</ol>
4. Induction of Vesicular Steatosis (Day 21&#8211;26)
<ol>
	<li>Day 21. Dilute sodium oleate (100 mM) with an appropriate volume of complete differentiation medium to a final concentration of 250 &#956;M (1:400). Add 99% methanol 1:400 (same volume as that of sodium oleate) into another aliquot of differentiation medium to make the vehicle-control treatment. (For instance: add 25 &#956;L of sodium oleate to 10 mL of medium and in parallel add 25 &#956;L of 99% methanol to 10 mL of medium). Wash the cells once with 1x PBS and add vehicle or sodium oleate medium.</li>
	<li>Day 23 and Day 25. Change the medium with appropriate volume of freshly prepared medium as in step 4.1.</li>
	<li>Day 26. Observe by optical microscope that lipid droplets accumulate in the sodium oleate-treated cells and are easily visible as translucent droplets in the cytoplasm as in Figure 2A.</li>
</ol>
5. Evaluation ofLipid Overloading and Steatosis Induction: Oil Red O Staining
<ol>
	<li>Wash he cells once with 1x PBS and remove 1x PBS completely.</li>
	<li>Add 4% paraformaldehyde (diluted in 1x PBS) and incubate for 15 min at RT. 
	CAUTION: Paraformaldehyde is toxic, so this step must be performed in a fume hood, with protective equipment, including gloves, a lab coat, and a mask.</li>
	<li>Remove paraformaldehyde and wash the cells twice with 1x PBS. Cells can be kept in 1x PBS at 4 &#176;C for a couple of days before staining. Wrap with parafilm and cover with aluminum foil to prevent the cells from drying.</li>
	<li>Remove 1x PBS. Incubate the cells with 60% isopropanol for 5 min at RT.</li>
	<li>Remove isopropanol and let the cells dry completely at RT.</li>
	<li>Add Oil Red O working solution and incubate at RT for 30 min. The volume of working solution required for each sample corresponds to the volume of media used for culturing the cells.</li>
	<li>Remove Oil Red O solution and immediately add ddH2O. Wash the cells 4 times with ddH2O.</li>
	<li>Acquire images under the microscope for analysis (Figure 2B).</li>
	<li>To elute Oil Red O dye: remove all the water and allow to dry; add 1 mL of 100% isopropanol and incubate for 10 min with gentle shaking at RT.</li>
	<li>Pipet the isopropanol with eluted Oil Red O dye up and down several times, ensuring that all the Oil Red O is in the solution. Transfer the solution to a cuvette. Measure OD500 nm by spectrophotometry and use 100% isopropanol as blank (Figure 2C).</li>
</ol>
6. Evaluation of Lipid Overloading and Steatosis Induction: Bodipy Staining and Cytofluorimetric Analysis &#160;
<ol>
	<li>Wash the cells once with 1x PBS. Incubate with 100 nM of Bodipy diluted in 1x PBS in the dark for 40 min at 37 &#176;C. An unstained control should be included in the flow cytometry measurements. From this point, protect the samples from light as much as possible. 
	NOTE: The volume of staining solution required for each sample corresponds to the volume of media used for culturing cells.</li>
	<li>Remove staining solution and wash the cells once with 1x PBS. Proceed to steps 6.3-6.6. for FACS (Fluorescence-activated cell sorting) analysis or to step 6.7 for microscope imaging.</li>
	<li>Gently scrape the cells with 1x PBS and transfer it into a 15 mL tube. Centrifuge for 10 min (200 x g, 4 &#176;C).</li>
	<li>Gently remove the supernatants without disturbing the pellets and wash with 3 mL of 1x PBS. Centrifuge for 5 min (200 x g, 4 &#176;C).</li>
	<li>Remove the supernatants and resuspend in 300 &#956;L of 1x PBS, then transfer into a FACS tube.</li>
	<li>Immediately measure Bodipy fluorescence intensity by cytofluorimetric analysis with excitation/emission wavelengths of 505/515 nm (Figure 3A,B).</li>
	<li>Wash the cells once with 1x PBS and remove PBS completely.</li>
	<li>Add 4% paraformaldehyde (diluted in 1x PBS) and incubate for 15 min at RT. 
	CAUTION: Paraformaldehyde is toxic, so this step must be performed in a fume hood, with protective equipment, including gloves, a lab coat, and a mask.</li>
	<li>Remove paraformaldehyde and wash the samples 3x for 5 min in PBS. Cells can be kept in 1x PBS at 4 &#176;C or imaged immediately (Figure 3C). For storage, wrap with parafilm and cover with aluminum foil to prevent the cells from drying.</li>
</ol>
7. Evaluation of Lipid Overloading and Steatosis Induction: qPCR
<ol>
	<li>Wash the cells once with 1x PBS. Scrape the cells with 1x PBS, centrifuge at 200 x g, and discard the supernatant. At this step, cells can be harvested at -80 &#176;C or processed as in step 7.2.</li>
	<li>Perform total RNA isolation by standard methods using commercial reagents following manufacturer&#39;s instructions.</li>
	<li>Assess RNA concentration by UV spectrophotometric measurement, ensuring that the RNA purity is high (close to 2.0) based on the A260/A280 reading.</li>
	<li>Synthesize cDNA from 1 &#956;g of total RNA with a standard cDNA synthesis kit.</li>
	<li>Dilute cDNA to a final 50 &#956;L volume with H2O.</li>
	<li>Analyze each cDNA sample in triplicate by qPCR: prepare one qPCR master mix (Table 1) that is sufficient for the needed reactions for each primer, including primers specific for the three housekeeping genes as controls: gliceraldeide-3-fosfato deidrogenasi (GAPDH), actinB and ribosomal 18S (see Table of Materials for primer sequences):</li>
	<li>Dispense 18 &#956;L of master mix per well in a PCR multiwall plate.</li>
