Name: inducing and characterizing vesicular steatosis in differentiated heparg cells
Uploaded: 2019-07-18T13:30:00
Description: Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

We thank prof. Christian Trepo (INSERM U871, Lyon, France), who kindly provided HepaRG cells. We are grateful to Rita Appodia for administrative help. This work was supported by MIUR- Ministero dell&#8217;istruzione, dell&#39;universita&#768; e della ricerca (FIRB 2011&#8211;2016 RBAP10XKNC) and Sapienza University of Rome (prot. C26A13T8PS; prot. C26A142MCH; prot. C26A15LSXL).

1. Preparation of Culture Media and Reagents
<ol>
	<li>Proliferating medium: supplement William&#39;s E medium with GlutaMAX, 10% fetal bovine serum (FBS), 1% penicillin/streptomycin, 5 &#956;g/mL insulin and 0.5 &#956;M hydrocortisone hemisuccinate.</li>
	<li>Differentiation medium: supplement William&#39;s E medium with GlutaMAX, 10% FBS, 1% penicillin/streptomycin, 5 &#956;g/mL insulin, 50 &#956;M hydrocortisone hemisuccinate and 2% DMSO.</li>
	<li>Freezing medium: supplement proliferating medium with 10% DMSO.</li>...

<ol>
	<li>Starley, B. Q., Calcagno, C. J., Harrison, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonalcoholic+fatty+liver+disease+and+hepatocellular+carcinoma:+a+weighty+connection.">Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection.</a> Hepatology. 51 (5), 1820-1832 (2010).</li><li>Byrne, C. D., Targher, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NAFLD:+a+multisystem+disease.">NAFLD: a multisystem disease.</a> Journal of Hepatology. 62 (1), 47-64 (2015).</li><li>Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+basis+and+mechanisms+of+progression+of+non-+alcoholic+steatohepatitis.">Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis.</a> Trends in Molecular Medicine. 14, 72-81 (2008).</li><li>Chalasani, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diagnosis+and+management+of+nonalcoholic+fatty+liver+disease:+Practice+guidance+from+the+American+Association+for+the+Study+of+Liver+Diseases.">The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases.</a> Hepatology. 67 (1), 328-357 (2018).</li><li>Banini, B. A., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+future+pharmacologic+treatment+of+nonalcoholic+steatohepatitis.">Current and future pharmacologic treatment of nonalcoholic steatohepatitis.</a> Current Opinion in Gastroenterology. 33 (3), 134-141 (2017).</li><li>Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+pharmacological+therapies+for+nonalcoholic+fatty+liver+disease/nonalcoholic+steatohepatitis.">Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis.</a> World Journal of Gastroenterology. 21 (13), 3777-3785 (2015).</li><li>Younossi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+burden+of+NAFLD+and+NASH:+trends,+predictions,+risk+factors+and+prevention.">Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention.</a> Nature Reviews Gastroenterology &amp; Hepatology. 15 (1), 11-20 (2018).</li><li>Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preclinical+models+of+non-alcoholic+fatty+liver+disease.">Preclinical models of non-alcoholic fatty liver disease.</a> Journal of Hepatology. 68 (2), 230-237 (2018).</li><li>Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+mouse+models+for+the+study+of+nonalcoholic+fatty+liver+disease.">Genetically modified mouse models for the study of nonalcoholic fatty liver disease.</a> World Journal of. Gastroenterology. 18 (11), 1141-1153 (2012).</li><li>Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+scientific+discovery:+the+need+for+preclinical+models+of+nonalcoholic+steatohepatitis.">Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis.</a> Hepatology International. 12 (1), 6-16 (2018).</li><li>Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+human+hepatic+cell+lines+for+in+vitro+testing+and+research+purposes.">Immortalized human hepatic cell lines for in vitro testing and research purposes.</a> Methods in Molecular Biology. 1250, 53-76 (2015).</li><li>G&#243;mez-Lech&#243;n, M. J., Donato, M. T., Castell, J. V., Jover, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatocytes+in+primary+culture:+the+choice+to+investigate+drug+metabolism+in+man.">Human hepatocytes in primary culture: the choice to investigate drug metabolism in man.</a> Current Drug Metabolism. 5 (5), 443-462 (2004).</li><li>Marion, M. J., Hantz, O., Durantel, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+HepaRG+cell+line:+biological+properties+and+relevance+as+a+tool+for+cell+biology,+drug+metabolism,+and+virology+studies.">The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies.</a> Methods in Molecular Biology. 640, 261-272 (2010).</li><li>Gripon, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+a+human+hepatoma+cell+line+by+hepatitis+B+virus.">Infection of a human hepatoma cell line by hepatitis B virus.</a> Proceedings of the National Academy of Sciences. 99 (24), 15655-15660 (2002).</li><li>Anth&#233;rieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+vesicular+steatosis+by+amiodarone+and+tetracycline+is+associated+with+up-regulation+of+lipogenic+genes+in+HepaRG+cells.">Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells.</a> Hepatology. 53 (6), 1895-1905 (2011).</li><li>Rouge, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PPAR+agonists+reduce+steatosis+in+oleic+acid-overloaded+HepaRG+cells.">PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells.</a> Toxicology and Applied Pharmacology. 276 (1), 73-81 (2014).</li><li>Belloni, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+a+phospho-STAT3-miRNAs+pathway+improves+vesicular+hepatic+steatosis+in+an+in+vitro+and+in+vivo+model.">Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model.</a> Scientific Reports. 8, 13638 (2018).