Name: high-throughput antiviral assays to screen for inhibitors of zika virus replication
Uploaded: 2021-10-30T14:00:00
Description: Watch this Scientific Journal Video about High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication at JoVE.com

This work was supported by Funda&#231;&#227;o de Amparo &#224; Pesquisa do Estado de S&#227;o Paulo (FAPESP), CEPID grant 2013/07600-3 to GO, grant 2018/05130-3 to RSF and 2016/19712-9 to ASG, and Coordena&#231;&#227;o de Aperfei&#231;oamento de Pessoal de N&#237;vel Superior (grant 88887.516153/2020-00) to ASG. We would like to gratefully thank the Medicine for Malaria Ventures (MMV,&#160;www.mmv.org) and the Drugs for Neglected Diseases initiative (DNDi, www.dndi.org) for their support, design of the Pandemic Response Box and supplying the compounds.

1. Luciferase activity assay
NOTE: Ensure that all procedures involving cell culture are conducted in certified biosafety hoods (see Table of Materials).
<ol>
	<li>Prepare growth media consisting in Dulbecco&#39;s Modi&#64257;ed Eagle&#39;s Medium (DMEM) supplemented with 10% FBS and 500 &#181;g/mL G418.</li>
	<li>Prepare a 10 mM stock solution of tested compounds in 100% DMSO, and then dilute them to 1 mM in 100% DMSO.</li>
	<li>Culture ZIKV Rluc r...