	<li>Add 2 &#956;L of cDNA sample in each well. Seal the plate.</li>
	<li>Run the samples according to the Thermal Cycler instruction.</li>
</ol>
8. Evaluation of Lipid Overloading and Steatosis Induction: CARS
<ol>
	<li>Fix the cells previously prepared on glass-bottomed dishes, as described in steps 5.1-5.3.</li>
	<li>Switch on a commercial tunable picosecond pulsed laser system, tuning it to obtain two outputs of different wavelengths. The frequency difference between the outputs must be 2,840 cm-1 to generate the intense CARS light signal corresponding to methylene symmetric stretching; for a fixed-wavelength output at 1,064 nm (&#34;Stokes&#34;&#160;light), the other wavelength should be tuned to 817 nm (&#34;pump&#34;&#160;light).</li>
	<li>Ensure the 817 nm output is spatially and temporally overlapped with the 1,064 nm output: use an appropriate dichroic mirror (i.e., with a cut between 817 and 1,064 nm) to spatially combine the beams and use an optical delay line to obtain temporal overlap of the laser pulses.</li>
	<li>Ensure the two copropagating beams are both collimated and that their diameters have similar values that are appropriate for the optical system within the microscope that will focus them onto the sample; if necessary, separately collimate the beams before the dichroic mirror that combines them.</li>
	<li>Switch on a commercial inverted microscope system, which should include an infrared laser scanning unit and a dual-channel red/green epi detection unit and align the copropagating laser beams into the scanning unit.</li>
	<li>Opening the dual-channel epi detection unit, remove the filter cube and replace its red-wavelength detection filter with a bandpass filter that can select the 2,840 cm-1 CARS signal that is centered at 663 nm for the 817/1,064 nm pump/Stokes excitation scheme. A narrow-bandwidth (20 nm) filter is preferred to avoid the collection of high levels of fluorescent background signals.</li>
	<li>Place a dish on the stage of the inverted CARS microscope, and using a 100x oil-immersion objective, shift the vertical position of the objective to focus on the cells.</li>
	<li>Set up the microscope software to collect high-resolution (1024 x 1024 pixels) images over a field of view spanning 127 &#956;m x 127 &#956;m.</li>
	<li>Set the microscope software to continuously acquire and display images of the 127 &#956;m x 127 &#956;m field of view and check the displayed images whilst optimizing the image collection parameters. Ensure that the laser powers are balanced for rapid image collection and minimal damage, inserting appropriate neutral-density filters in the beam paths as necessary, and select a pixel dwell time that allows the collection of images with a good signal-to-noise ratio under the selected laser power conditions.</li>
	<li>Acquire and save images of several different fields of view within the dish under the optimized conditions. Optionally, multiphoton fluorescence images, generated by a green-wavelength emission (mostly from two-photon excitation at 817 nm), may be simultaneously collected via the other epi detector. Repeat steps 8.7-8.10 for each dish.</li>
	<li>For the CARS image analysis, process images using the FIJI implementation of ImageJ. Operate the Despeckle function (or a similar denoising tool) on each image before further analysis to improve signal-to-noise ratios without loss of detail.</li>
	<li>Use FIJI to select cells manually and then automatically count lipid droplets within segmented individual cells to produce statistics on lipid droplet areas and numbers for each cell and for the entire image dataset for each dish.</li>
</ol>
9. MTT Cell Viability Assay
<ol>
	<li>Plate differentiated HepaRG cells into a 96-well plate with a density of 1 x 105 cells/well in a final 100 &#956;L volume of differentiation culture medium.</li>
	<li>24 h after seeding, treat the cells with 99% methanol (vehicle) and with 100 &#956;M, 250 &#956;M and 500 &#956;M sodium oleate and sodium palmitate diluted in 100 &#956;L of differentiation culture medium/well in triplicate.</li>
	<li>Change the medium with 99% methanol and with 100 &#956;M, 250 &#956;M and 500 &#956;M sodium oleate and sodium palmitate diluted in 100 &#956;L of differentiation culture medium/well every 24 h.</li>
	<li>96 h after methanol/sodium oleate/sodium palmitate treatment, treat the cells with 2 &#956;M doxorubicin diluted in 100 &#956;L of differentiation culture medium/well in triplicate as a control.</li>
	<li>18 h after doxorubucin treatment, change the medium with 100 &#956;L of differentiation culture medium.</li>
	<li>Pipet 20 &#956;L of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium reagent MTT (Table of Materials) into each well of the 96-well assay plate containing the cells in 100 &#956;L of differentiation culture medium. Include a background control by pipetting 20 &#956;L of reagent into a control well without cells in 100 &#956;L of differentiation culture medium in triplicate.&#160;</li>
	<li>Incubate the plate at 37 &#176;C in a humidified, 5% CO2 atmosphere.</li>
	<li>After incubating for 30, 60, and 90 min with MTT tetrazolium reagent, record the absorbance at 490 nm using a 96-well plate reader. Subtract the background absorbance of the no-cell control wells from the absorbance values for the other samples.</li>
</ol>