</li><li>Nunn, A. D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+histone+deacetylase+inhibiting+drug+Entinostat+induces+lipid+accumulation+in+differentiated+HepaRG+cells.">The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells.</a> Scientific Reports. 6, 28025 (2016).</li><li>Donato, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytometric+analysis+for+drug-induced+steatosis+in+HepG2+cells.">Cytometric analysis for drug-induced steatosis in HepG2 cells.</a> Chemico-Biological Interactions. 181 (3), 417-423 (2009).</li><li>Hellerer, T., Ax&#228;ng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+of+lipid+storage+in+Caenorhabditis+elegans+using+coherent+anti-Stokes+Raman+scattering+(CARS)+microscopy.">Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy.</a> Proceedings of the National Academy of Sciences. 104 (37), 14658-14663 (2007).</li><li>Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+evaluation+of+hepatic+microvesicular+steatosis+with+multimodal+coherent+anti-Stokes+Raman+scattering+microscopy.">Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy.</a> PLoS One. 7 (11), 51092 (2012).</li><li>Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+hepatoma+HepaRG+cells:+a+highly+differentiated+model+for+studies+of+liver+metabolism+and+toxicity+of+xenobiotics.">The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics.</a> Chemico-Biological Interactions. 168 (1), 66-73 (2007).</li><li>Nelson, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatic+HepaRG+cells+maintain+an+organotypic+phenotype+with+high+intrinsic+CYP450+Activity/metabolism+and+significantly+outperform+standard+HepG2/C3A+cells+for+pharmaceutical+and+therapeutic+applications.">Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications.</a> Basic &amp; Clinical Pharmacology &amp; Toxicology. 120 (1), 30-37 (2017).</li><li>Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+human+hepatocytes,+HepG2+cells,+and+HepaRG+cells+at+the+mRNA+level+and+CYP+activity+in+response+to+inducers+and+their+predictivity+for+the+detection+of+human+hepatotoxins.">Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins.</a> Cell Biology and Toxicology. 28 (2), 69-87 (2012).</li><li>Pusl, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+sensitize+hepatocytes+to+bile+acid-induced+apoptosis.">Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis.</a> Biochemical and Biophysical Research Communications. 371 (3), 441-445 (2008).</li><li>Gentile, C. L., Pagliassotti, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+fatty+acids+in+the+development+and+progression+of+nonalcoholic+fatty+liver+disease.">The role of fatty acids in the development and progression of nonalcoholic fatty liver disease.</a> The Journal of Nutritional Biochemistry. 19 (9), 567-576 (2008).</li><li>Mei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+roles+of+unsaturated+and+saturated+fatty+acids+on+autophagy+and+apoptosis+in+hepatocytes.">Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes.</a> Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).</li><li>Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+induce+JNK-dependent+hepatocyte+lipoapoptosis.">Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis.</a> Journal of Biological Chemistry. 281, 12093-12101 (2006).</li><li>Moravcov&#225;, A., &#268;ervinkov&#225;, Z., Ku&#269;era, O., Mezera, V., Rychtrmoc, D., Lotkov&#225;, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+oleic+and+palmitic+acid+on+induction+of+steatosis+and+cytotoxicity+on+rat+hepatocytes+in+primary+culture.">The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture.</a> Physiological Research. 64, 627-636 (2015).</li><li>Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pitfall+in+using+BODIPY+dyes+to+label+lipid+droplets+for+fluorescence+microscopy.">A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy.</a> Histochemistry and Cell Biology. 133 (4), 477-480 (2010).</li><li>Rinia, H. A., Burger, K. N., Bonn, M., M&#252;ller, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+label-free+imaging+of+lipid+composition+and+packing+of+individual+cellular+lipid+droplets+using+multiplex+CARS+microscopy.">Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy.</a> Biophysical Journal. 95 (10), 4908-4914 (2008).</li><li>Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+in+situ+imaging+of+oil+body+dynamics+and+chemistry+in+germination.">Label-free in situ imaging of oil body dynamics and chemistry in germination.</a> Journal of The Royal Society Interface. 13 (123), (2016).</li><li>J&#252;ngst, C., Winterhalder, M. J., Zumbusch, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+long+term+lipid+droplet+tracking+with+CARS+microscopy.">Fast and long term lipid droplet tracking with CARS microscopy.</a> Journal of Biophotonics. 4 (6), 435-441 (2011).</li><li>Welte, M. A., Gould, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplet+functions+beyond+energy+storage.">Lipid droplet functions beyond energy storage.</a> Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862 (10), 1260-1272 (2017).</li><li>Cohen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+as+organelles.">Lipid droplets as organelles.</a> International Review of Cell and Molecular Biology. 337, 83-110 (2018).</li><li>Farese, R. V., Walther, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+finally+get+a+little+R-E-S-P-E-C-T.">Lipid droplets finally get a little R-E-S-P-E-C-T.</a> Cell. 139 (5), 855-860 (2009).</li></ol>

This protocol describes how to differentiate HepaRG cells and how to induce vesicular steatosis by sodium oleate treatment (Figure 1A). Indeed, compared to other human hepatocellular carcinoma (HCC) cell lines, the HepaRG cell line exhibits features of adult human hepatocytes, representing a valuable alternative to ex vivo cultivated primary human hepatocytes13,14,15. The HepaRG cel...