<ol>
	<li>Starley, B. Q., Calcagno, C. J., Harrison, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonalcoholic+fatty+liver+disease+and+hepatocellular+carcinoma:+a+weighty+connection.">Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection.</a> Hepatology. 51 (5), 1820-1832 (2010).</li><li>Byrne, C. D., Targher, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NAFLD:+a+multisystem+disease.">NAFLD: a multisystem disease.</a> Journal of Hepatology. 62 (1), 47-64 (2015).</li><li>Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+basis+and+mechanisms+of+progression+of+non-+alcoholic+steatohepatitis.">Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis.</a> Trends in Molecular Medicine. 14, 72-81 (2008).</li><li>Chalasani, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diagnosis+and+management+of+nonalcoholic+fatty+liver+disease:+Practice+guidance+from+the+American+Association+for+the+Study+of+Liver+Diseases.">The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases.</a> Hepatology. 67 (1), 328-357 (2018).</li><li>Banini, B. A., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+future+pharmacologic+treatment+of+nonalcoholic+steatohepatitis.">Current and future pharmacologic treatment of nonalcoholic steatohepatitis.</a> Current Opinion in Gastroenterology. 33 (3), 134-141 (2017).</li><li>Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+pharmacological+therapies+for+nonalcoholic+fatty+liver+disease/nonalcoholic+steatohepatitis.">Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis.</a> World Journal of Gastroenterology. 21 (13), 3777-3785 (2015).</li><li>Younossi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+burden+of+NAFLD+and+NASH:+trends,+predictions,+risk+factors+and+prevention.">Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention.</a> Nature Reviews Gastroenterology &amp; Hepatology. 15 (1), 11-20 (2018).</li><li>Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preclinical+models+of+non-alcoholic+fatty+liver+disease.">Preclinical models of non-alcoholic fatty liver disease.</a> Journal of Hepatology. 68 (2), 230-237 (2018).</li><li>Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+mouse+models+for+the+study+of+nonalcoholic+fatty+liver+disease.">Genetically modified mouse models for the study of nonalcoholic fatty liver disease.</a> World Journal of. Gastroenterology. 18 (11), 1141-1153 (2012).</li><li>Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+scientific+discovery:+the+need+for+preclinical+models+of+nonalcoholic+steatohepatitis.">Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis.</a> Hepatology International. 12 (1), 6-16 (2018).</li><li>Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+human+hepatic+cell+lines+for+in+vitro+testing+and+research+purposes.">Immortalized human hepatic cell lines for in vitro testing and research purposes.</a> Methods in Molecular Biology. 1250, 53-76 (2015).</li><li>G&#243;mez-Lech&#243;n, M. J., Donato, M. T., Castell, J. V., Jover, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatocytes+in+primary+culture:+the+choice+to+investigate+drug+metabolism+in+man.">Human hepatocytes in primary culture: the choice to investigate drug metabolism in man.</a> Current Drug Metabolism. 5 (5), 443-462 (2004).</li><li>Marion, M. J., Hantz, O., Durantel, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+HepaRG+cell+line:+biological+properties+and+relevance+as+a+tool+for+cell+biology,+drug+metabolism,+and+virology+studies.">The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies.</a> Methods in Molecular Biology. 640, 261-272 (2010).</li><li>Gripon, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+a+human+hepatoma+cell+line+by+hepatitis+B+virus.">Infection of a human hepatoma cell line by hepatitis B virus.</a> Proceedings of the National Academy of Sciences. 99 (24), 15655-15660 (2002).</li><li>Anth&#233;rieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+vesicular+steatosis+by+amiodarone+and+tetracycline+is+associated+with+up-regulation+of+lipogenic+genes+in+HepaRG+cells.">Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells.</a> Hepatology. 53 (6), 1895-1905 (2011).</li><li>Rouge, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PPAR+agonists+reduce+steatosis+in+oleic+acid-overloaded+HepaRG+cells.">PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells.</a> Toxicology and Applied Pharmacology. 276 (1), 73-81 (2014).</li><li>Belloni, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+a+phospho-STAT3-miRNAs+pathway+improves+vesicular+hepatic+steatosis+in+an+in+vitro+and+in+vivo+model.">Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model.</a> Scientific Reports. 8, 13638 (2018).</li><li>Nunn, A. D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+histone+deacetylase+inhibiting+drug+Entinostat+induces+lipid+accumulation+in+differentiated+HepaRG+cells.">The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells.</a> Scientific Reports. 6, 28025 (2016).</li><li>Donato, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytometric+analysis+for+drug-induced+steatosis+in+HepG2+cells.">Cytometric analysis for drug-induced steatosis in HepG2 cells.</a> Chemico-Biological Interactions. 181 (3), 417-423 (2009).</li><li>Hellerer, T., Ax&#228;ng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+of+lipid+storage+in+Caenorhabditis+elegans+using+coherent+anti-Stokes+Raman+scattering+(CARS)+microscopy.">Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy.</a> Proceedings of the National Academy of Sciences. 104 (37), 14658-14663 (2007).</li><li>Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+evaluation+of+hepatic+microvesicular+steatosis+with+multimodal+coherent+anti-Stokes+Raman+scattering+microscopy.">Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy.</a> PLoS One. 7 (11), 51092 (2012).</li><li>Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+hepatoma+HepaRG+cells:+a+highly+differentiated+model+for+studies+of+liver+metabolism+and+toxicity+of+xenobiotics.">The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics.</a> Chemico-Biological Interactions. 168 (1), 66-73 (2007).</li><li>Nelson, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatic+HepaRG+cells+maintain+an+organotypic+phenotype+with+high+intrinsic+CYP450+Activity/metabolism+and+significantly+outperform+standard+HepG2/C3A+cells+for+pharmaceutical+and+therapeutic+applications.">Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications.</a> Basic &amp; Clinical Pharmacology &amp; Toxicology. 120 (1), 30-37 (2017).</li><li>Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+human+hepatocytes,+HepG2+cells,+and+HepaRG+cells+at+the+mRNA+level+and+CYP+activity+in+response+to+inducers+and+their+predictivity+for+the+detection+of+human+hepatotoxins.">Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins.</a> Cell Biology and Toxicology. 28 (2), 69-87 (2012).</li><li>Pusl, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+sensitize+hepatocytes+to+bile+acid-induced+apoptosis.">Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis.</a> Biochemical and Biophysical Research Communications. 371 (3), 441-445 (2008).</li><li>Gentile, C. L., Pagliassotti, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+fatty+acids+in+the+development+and+progression+of+nonalcoholic+fatty+liver+disease.">The role of fatty acids in the development and progression of nonalcoholic fatty liver disease.</a> The Journal of Nutritional Biochemistry. 19 (9), 567-576 (2008).</li><li>Mei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+roles+of+unsaturated+and+saturated+fatty+acids+on+autophagy+and+apoptosis+in+hepatocytes.">Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes.</a> Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).</li><li>Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+induce+JNK-dependent+hepatocyte+lipoapoptosis.">Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis.</a> Journal of Biological Chemistry. 281, 12093-12101 (2006).</li><li>Moravcov&#225;, A., &#268;ervinkov&#225;, Z., Ku&#269;era, O., Mezera, V., Rychtrmoc, D., Lotkov&#225;, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+oleic+and+palmitic+acid+on+induction+of+steatosis+and+cytotoxicity+on+rat+hepatocytes+in+primary+culture.">The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture.</a> Physiological Research. 64, 627-636 (2015).</li><li>Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pitfall+in+using+BODIPY+dyes+to+label+lipid+droplets+for+fluorescence+microscopy.">A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy.</a> Histochemistry and Cell Biology. 133 (4), 477-480 (2010).</li><li>Rinia, H. A., Burger, K. N., Bonn, M., M&#252;ller, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+label-free+imaging+of+lipid+composition+and+packing+of+individual+cellular+lipid+droplets+using+multiplex+CARS+microscopy.">Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy.</a> Biophysical Journal. 95 (10), 4908-4914 (2008).</li><li>Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+in+situ+imaging+of+oil+body+dynamics+and+chemistry+in+germination.">Label-free in situ imaging of oil body dynamics and chemistry in germination.</a> Journal of The Royal Society Interface. 13 (123), (2016).</li><li>J&#252;ngst, C., Winterhalder, M. J., Zumbusch, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+long+term+lipid+droplet+tracking+with+CARS+microscopy.">Fast and long term lipid droplet tracking with CARS microscopy.</a> Journal of Biophotonics. 4 (6), 435-441 (2011).</li><li>Welte, M. A., Gould, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplet+functions+beyond+energy+storage.">Lipid droplet functions beyond energy storage.</a> Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862 (10), 1260-1272 (2017).</li><li>Cohen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+as+organelles.">Lipid droplets as organelles.</a> International Review of Cell and Molecular Biology. 337, 83-110 (2018).</li><li>Farese, R. V., Walther, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+finally+get+a+little+R-E-S-P-E-C-T.">Lipid droplets finally get a little R-E-S-P-E-C-T.</a> Cell. 139 (5), 855-860 (2009).</li></ol>

The authors declare that they have no competing financial interests.

This protocol describes how to differentiate HepaRG cells and how to induce vesicular steatosis by sodium oleate treatment (Figure 1A). Indeed, compared to other human hepatocellular carcinoma (HCC) cell lines, the HepaRG cell line exhibits features of adult human hepatocytes, representing a valuable alternative to ex vivo cultivated primary human hepatocytes13,14,15. The HepaRG cel...

Hepatic steatosis is defined as intrahepatic fat accumulation, within triglyceride-containing lipid droplets, of at least 5% of liver weight. Prolonged hepatic lipid storage is a potentially reversible process, however, it can lead to liver metabolic dysfunction, inflammation and advanced forms of nonalcoholic fatty liver disease (NAFLD), the predominant cause of chronic liver disease in many parts of the world1,2. NAFLD is a multifactorial disease that may evolve to the more aggressive non-alcoholic steatohepatitis (NASH), which in turn can progress to cirrhosis and, in a small percentage of patients, to hepatocellular carcinoma (HCC)1,3. No approved therapy is currently available as a specific treatment for NAFLD and the combination of diet and lifestyle modifications remains the pillar of NAFLD and NASH management4,5,6.
The molecu&#173;lar mechanisms leading to the development of hepatic steatosis in the pathogenesis of NAFLD still remain to be elucidated7. In this context, mouse models have been developed to study human steatosis disease progression. A myriad of different models exists, and each one has its advantages and disadvantages, including genetic, nutritional and chemically induced models combining different approaches. Genetically modified (transgenic or knockout) mice spontaneously develop liver disease. However, it should be noted that these mutations are very rare in humans and deletion or over-expression of a single gene (e.g., ob/ob mouse) may not mimic the etiology of the multifactorial human disease at the molecular level8,9. Likewise, the disease acquired by mice after dietary or pharmacological manipulation may not mimic the effects of human diets associated with development of NAFLD in man8. Animal models have, however, facilitated developments in the understanding of NAFLD and this approach is currently the most frequently used strategy in laboratory research. Nevertheless, the replication in humans of results obtained in animal models has repeatedly failed, causing poor translation into the clinic10.
Therefore, in vitro models of NAFLD may play a fundamental role in elucidating the molecular mechanisms of NAFLD progression, and they represent a valuable tool to screen a large number of compounds. Primary cell cultures, immortalized cell lines and liver biopsies have been extensively used for research purposes11. Primary human hepatocytes closely resemble human clinical conditions, but there is a limited number of donors, and primary cell cultures show poor reproducibility due to the variability of the cells. These observations, together with ethical and logistic issues, have resulted in the use of human primary hepatocytes being limited12. Thus, hepatic cell lines represent a convenient alternative, having several essential advantages over primary culture, as hepatic cell lines grow steadily, have an almost unlimited life-span, and have a stable phenotype. Moreover, cell lines are easily accessible and the culture conditions of hepatic cell lines are simpler than those of primary hepatocytes and are standardized among different laboratories.
Here, we describe in detail an in vitro cell-based model of liver vesicular steatosis, represented by hepatic differentiated HepaRG cells treated with the fatty acid sodium oleate. The HepaRG cell line was established from a female patient affected by hepatitis C infection and an Edmondson grade I well-differentiated liver tumor14. The HepaRG cell line is a human bipotent progenitor cell line capable of differentiating upon exposure to 2% dimethyl sulfoxide (DMSO) toward two different cell phenotypes: biliary-like and hepatocyte-like cells. Differentiated HepaRG cells (dHepaRG) share some features and properties with adult hepatocytes and possess the ability to stably express liver-specific genes such as Albumin, AldolaseB, Cytochrome P450 2E1 (CYP2E1), and Cytochrome P450 3A4 (CYP3A4)13 (step 3). Treatment of dHepaRG cells with the fatty acid salt sodium oleate (250 &#956;M) for 5 days lead to the generation of cytoplasmic lipid droplets, mimicking the effects of fatty liver14,15,17,18 (step 4). Accumulation of lipid droplets can be easily detected by Oil Red O staining (step 5), a lysochrome fat-soluble dye that stains neutral triglycerides and lipids red-orange. To efficiently quantify lipids in fatty dHepaRG, here we illustrate cytofluorimetric analysis after staining with 4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene (Bodipy 505/515) (step 6), a lipophilic fluorescent probe that localizes to intracellular lipid bodies and has been used to label lipid droplets19. Moreover, here we show how to evaluate steatosis by quantitative polymerase chain reaction (qPCR) (step 7) gene expression deregulation of several metabolic genes in dHepaRG cells. To further characterize and quantify the accumulation of lipid droplets after sodium oleate treatment, we performed coherent anti-Stokes Raman scattering (CARS) microscopy (step 8), an innovative technique that enables the visualization and quantification of lipid droplets without labeling20,21.

<table border="0" cellpadding="0" cellspacing="0" style="width:799px;" width="797">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Hyclone HyClone Fetal Clone II&#160;</td>