Hepatic steatosis is defined as intrahepatic fat accumulation, within triglyceride-containing lipid droplets, of at least 5% of liver weight. Prolonged hepatic lipid storage is a potentially reversible process, however, it can lead to liver metabolic dysfunction, inflammation and advanced forms of nonalcoholic fatty liver disease (NAFLD), the predominant cause of chronic liver disease in many parts of the world1,2. NAFLD is a multifactorial disease that may evolve to the more aggressive non-alcoholic steatohepatitis (NASH), which in turn can progress to cirrhosis and, in a small percentage of patients, to hepatocellular carcinoma (HCC)1,3. No approved therapy is currently available as a specific treatment for NAFLD and the combination of diet and lifestyle modifications remains the pillar of NAFLD and NASH management4,5,6.
The molecu&#173;lar mechanisms leading to the development of hepatic steatosis in the pathogenesis of NAFLD still remain to be elucidated7. In this context, mouse models have been developed to study human steatosis disease progression. A myriad of different models exists, and each one has its advantages and disadvantages, including genetic, nutritional and chemically induced models combining different approaches. Genetically modified (transgenic or knockout) mice spontaneously develop liver disease. However, it should be noted that these mutations are very rare in humans and deletion or over-expression of a single gene (e.g., ob/ob mouse) may not mimic the etiology of the multifactorial human disease at the molecular level8,9. Likewise, the disease acquired by mice after dietary or pharmacological manipulation may not mimic the effects of human diets associated with development of NAFLD in man8. Animal models have, however, facilitated developments in the understanding of NAFLD and this approach is currently the most frequently used strategy in laboratory research. Nevertheless, the replication in humans of results obtained in animal models has repeatedly failed, causing poor translation into the clinic10.
Therefore, in vitro models of NAFLD may play a fundamental role in elucidating the molecular mechanisms of NAFLD progression, and they represent a valuable tool to screen a large number of compounds. Primary cell cultures, immortalized cell lines and liver biopsies have been extensively used for research purposes11. Primary human hepatocytes closely resemble human clinical conditions, but there is a limited number of donors, and primary cell cultures show poor reproducibility due to the variability of the cells. These observations, together with ethical and logistic issues, have resulted in the use of human primary hepatocytes being limited12. Thus, hepatic cell lines represent a convenient alternative, having several essential advantages over primary culture, as hepatic cell lines grow steadily, have an almost unlimited life-span, and have a stable phenotype. Moreover, cell lines are easily accessible and the culture conditions of hepatic cell lines are simpler than those of primary hepatocytes and are standardized among different laboratories.
Here, we describe in detail an in vitro cell-based model of liver vesicular steatosis, represented by hepatic differentiated HepaRG cells treated with the fatty acid sodium oleate. The HepaRG cell line was established from a female patient affected by hepatitis C infection and an Edmondson grade I well-differentiated liver tumor14. The HepaRG cell line is a human bipotent progenitor cell line capable of differentiating upon exposure to 2% dimethyl sulfoxide (DMSO) toward two different cell phenotypes: biliary-like and hepatocyte-like cells. Differentiated HepaRG cells (dHepaRG) share some features and properties with adult hepatocytes and possess the ability to stably express liver-specific genes such as Albumin, AldolaseB, Cytochrome P450 2E1 (CYP2E1), and Cytochrome P450 3A4 (CYP3A4)13 (step 3). Treatment of dHepaRG cells with the fatty acid salt sodium oleate (250 &#956;M) for 5 days lead to the generation of cytoplasmic lipid droplets, mimicking the effects of fatty liver14,15,17,18 (step 4). Accumulation of lipid droplets can be easily detected by Oil Red O staining (step 5), a lysochrome fat-soluble dye that stains neutral triglycerides and lipids red-orange. To efficiently quantify lipids in fatty dHepaRG, here we illustrate cytofluorimetric analysis after staining with 4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene (Bodipy 505/515) (step 6), a lipophilic fluorescent probe that localizes to intracellular lipid bodies and has been used to label lipid droplets19. Moreover, here we show how to evaluate steatosis by quantitative polymerase chain reaction (qPCR) (step 7) gene expression deregulation of several metabolic genes in dHepaRG cells. To further characterize and quantify the accumulation of lipid droplets after sodium oleate treatment, we performed coherent anti-Stokes Raman scattering (CARS) microscopy (step 8), an innovative technique that enables the visualization and quantification of lipid droplets without labeling20,21.