			<td style="width:240px;">GE Healthcare</td>
			<td style="width:143px;">SH30066</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">William&#8217;s E medium with GlutaMAX&#160;</td>
			<td style="width:240px;">Thermofisher</td>
			<td>32551087</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/streptomycin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>P4333</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Insulin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>I9278</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">hydrocortisone hemisuccinate</td>
			<td style="width:240px;">SIGMA</td>
			<td>H2270</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">DMSO, dimethyl sulfoxide</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">D2438&#160;&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Sodium Oleate</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O7501&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Methanol</td>
			<td style="width:240px;">SIGMA</td>
			<td>179337</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Isopropanol</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">278475</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BODIPY 505/515</td>
			<td>Thermofisher</td>
			<td>D3921</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">PBS</td>
			<td style="width:240px;">Thermofisher</td>
			<td>14190-250</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution</td>
			<td style="width:240px;">SIGMA</td>
			<td>252549</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">RNAse free DNAseI</td>
			<td style="width:240px;">Promega</td>
			<td>M198A&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glass-bottomed dishes</td>
			<td style="width:240px;">Willco Wells</td>
			<td style="width:143px;">GWST-5040</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Oil Red solution</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O625</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">CellTiter 96 AQueous One Solution</td>
			<td style="width:240px;">Promega&#160;</td>
			<td style="width:143px;">G3582</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">q-PCR oligo name</td>
			<td>Sequence</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ACACB FOR</td>
			<td>CAAGCCGATCACCAAGAGTAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">ACACB REV</td>
			<td>CCCTGAGTTATCAGAGGCTGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin FOR</td>
			<td style="width:240px;">GCACTCTTCCAGCCTTCCT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin REV</td>
			<td style="width:240px;">AGGTCTTTGCGGATGTCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN FOR</td>
			<td>TGCTTGAATGTGCTGATGACAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN REV</td>
			<td>AAGGCAAGTCAGCAGGCATCTCATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB FOR</td>
			<td>GCATCTGTCAGCAGAATGGA&#160;</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB REV</td>
			<td>TAGACAGCAGCCAGGACCTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB FOR</td>
			<td>CCTCCGTTTTGGTGGTAGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB REV</td>
			<td>&#160;CCTAAAAGCTGGGAAGCTGA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 FOR</td>
			<td>CTCAGCTTCATGCAGGGTTA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 REV</td>
			<td>GGTGCTCCAGTAGTCTTTCAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A FOR</td>
			<td>TCATCAAGAAATGTCGCACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A REV</td>
			<td>GCCTCGTATGTGAGGCAAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 FOR</td>
			<td>TTGAAGCCTCTCGTTGACCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 REV</td>
			<td>CGTGGTGGGATACAGCCAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 FOR</td>
			<td>CTTCATCCAATGGACTGCATAAAT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 REV</td>
			<td>TCCCAAGTATAACACTCTACACAGACAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH FOR</td>
			<td>TGACAACTTTGGTATCGTGGAAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH REV</td>
			<td>AGGGATGATGTTCTGGAGAGCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM FOR</td>
			<td>TCTTTGGGTTTGCGGAATGTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM REV</td>
			<td>ATGCACATCTCGCTCTTGAATAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 FOR</td>
			<td>CCTGAACCTTCCAAAGATGGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 REV</td>
			<td>ACCTCAAACTCCAAAAGACCAGTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 FOR</td>
			<td>ACAGACAGGAAACCCAAGCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 REV</td>
			<td>TGGAGGTGAGAAGGAACATACACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 FOR</td>
			<td>TTGCAGTTGCCAATACCTATGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 REV</td>
			<td>CCAGTCACAGTAGTCGTCACA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 FOR</td>
			<td>AATGAGTTGGAGGGGCTGGGGGACATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 REV</td>
			<td>GGTCACCTAAACGAACGAAGTAGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD FOR</td>
			<td>TCTAGCTCCTATACCACCACCA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD REV</td>
			<td>TCGTCTCCAACTTATCTCCTCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 FOR</td>
			<td>TGCTCATCAACCGCAACGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 REV</td>
			<td>CCGACTCTCTTCCTTCATCTCCTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S FOR</td>
			<td>CGCCGCTAGAGGTGAAATTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S REV</td>
			<td>TTGGCAAATGCTTTCGCTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

inducing and characterizing vesicular steatosis in differentiated heparg cells

Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive fat accumulation leads to non-alcoholic fatty liver disease (NAFLD), &#160;which is potentially reversible and may evolve into non-alcoholic steatohepatitis (NASH) and eventually cirrhosis and hepatocellular carcinoma (HCC). The molecular mechanisms linking lipid accumulation in hepatocytes with the progression to NASH, irreversible liver damage, fibrosis, cirrhosis, and even HCC still remains unclear. To this end, several in vitro and in vivo models have been developed to elucidate the pathological processes that cause NAFLD. In the present study, we describe a cellular model for the induction of liver vesicular steatosis that consists of DMSO-differentiated human hepatic HepaRG cells treated with the fatty acid salt sodium oleate. Indeed, sodium oleate-treated HepaRG cells accumulate lipid droplets in the cytoplasm and show typical features of steatosis. This in vitro human model represents a valuable alternative to in vivo mice models as well as to the primary human hepatocytes. We also present a comparison of several methods for the quantification and evaluation of fat accumulation in HepaRG cells, including Oil Red O staining, cytofluorimetric Bodipy measurement, metabolic gene expression analysis by qPCR, and coherent anti-Stokes Raman scattering (CARS) microscopy. CARS imaging combines the chemical specificity of Raman spectroscopy, a chemical analysis technique well-known in materials science applications, with the benefits of high-speed, high-resolution non-linear optical microscopies to allow precise quantification of lipid accumulation and lipid droplet dynamics. The establishment of an efficient in vitro model for the induction of vesicular steatosis, alongside an accurate method for the quantification and characterization of lipid accumulation, could lead to the development of early stage diagnosis of NAFLD via the identification of molecular markers, and to the generation of new treatment strategies.

This protocol describes an efficient method to induce and characterize vesicular steatosis in DMSO-differentiated HepaRG cells by sodium oleate treatment (Figure 1A).
Differentiation of HepaRG cells. 
To efficiently induce differentiation, proliferating cells must be seeded at a low density (2.5 x 104 cells/cm2) in the proliferation medium. When seeded at low density, the cells actively divide and acquir...

Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells

In this study, we describe a detailed protocol for inducing liver vesicular steatosis in differentiated HepaRG cells with the fatty acid salt sodium oleate and employ methods for detection and quantification of lipid accumulation, including coherent anti-Stokes Raman scattering (CARS) microscopy, cytofluorimetric analysis, Oil red O staining, and qPCR.&#160;

Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive ...

inducing-characterizing-vesicular-steatosis-differentiated-heparg

Research

JoVE Journal

Medicine

8.7K Views.  Sapienza University. In this study, we describe a detailed protocol for inducing liver vesicular steatosis in differentiated HepaRG cells with the fatty acid salt sodium oleate and employ methods for detection and quantification of lipid accumulation, including coherent anti-Stokes Raman scattering (CARS) microscopy, cytofluorimetric analysis, Oil red O staining, and qPCR. 

Video: Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells

Inducing Myointimal Hyperplasia Versus Atherosclerosis in Mice: An Introduction of Two Valid Models

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque formation and stenosis, as observed for example in ischemic heart disease. Two highly reproducible mouse models&#160;&#8211;&#160;both resulting in artery stenosis but each underlying a different pathway of development&#160;&#8211; are introduced here. The models represent the two most common causes of artery stenosis; namely one mouse model for each myointimal hyperplasia, and atherosclerosis are shown. To induce myointimal hyperplasia, a balloon catheter injury of the abdominal aorta is performed. For the development of atherosclerotic plaque, the ApoE -/- mouse model in combination with western fatty diet is used. Different model-adapted options for the measurement and evaluation of the results are named and described in this manuscript. The introduction and comparison of these two models provides information for scientists to choose the appropriate artery stenosis model in accordance to the scientific question asked.

This video shows two models of intimal plaque development in murine arteries and emphasizes the differences in myointimal hyperplasia and atherosclerosis.