<table border="0" cellpadding="0" cellspacing="0" style="width:799px;" width="797">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Hyclone HyClone Fetal Clone II&#160;</td>
			<td style="width:240px;">GE Healthcare</td>
			<td style="width:143px;">SH30066</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">William&#8217;s E medium with GlutaMAX&#160;</td>
			<td style="width:240px;">Thermofisher</td>
			<td>32551087</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/streptomycin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>P4333</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Insulin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>I9278</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">hydrocortisone hemisuccinate</td>
			<td style="width:240px;">SIGMA</td>
			<td>H2270</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">DMSO, dimethyl sulfoxide</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">D2438&#160;&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Sodium Oleate</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O7501&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Methanol</td>
			<td style="width:240px;">SIGMA</td>
			<td>179337</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Isopropanol</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">278475</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BODIPY 505/515</td>
			<td>Thermofisher</td>
			<td>D3921</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">PBS</td>
			<td style="width:240px;">Thermofisher</td>
			<td>14190-250</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution</td>
			<td style="width:240px;">SIGMA</td>
			<td>252549</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">RNAse free DNAseI</td>
			<td style="width:240px;">Promega</td>
			<td>M198A&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glass-bottomed dishes</td>
			<td style="width:240px;">Willco Wells</td>
			<td style="width:143px;">GWST-5040</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Oil Red solution</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O625</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">CellTiter 96 AQueous One Solution</td>
			<td style="width:240px;">Promega&#160;</td>
			<td style="width:143px;">G3582</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">q-PCR oligo name</td>
			<td>Sequence</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ACACB FOR</td>
			<td>CAAGCCGATCACCAAGAGTAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">ACACB REV</td>
			<td>CCCTGAGTTATCAGAGGCTGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin FOR</td>
			<td style="width:240px;">GCACTCTTCCAGCCTTCCT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin REV</td>
			<td style="width:240px;">AGGTCTTTGCGGATGTCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN FOR</td>
			<td>TGCTTGAATGTGCTGATGACAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN REV</td>
			<td>AAGGCAAGTCAGCAGGCATCTCATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB FOR</td>
			<td>GCATCTGTCAGCAGAATGGA&#160;</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB REV</td>
			<td>TAGACAGCAGCCAGGACCTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB FOR</td>
			<td>CCTCCGTTTTGGTGGTAGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB REV</td>
			<td>&#160;CCTAAAAGCTGGGAAGCTGA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 FOR</td>
			<td>CTCAGCTTCATGCAGGGTTA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 REV</td>
			<td>GGTGCTCCAGTAGTCTTTCAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A FOR</td>
			<td>TCATCAAGAAATGTCGCACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A REV</td>
			<td>GCCTCGTATGTGAGGCAAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 FOR</td>
			<td>TTGAAGCCTCTCGTTGACCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 REV</td>
			<td>CGTGGTGGGATACAGCCAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 FOR</td>
			<td>CTTCATCCAATGGACTGCATAAAT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 REV</td>
			<td>TCCCAAGTATAACACTCTACACAGACAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH FOR</td>
			<td>TGACAACTTTGGTATCGTGGAAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH REV</td>
			<td>AGGGATGATGTTCTGGAGAGCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM FOR</td>
			<td>TCTTTGGGTTTGCGGAATGTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM REV</td>
			<td>ATGCACATCTCGCTCTTGAATAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 FOR</td>
			<td>CCTGAACCTTCCAAAGATGGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 REV</td>
			<td>ACCTCAAACTCCAAAAGACCAGTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 FOR</td>
			<td>ACAGACAGGAAACCCAAGCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 REV</td>
			<td>TGGAGGTGAGAAGGAACATACACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 FOR</td>
			<td>TTGCAGTTGCCAATACCTATGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 REV</td>
			<td>CCAGTCACAGTAGTCGTCACA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 FOR</td>
			<td>AATGAGTTGGAGGGGCTGGGGGACATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 REV</td>
			<td>GGTCACCTAAACGAACGAAGTAGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD FOR</td>
			<td>TCTAGCTCCTATACCACCACCA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD REV</td>
			<td>TCGTCTCCAACTTATCTCCTCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 FOR</td>
			<td>TGCTCATCAACCGCAACGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 REV</td>
			<td>CCGACTCTCTTCCTTCATCTCCTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S FOR</td>
			<td>CGCCGCTAGAGGTGAAATTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S REV</td>
			<td>TTGGCAAATGCTTTCGCTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