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque ...

Minimal Invasive Surgical Procedure of Inducing Myocardial Infarction in Mice

Myocardial infarction still remains the main cause of death in western countries, despite considerable progress in the stent development area in the last decades. For clarification of the underlying mechanisms and the development of new therapeutic strategies, the availability of valid animal models are mandatory. Since we need new insights into pathomechanisms of cardiovascular diseases under in vivo conditions to combat myocardial infarction, the validity of the animal model is a crucial aspect. However, protection of animals are highly relevant in this context. Therefore, we establish a minimally invasive and simple model of myocardial infarction in mice, which assures a high reproducibility and survival rate of animals. Thus, this models fulfils the requirements of the 3R principle (Replacement, Refinement and Reduction) for animal experiments and assure the scientific information needed for further developing of therapeutical strategies for cardiovascular diseases.

A highly reproducible model for myocardial infarction in mice with minimal invasive manipulations is described. The model can be easily performed, resulting in a high reproducibility and survival rate. Thus, the described model will reduce the number of required animals as requested by the 3R principle (Replacement, Refinement and Reduction).

Myocardial infarction still remains the main cause of death in western countries, despite considerable progress in the stent development area in the last ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoma is a disease of the central nervous system affecting retinal ganglion cells (RGCs). RGC axons making up the optic nerve carry visual input to the brain for visual perception. Damage to RGCs and their axons leads to vision loss and/or blindness. Although the specific cause of glaucoma is unknown, the primary risk factor for the disease is an elevated intraocular pressure. Glaucoma-inducing procedures in animal models are a valuable tool to researchers studying the mechanism of RGC death. Such information can lead to the development of effective neuroprotective treatments that could aid in the prevention of vision loss. The protocol in this paper describes a method of inducing glaucoma - like conditions in an in vivo rat model where 50 &#181;l of 2 M hypertonic saline is injected into the episcleral venous plexus. Blanching of the vessels indicates successful injection. This procedure causes loss of RGCs to simulate glaucoma. One month following injection, animals are sacrificed and eyes are removed. Next, the cornea, lens, and vitreous are removed to make an eyecup. The retina is then peeled from the back of the eye and pinned onto sylgard dishes using cactus needles. At this point, neurons in the retina can be stained for analysis. Results from this lab show that approximately 25% of RGCs are lost within one month of the procedure when compared to internal controls. This procedure allows for quantitative analysis of retinal ganglion cell death in an in vivo rat glaucoma model.

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoma is characterized by damage to retinal ganglion cells. Inducing glaucoma in animal models can provide insight into the study of this disease. Here, we outline a procedure that induces loss of RGCs in an in vivo rat model and demonstrates the preparation of whole-mount retinas for analysis.

Glaucoma is a disease of the central nervous system affecting retinal ganglion cells (RGCs). RGC axons making up the optic nerve carry visual input to the ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic study in the liver. Here, numerous assays are described to comprehensively measure the phenotype and parameters of hepatic steatosis in mouse and hepatocyte models. 
Combining the physiological, histological, and biochemical methods, this system can be used to assess the progress of hepatic steatosis. In vivo, the measurements of body weight and nuclear magnetic resonance (NMR) provide a general understanding of mice in a non-invasive manner. Hematoxylin and Eosin (H&amp;E) and Oil Red O staining determine the histological morphology and lipid deposition of liver tissue under nutrient overload conditions, such as high-fat diet feeding. Next, the total lipid contents are isolated by chloroform/methanol extraction, which are followed by a biochemical analysis for triglyceride and cholesterol. Moreover, mouse primary hepatocytes are treated with high glucose plus insulin to stimulate lipid accumulation, an efficient in vitro model to mimic diet-induced hyperglycemia and hyperinsulinemia in vivo. Then, the lipid deposition is measured by Oil Red O staining and chloroform/methanol extraction. Oil Red O staining determines intuitive hepatic steatotic phenotypes, while the lipid extraction analysis determines the parameters that can be analyzed statistically. The present protocols are of interest to scientists in the fields of fatty liver diseases, insulin resistance, and type 2 diabetes.

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Here, optimized methods to generate in vivo and in vitro models of hepatic steatosis and to analyze the steatotic phenotypes and related physiological parameters are described.

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Inducing Acute Lung Injury in Mice by Direct Intratracheal Lipopolysaccharide Instillation

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. Various approaches have been described, such as the inhalation of aerosolized LPS as well as nasal or intratracheal instillation. The presented protocol describes a detailed step-by-step procedure to induce ALI in mice by direct intratracheal LPS instillation and perform FACS analysis of blood samples, bronchoalveolar lavage (BAL) fluid, and lung tissue. After intraperitoneal sedation, the trachea is exposed and LPS is administered via a 22 G venous catheter. A robust and reproducible inflammatory reaction with leukocyte invasion, upregulation of proinflammatory cytokines, and disruption of the alveolo-capillary barrier is induced within hours to days, depending on the LPS dosage used. Collection of blood samples, BAL fluid, and lung harvesting, as well as the processing for FACS analysis, are described in detail in the protocol. Although the use of the sterile LPS is not suitable to study pharmacologic interventions in infectious diseases, the described approach offers minimal invasiveness, simple handling, and good reproducibility to answer mechanistic immunological questions. Furthermore, dose titration as well as the use of alternative LPS preparations or mouse strains allow modulation of the clinical effects, which can exhibit different degrees of ALI severity or early vs. late onset of disease symptoms.