inducing and characterizing vesicular steatosis in differentiated heparg cells

Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive fat accumulation leads to non-alcoholic fatty liver disease (NAFLD), &#160;which is potentially reversible and may evolve into non-alcoholic steatohepatitis (NASH) and eventually cirrhosis and hepatocellular carcinoma (HCC). The molecular mechanisms linking lipid accumulation in hepatocytes with the progression to NASH, irreversible liver damage, fibrosis, cirrhosis, and even HCC still remains unclear. To this end, several in vitro and in vivo models have been developed to elucidate the pathological processes that cause NAFLD. In the present study, we describe a cellular model for the induction of liver vesicular steatosis that consists of DMSO-differentiated human hepatic HepaRG cells treated with the fatty acid salt sodium oleate. Indeed, sodium oleate-treated HepaRG cells accumulate lipid droplets in the cytoplasm and show typical features of steatosis. This in vitro human model represents a valuable alternative to in vivo mice models as well as to the primary human hepatocytes. We also present a comparison of several methods for the quantification and evaluation of fat accumulation in HepaRG cells, including Oil Red O staining, cytofluorimetric Bodipy measurement, metabolic gene expression analysis by qPCR, and coherent anti-Stokes Raman scattering (CARS) microscopy. CARS imaging combines the chemical specificity of Raman spectroscopy, a chemical analysis technique well-known in materials science applications, with the benefits of high-speed, high-resolution non-linear optical microscopies to allow precise quantification of lipid accumulation and lipid droplet dynamics. The establishment of an efficient in vitro model for the induction of vesicular steatosis, alongside an accurate method for the quantification and characterization of lipid accumulation, could lead to the development of early stage diagnosis of NAFLD via the identification of molecular markers, and to the generation of new treatment strategies.

This protocol describes an efficient method to induce and characterize vesicular steatosis in DMSO-differentiated HepaRG cells by sodium oleate treatment (Figure 1A).
Differentiation of HepaRG cells. 
To efficiently induce differentiation, proliferating cells must be seeded at a low density (2.5 x 104 cells/cm2) in the proliferation medium. When seeded at low density, the cells actively divide and acquir...

Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells

In this study, we describe a detailed protocol for inducing liver vesicular steatosis in differentiated HepaRG cells with the fatty acid salt sodium oleate and employ methods for detection and quantification of lipid accumulation, including coherent anti-Stokes Raman scattering (CARS) microscopy, cytofluorimetric analysis, Oil red O staining, and qPCR.&#160;

Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive ...

This protocol describes how to induce liver vesicular steatosis in differentiated HepaRG cells and methods for detection and quantification of lipid accumulation. This in vitro human cell model represents a valuable alternative to in vivo mice models and to primary human hepatocytes. Thaw a nitrogen cryopreserved low-passage batch of HepaRG cells by immersing them in a 37 degree Celsius bath until defrosted.Rapidly transfer the cells into a 15-milliliter tube containing 10 milliliters of proliferating medium. After centrifuging for five minutes, discard the supernatant and resuspend the cells in five milliliters of proliferating medium. Count the cells and dilute in order to plate 250, 000 cells per square centimeter.Plate the cells on 100-millimeter cell culture dishes and renew the medium every two or three days. Cells proliferate with a doubling time of around 24 hours. Once the HepaRG cells reach 80%confluency, detach them through a three-to five-minute incubation with 0.05%trypsin solution.Collect the cells in proliferating medium and centrifuge for five minutes as before. Discard the supernatant and resuspend the cells with five milliliters of proliferating medium. Again, count the cells and dilute in order to plate 250, 000 cells per square centimeter.At this stage, amplify the cells by repeating these steps to reach an appropriate number of cells to start experiments. To cryopreserve HepaRG cells, detach the cells 24 hours after plating through a three-to five-minute incubation with 0.05%trypsin solution. Collect the cells in proliferating medium and centrifuge for five minutes as before.Discard the supernatant, resuspend the cells in one milliliter per batch of freezing medium, and cryopreserve the batches in liquid nitrogen. On day zero, seed HepaRG cells at 250, 000 cells per square centimeter into culture-treated dishes with an appropriate volume of proliferation medium. Two dishes need to be plated for each assay, one for control cells and one for oleate-treated cells.On day two and day four, change the medium with an appropriate volume of proliferation medium and let the cells grow until they reach confluence. On day seven, the cells must be 100%confluent. Wash the cells once with 1X PBS.Then, remove the 1X PBS and add an appropriate volume of differentiation medium. On days eight, nine, 12, 15, and 18, wash the cells once with 1X PBS before adding an appropriate volume of differentiation medium. On day 21, observe HepaRG cells under a microscope and ensure that the cells are confluent differentiated cultures.As a control, harvest one control dish to perform gene expression analysis of differentiation marker genes. At day 21, differentiated HepaRG cells can be cryopreserved in liquid nitrogen. On day 21, dilute sodium oleate with an appropriate volume of complete differentiation medium to a final concentration of 250 micromolar.Add 99%methanol at a ratio of one to 400 into another aliquot of differentiation medium to make the vehicle control treatment. Wash the cells once with 1X PBS and add vehicle or sodium oleate medium. On day 23 and day 25, change the medium with the appropriate volume of freshly-prepared medium.On day 26, observe the cells by optical microscopy. Lipid droplets accumulate in the sodium oleate treated cells and are easily visible as translucent droplets in the cytoplasm. To perform Oil Red O staining, first wash the cells once with 1X PBS and remove the 1X PBS completely.Add 4%paraformaldehyde and incubate for 15 minutes at room temperature. Remove the paraformaldehyde and wash the cells twice with 1X PBS. After removing the PBS, incubate the cells with 60%isopropanol for five minutes at room temperature.Remove the isopropanol and let the cells dry completely at room temperature. Now add Oil Red O working solution to the cells and incubate at room temperature for 30 minutes. The volume of working solution required for each sample corresponds to the volume of media used for culturing the cells.Remove the Oil Red O solution and immediately add double-distilled water. After washing the cells four times with double-distilled water, acquire images under the microscope for analysis. To elute the Oil Red O dye, remove all the water and allow to dry.Then, add one milliliter of 100%isopropanol and incubate for 10 minutes with gentle shaking at room temperature. Pipette the isopropanol with eluted Oil Red O dye up and down several times, ensuring that all the Oil Red O is in the solution. Transfer the solution to a cuvette.Measure the optical density at 500 nanometers by spectrophotometry and use 100%isopropanol as the blank. Wash the cells once with 1X PBS. Then, incubate with 100 nanomolar of Bodipy diluted in 1X PBS in the dark for 40 minutes at 37 degrees Celsius.An unstained control should be included in the flow cytometry measurements. Remove the staining solution and wash the cells once with 1X PBS. Then, wash the cells again and remove the PBS completely.Add 4%paraformaldehyde and incubate for 15 minutes at room temperature. Remove the paraformaldehyde and wash the samples three times for five minutes in PBS. Cells can be kept in 1X PBS at four degrees Celsius or imaged immediately.For storage, wrap with Parafilm and cover with aluminum foil to prevent the cells from drying. To verify efficient induction of steatosis, oleate-treated and control HepaRG cells were stained with Oil Red O dye. After staining, lipid droplets are easily visible as red droplets.Staining can be quantified by spectrophotometric measurement of Oil R O dye eluted with isopropanol. Absorbance of eluted Oil Red O from the cells is directly proportional to cytoplasmic lipid droplet accumulation. Sodium oleate concentration and exposure time were determined by MTT colorimetric cell viability assay.The Formosan product is quantified by its absorbance at 490 nanometers and is directly proportional to the number of living cells in culture. Sodium oleate treatment was compared to sodium palmitate treatment. The apoptotic drug doxorubicin was used as a control.To quantify the increase of cellular lipid content after sodium oleate treatment, staining with Bodipy dye was used to label lipid droplets. Using cytofluorometric analysis, it is possible to quantify the triglyceride content by Bodipy mean fluorescent intensity, which is higher in oleate-treated cells as compared to control cells. This indicates efficient fat accumulation after oleate treatment.Indeed, images of Bodipy-stained cells show bright green fluorescent lipid droplets in oleate-treated cells that are not visible in the control cells. To further characterize the accumulation of lipid droplets after sodium oleate treatment, CARS microscopy can be performed as described in the text protocol which enables lipid droplets quantification without labeling. This cell-based model may increase knowledge of the molecular mechanisms involved in non-oncotic fatty liver disease and could lead to the development of new markers for early diagnosis and new treatment strategies.

inducing-characterizing-vesicular-steatosis-differentiated-heparg

Research

JoVE Journal

Medicine

Inducing Myointimal Hyperplasia Versus Atherosclerosis in Mice: An Introduction of Two Valid Models

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque formation and stenosis, as observed for example in ischemic heart disease. Two highly reproducible mouse models&#160;&#8211;&#160;both resulting in artery stenosis but each underlying a different pathway of development&#160;&#8211; are introduced here. The models represent the two most common causes of artery stenosis; namely one mouse model for each myointimal hyperplasia, and atherosclerosis are shown. To induce myointimal hyperplasia, a balloon catheter injury of the abdominal aorta is performed. For the development of atherosclerotic plaque, the ApoE -/- mouse model in combination with western fatty diet is used. Different model-adapted options for the measurement and evaluation of the results are named and described in this manuscript. The introduction and comparison of these two models provides information for scientists to choose the appropriate artery stenosis model in accordance to the scientific question asked.

This video shows two models of intimal plaque development in murine arteries and emphasizes the differences in myointimal hyperplasia and atherosclerosis.

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque ...

Minimal Invasive Surgical Procedure of Inducing Myocardial Infarction in Mice

Myocardial infarction still remains the main cause of death in western countries, despite considerable progress in the stent development area in the last decades. For clarification of the underlying mechanisms and the development of new therapeutic strategies, the availability of valid animal models are mandatory. Since we need new insights into pathomechanisms of cardiovascular diseases under in vivo conditions to combat myocardial infarction, the validity of the animal model is a crucial aspect. However, protection of animals are highly relevant in this context. Therefore, we establish a minimally invasive and simple model of myocardial infarction in mice, which assures a high reproducibility and survival rate of animals. Thus, this models fulfils the requirements of the 3R principle (Replacement, Refinement and Reduction) for animal experiments and assure the scientific information needed for further developing of therapeutical strategies for cardiovascular diseases.

A highly reproducible model for myocardial infarction in mice with minimal invasive manipulations is described. The model can be easily performed, resulting in a high reproducibility and survival rate. Thus, the described model will reduce the number of required animals as requested by the 3R principle (Replacement, Refinement and Reduction).