Presented here is a step-by-step procedure to induce acute lung injury in mice by direct intratracheal lipopolysaccharide instillation and to perform FACS analysis of blood samples, bronchoalveolar lavage fluid, and lung tissue. Minimal invasiveness, simple handling, good reproducibility, and titration of disease severity are advantages of this approach.

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. ...

Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations often cause a distorted reading frame and premature stop codons, resulting in an almost total lack of dystrophin protein. The reading frame can be corrected using antisense oligonucleotides (AONs) that induce exon skipping. The morpholino AON viltolarsen (code name: NS-065/NCNP-01) has been shown to induce exon 53 skipping, restoring the reading frame for patients with exon 52 deletions. We recently administered NS-065/NCNP-01 intravenously to DMD patients in an exploratory investigator-initiated, first-in-human trial of NS-065/NCNP-01. In this methods article, we present the molecular characterization of dystrophin expression using Sanger sequencing, RT-PCR, and western blotting in the clinical trial. The characterization of dystrophin expression was fundamental in the study for showing the efficacy since no functional outcome tests were performed.

Here, we present the molecular characterization of dystrophin 38 expression using Sanger sequencing, RT-PCR, and western blotting in the clinical trial.

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations ...

A Model of Experimental Steatosis In Vitro: Hepatocyte Cell Culture in Lipid Overload-Conditioned Medium

Metabolic dysfunction-associated fatty liver disease (MAFLD), previously known as non-alcoholic fatty liver disease (NAFLD), is the most prevalent liver disease worldwide due to its relationship with obesity, diabetes type 2, and dyslipidemia. Hepatic steatosis, the accumulation of lipid droplets in the liver parenchyma, is a key feature of the disease preceding the inflammation observed in steatohepatitis, fibrosis, and end-stage liver disease. Lipid accumulation in hepatocytes might interfere with proper metabolism of xenobiotics and endogenous molecules, as well as to induce cellular processes leading to the advance of the disease. Although the experimental study of steatosis can be performed in vivo, in vitro approaches to the study of steatosis are complementary tools with different advantages. Hepatocyte culture in lipid overload-conditioned medium is an excellent reproducible option for the study of hepatic steatosis allowing the identification of cellular processes related to lipid accumulation, such as oxidative and reticular stresses, autophagia, proliferation, cell death, etcetera, as well as other testing including drug effectiveness, and toxicological testing, among many other possible applications. Here, it was aimed to describe the methodology of hepatocyte cell culture in lipid overload-conditioned medium. HepG2 cells were cultured in RMPI 1640 medium conditioned with sodium palmitate and sodium oleate. Importantly, the ratio of these two lipids is crucial to favor lipid droplet accumulation, while maintaining cell proliferation and a moderate mortality rate, as occurs in the liver during the disease. The methodology, from the preparation of the lipid solution stocks, mixture, addition to the medium, and hepatocyte culture is shown. With this approach, it is possible to identify lipid droplets in the hepatocytes that are readily observable by Oil-red O staining, as well as curves of proliferation/mortality rates.

A Model of Experimental Steatosis In Vitro: Hepatocyte Cell Culture in Lipid Overload-Conditioned Medium

This protocol is intended to be a tool to study steatosis and the molecular, biochemical, cellular changes produced by the over exposure of hepatocytes to lipids in vitro.

Metabolic dysfunction-associated fatty liver disease (MAFLD), previously known as non-alcoholic fatty liver disease (NAFLD), is the most prevalent liver ...

A Modified Biopsy Punch Method for Precise Alkali Burns in Mice

Corneal and Limbal Alkali Injury Induction Using a Punch-Trephine Technique in a Mouse Model

The cornea is critical for vision, and corneal healing after trauma is fundamental in maintaining its transparency and function. Through the study of corneal injury models, researchers aim to enhance their understanding of how the cornea heals and develop strategies to prevent and manage corneal opacities. Chemical injury is one of the most popular injury models that has extensively been studied on mice. Most previous investigators have used a flat paper soaked in sodium hydroxide to induce corneal injury. However, inducing corneal and limbal injury using flat filter paper is unreliable, since the mouse cornea is highly curved. Here, we present a new instrument, a modified biopsy punch, that enables the researchers to create a well-circumscribed, localized, and evenly distributed alkali injury to the murine cornea and limbus. This punch-trephine method enables researchers to induce an accurate and reproducible chemical burn to the entire murine cornea and limbus while leaving other structures, such as the eyelids, unaffected by the chemical. Moreover, this study introduces an enucleation technique that preserves the medial caruncle as a landmark for identifying the nasal side of the globe. The bulbar and palpebral conjunctiva, and lacrimal gland are also kept intact using this technique. Ophthalmologic examinations were performed via slit lamp biomicroscope and fluorescein staining on days 0, 1, 2, 6, 8, and 14 post-injury. Clinical, histological, and immunohistochemical findings confirmed limbal stem cell deficiency and ocular surface regeneration failure in all experimental mice. The presented alkali corneal injury model is ideal for studying limbal stem cell deficiency, corneal inflammation, and fibrosis. This method is also suitable for investigating pre-clinical and clinical efficacies of topical ophthalmologic medications on the murine corneal surface.

Author Spotlight: Advancing Research in Corneal Opacity Treatment and Regeneration 

This protocol describes a method to induce an accurate and reproducible corneal and limbal alkali injury in a mouse model. The protocol is advantageous as it allows for an evenly distributed injury to the highly curved mouse cornea and limbus.

The cornea is critical for vision, and corneal healing after trauma is fundamental in maintaining its transparency and function. Through the study of ...