Myocardial infarction still remains the main cause of death in western countries, despite considerable progress in the stent development area in the last ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoma is a disease of the central nervous system affecting retinal ganglion cells (RGCs). RGC axons making up the optic nerve carry visual input to the brain for visual perception. Damage to RGCs and their axons leads to vision loss and/or blindness. Although the specific cause of glaucoma is unknown, the primary risk factor for the disease is an elevated intraocular pressure. Glaucoma-inducing procedures in animal models are a valuable tool to researchers studying the mechanism of RGC death. Such information can lead to the development of effective neuroprotective treatments that could aid in the prevention of vision loss. The protocol in this paper describes a method of inducing glaucoma - like conditions in an in vivo rat model where 50 &#181;l of 2 M hypertonic saline is injected into the episcleral venous plexus. Blanching of the vessels indicates successful injection. This procedure causes loss of RGCs to simulate glaucoma. One month following injection, animals are sacrificed and eyes are removed. Next, the cornea, lens, and vitreous are removed to make an eyecup. The retina is then peeled from the back of the eye and pinned onto sylgard dishes using cactus needles. At this point, neurons in the retina can be stained for analysis. Results from this lab show that approximately 25% of RGCs are lost within one month of the procedure when compared to internal controls. This procedure allows for quantitative analysis of retinal ganglion cell death in an in vivo rat glaucoma model.

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoma is characterized by damage to retinal ganglion cells. Inducing glaucoma in animal models can provide insight into the study of this disease. Here, we outline a procedure that induces loss of RGCs in an in vivo rat model and demonstrates the preparation of whole-mount retinas for analysis.

Glaucoma is a disease of the central nervous system affecting retinal ganglion cells (RGCs). RGC axons making up the optic nerve carry visual input to the ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic study in the liver. Here, numerous assays are described to comprehensively measure the phenotype and parameters of hepatic steatosis in mouse and hepatocyte models. 
Combining the physiological, histological, and biochemical methods, this system can be used to assess the progress of hepatic steatosis. In vivo, the measurements of body weight and nuclear magnetic resonance (NMR) provide a general understanding of mice in a non-invasive manner. Hematoxylin and Eosin (H&amp;E) and Oil Red O staining determine the histological morphology and lipid deposition of liver tissue under nutrient overload conditions, such as high-fat diet feeding. Next, the total lipid contents are isolated by chloroform/methanol extraction, which are followed by a biochemical analysis for triglyceride and cholesterol. Moreover, mouse primary hepatocytes are treated with high glucose plus insulin to stimulate lipid accumulation, an efficient in vitro model to mimic diet-induced hyperglycemia and hyperinsulinemia in vivo. Then, the lipid deposition is measured by Oil Red O staining and chloroform/methanol extraction. Oil Red O staining determines intuitive hepatic steatotic phenotypes, while the lipid extraction analysis determines the parameters that can be analyzed statistically. The present protocols are of interest to scientists in the fields of fatty liver diseases, insulin resistance, and type 2 diabetes.

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Here, optimized methods to generate in vivo and in vitro models of hepatic steatosis and to analyze the steatotic phenotypes and related physiological parameters are described.

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Inducing Acute Lung Injury in Mice by Direct Intratracheal Lipopolysaccharide Instillation

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. Various approaches have been described, such as the inhalation of aerosolized LPS as well as nasal or intratracheal instillation. The presented protocol describes a detailed step-by-step procedure to induce ALI in mice by direct intratracheal LPS instillation and perform FACS analysis of blood samples, bronchoalveolar lavage (BAL) fluid, and lung tissue. After intraperitoneal sedation, the trachea is exposed and LPS is administered via a 22 G venous catheter. A robust and reproducible inflammatory reaction with leukocyte invasion, upregulation of proinflammatory cytokines, and disruption of the alveolo-capillary barrier is induced within hours to days, depending on the LPS dosage used. Collection of blood samples, BAL fluid, and lung harvesting, as well as the processing for FACS analysis, are described in detail in the protocol. Although the use of the sterile LPS is not suitable to study pharmacologic interventions in infectious diseases, the described approach offers minimal invasiveness, simple handling, and good reproducibility to answer mechanistic immunological questions. Furthermore, dose titration as well as the use of alternative LPS preparations or mouse strains allow modulation of the clinical effects, which can exhibit different degrees of ALI severity or early vs. late onset of disease symptoms.

Presented here is a step-by-step procedure to induce acute lung injury in mice by direct intratracheal lipopolysaccharide instillation and to perform FACS analysis of blood samples, bronchoalveolar lavage fluid, and lung tissue. Minimal invasiveness, simple handling, good reproducibility, and titration of disease severity are advantages of this approach.

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. ...

A Revised Method for Inducing Secondary Lymphedema in the Hindlimb of Mice

Animal models are of paramount importance in the research of lymphedema in order to understand the pathophysiology of the disease but also to explore potential treatment options. This mouse model allows researchers to induce significant lymphedema lasting at least 8 weeks. Lymphedema is induced using a combination of fractioned radiotherapy and surgical ablation of lymphatics. This model requires that the mice get a dose of 10 Gray (Gy) radiation before and after surgery. The surgical part of the model involves ligation of three lymph vessels and extraction of two lymph nodes from the mouse hindlimb. Having access to microsurgical tools and a microscope is essential, due to the small anatomical structures of mice. The advantage of this model is that it results in statistically significant lymphedema, which provides a good basis for evaluating different treatment options. It is also a great and easily available option for microsurgical training. The limitation of this model is that the procedure can be time consuming, especially if not practiced in advance. The model results in objectively quantifiable lymphedema in mice, without causing severe morbidity and has been tested in three separate projects.

This animal model enables researchers to induce statistically significant secondary lymphedema in the hindlimb of mice, lasting at least 8 weeks. The model can be used to study the pathophysiology of lymphedema and to investigate novel treatment options.

Animal models are of paramount importance in the research of lymphedema in order to understand the pathophysiology of the disease but also to explore ...

Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations often cause a distorted reading frame and premature stop codons, resulting in an almost total lack of dystrophin protein. The reading frame can be corrected using antisense oligonucleotides (AONs) that induce exon skipping. The morpholino AON viltolarsen (code name: NS-065/NCNP-01) has been shown to induce exon 53 skipping, restoring the reading frame for patients with exon 52 deletions. We recently administered NS-065/NCNP-01 intravenously to DMD patients in an exploratory investigator-initiated, first-in-human trial of NS-065/NCNP-01. In this methods article, we present the molecular characterization of dystrophin expression using Sanger sequencing, RT-PCR, and western blotting in the clinical trial. The characterization of dystrophin expression was fundamental in the study for showing the efficacy since no functional outcome tests were performed.

Here, we present the molecular characterization of dystrophin 38 expression using Sanger sequencing, RT-PCR, and western blotting in the clinical trial.

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations ...

Inducing Acute Liver Injury in Rats via Carbon Tetrachloride (CCl4) Exposure Through an Orogastric Tube

Acute liver injury (ALI) plays a crucial role in the development of hepatic failure, which is characterized by severe liver dysfunction including complications such as hepatic encephalopathy and impaired protein synthesis. Appropriate animal models are vital to test the mechanism and pathophysiology of ALI and investigate different hepatoprotective strategies. Due to its ability to perform chemical transformations, carbon tetrachloride (CCl4) is widely used in the liver to induce ALI through the formation of reactive oxygen species. CCl4 exposure can be performed intraperitoneally, by inhalation, or through a nasogastric or orogastric tube. Here, we describe a rodent model, in which ALI is induced by CCl4 exposure through an orogastric tube. This method is inexpensive, easily performed, and has minimal hazard risk. The model is highly reproducible and can be widely used to determine the efficacy of potential hepatoprotective strategies and assess markers of liver injury.

Inducing Acute Liver Injury in Rats via Carbon Tetrachloride CCl4 Exposure Through an Orogastric Tube

This protocol describes a common and feasible method of inducing acute liver injury (ALI) via CCl4 exposure through an orogastric tube. CCl4 exposure induces ALI through the formation of reactive oxygen species during its biotransformation in the liver. This method is used to analyze the pathophysiology of ALI and examine different hepatoprotective strategies.

Acute liver injury (ALI) plays a crucial role in the development of hepatic failure, which is characterized by severe liver dysfunction including ...

A Model of Experimental Steatosis In Vitro: Hepatocyte Cell Culture in Lipid Overload-Conditioned Medium

Metabolic dysfunction-associated fatty liver disease (MAFLD), previously known as non-alcoholic fatty liver disease (NAFLD), is the most prevalent liver disease worldwide due to its relationship with obesity, diabetes type 2, and dyslipidemia. Hepatic steatosis, the accumulation of lipid droplets in the liver parenchyma, is a key feature of the disease preceding the inflammation observed in steatohepatitis, fibrosis, and end-stage liver disease. Lipid accumulation in hepatocytes might interfere with proper metabolism of xenobiotics and endogenous molecules, as well as to induce cellular processes leading to the advance of the disease. Although the experimental study of steatosis can be performed in vivo, in vitro approaches to the study of steatosis are complementary tools with different advantages. Hepatocyte culture in lipid overload-conditioned medium is an excellent reproducible option for the study of hepatic steatosis allowing the identification of cellular processes related to lipid accumulation, such as oxidative and reticular stresses, autophagia, proliferation, cell death, etcetera, as well as other testing including drug effectiveness, and toxicological testing, among many other possible applications. Here, it was aimed to describe the methodology of hepatocyte cell culture in lipid overload-conditioned medium. HepG2 cells were cultured in RMPI 1640 medium conditioned with sodium palmitate and sodium oleate. Importantly, the ratio of these two lipids is crucial to favor lipid droplet accumulation, while maintaining cell proliferation and a moderate mortality rate, as occurs in the liver during the disease. The methodology, from the preparation of the lipid solution stocks, mixture, addition to the medium, and hepatocyte culture is shown. With this approach, it is possible to identify lipid droplets in the hepatocytes that are readily observable by Oil-red O staining, as well as curves of proliferation/mortality rates.

A Model of Experimental Steatosis In Vitro: Hepatocyte Cell Culture in Lipid Overload-Conditioned Medium

This protocol is intended to be a tool to study steatosis and the molecular, biochemical, cellular changes produced by the over exposure of hepatocytes to lipids in vitro.

Metabolic dysfunction-associated fatty liver disease (MAFLD), previously known as non-alcoholic fatty liver disease (NAFLD), is the most prevalent liver ...