<ol>
	<li>Zou, J., Shi, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+Zika+drug+discovery.">Strategies for Zika drug discovery.</a> Current Opinion in Virology. 35, 19-26 (2019).</li><li>Cugola, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Brazilian+Zika+virus+strain+causes+birth+defects+in+experimental+models.">The Brazilian Zika virus strain causes birth defects in experimental models.</a> Nature. 534 (7606), 267-271 (2016).</li><li>de Ara&#250;jo, T. V. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Association+between+microcephaly,+Zika+virus+infection,+and+other+risk+factors+in+Brazil:+Final+report+of+a+case-control+study.">Association between microcephaly, Zika virus infection, and other risk factors in Brazil: Final report of a case-control study.</a> The Lancet Infectious Diseases. 18 (3), 328-336 (2018).</li><li>Cao-Lormeau, V. -. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guillain-Barr&#233;+Syndrome+outbreak+associated+with+Zika+virus+infection+in+French+Polynesia:+a+case-control+study.">Guillain-Barr&#233; Syndrome outbreak associated with Zika virus infection in French Polynesia: a case-control study.</a> The Lancet. 387 (10027), 1531-1539 (2016).</li><li>Pielnaa, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus-spread,+epidemiology,+genome,+transmission+cycle,+clinical+manifestation,+associated+challenges,+vaccine+and+antiviral+drug+development.">Zika virus-spread, epidemiology, genome, transmission cycle, clinical manifestation, associated challenges, vaccine and antiviral drug development.</a> Virology. 543, 34-42 (2020).</li><li>Bollati, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+and+functionality+in+flavivirus+NS-proteins:+Perspectives+for+drug+design+Flaviviral+NS3+protein+Flaviviral+NS5+protein+Protease+Helicase+Polymerase+Methyltransferase+Flavivirus+protein+structure+Antivirals+VIZIER+Consortium.">Structure and functionality in flavivirus NS-proteins: Perspectives for drug design Flaviviral NS3 protein Flaviviral NS5 protein Protease Helicase Polymerase Methyltransferase Flavivirus protein structure Antivirals VIZIER Consortium.</a> Antiviral Research. 87, 125-148 (2010).</li><li>Fernandes, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reporter+replicons+for+antiviral+drug+discovery+against+positive+single-stranded+RNA+viruses.">Reporter replicons for antiviral drug discovery against positive single-stranded RNA viruses.</a> Viruses. 12 (6), (2020).</li><li>Fernandes, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+an+imidazonaphthyridine+and+a+riminophenazine+as+potent+anti-Zika+virus+agents+through+a+replicon-based+high-throughput+screening.">Discovery of an imidazonaphthyridine and a riminophenazine as potent anti-Zika virus agents through a replicon-based high-throughput screening.</a> Virus Research. 299, 198388 (2021).</li><li>Noske, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+characterization+and+polymorphism+analysis+of+the+NS2B-NS3+protease+from+the+2017+Brazilian+circulating+strain+of+Yellow+Fever+virus.">Structural characterization and polymorphism analysis of the NS2B-NS3 protease from the 2017 Brazilian circulating strain of Yellow Fever virus.</a> Biochimica et Biophysica Acta - General Subjects. 1864 (4), 129521 (2020).</li><li>Godoy, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Zika+virus+NS5+RNA-dependent+RNA+polymerase.">Crystal structure of Zika virus NS5 RNA-dependent RNA polymerase.</a> Nature Communications. 8, 14764 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+adenosine+nucleoside+inhibitor+of+dengue+virus.">An adenosine nucleoside inhibitor of dengue virus.</a> Proceedings of the National Academy of Sciences. 106 (48), 20435-20439 (2009).</li><li>Zhang, J. H., Chung, T. D. Y., Oldenburg, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+statistical+parameter+for+use+in+evaluation+and+validation+of+high+throughput+screening+assays.">A simple statistical parameter for use in evaluation and validation of high throughput screening assays.</a> Journal of Biomolecular Screening. 4 (2), 67-73 (1999).</li><li>Brecher, M., Zhang, J., Li, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+flavivirus+protease+as+a+target+for+drug+discovery.">The flavivirus protease as a target for drug discovery.</a> Virologica Sinica. 28 (6), 326-336 (2013).</li><li>Noble, C. G., Seh, C. C., Chao, A. T., Shi, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-bound+structures+of+the+dengue+virus+protease+reveal+the+active+conformation.">Ligand-bound structures of the dengue virus protease reveal the active conformation.</a> Journal of Virology. 86 (1), 438-446 (2012).</li><li>Chen, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+activation+and+inhibition+of+Zika+virus+NS2B-NS3+protease.">Mechanisms of activation and inhibition of Zika virus NS2B-NS3 protease.</a> Cell Research. 26 (11), 1260-1263 (2016).</li><li>Eyer, L., Nencka, R., de Clercq, E., Seley-Radtke, K., R&#367;&#382;ek, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleoside+analogs+as+a+rich+source+of+antiviral+agents+active+against+arthropod-borne+flaviviruses.">Nucleoside analogs as a rich source of antiviral agents active against arthropod-borne flaviviruses.</a> Antiviral Chemistry and Chemotherapy. 26, (2018).</li><li>Xie, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus+Replicons+for+Drug+Discovery.">Zika Virus Replicons for Drug Discovery.</a> EBioMedicine. 12, 156-160 (2016).</li><li>Pan, K. L., Lee, J. C., Sung, H. W., Chang, T. Y., Hsu, J. T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+NS3/4A+protease-based+reporter+assay+suitable+for+efficiently+assessing+hepatitis+C+virus+infection.">Development of NS3/4A protease-based reporter assay suitable for efficiently assessing hepatitis C virus infection.</a> Antimicrobial Agents and Chemotherapy. 53 (11), 4825-4834 (2009).</li><li>Khumthong, R., Angsuthanasombat, C., Panyim, S., Katzenmeier, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vitro+Determination+of+Dengue+Virus+Type+2+NS2B-NS3+Protease+Activity+with+Fluorescent+Peptide+Substrates.">In Vitro Determination of Dengue Virus Type 2 NS2B-NS3 Protease Activity with Fluorescent Peptide Substrates.</a> Journal of Biochemistry and Molecular Biology. 35 (2), (2002).</li><li>Ulanday, G. E. L., Okamoto, K., Morita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+utility+of+an+in+vitro,+fluorescence-based+assay+for+the+discovery+of+novel+compounds+against+dengue+2+viral+protease.">Development and utility of an in vitro, fluorescence-based assay for the discovery of novel compounds against dengue 2 viral protease.</a> Tropical Medicine and Health. 44 (1), 1-10 (2016).</li><li>Ong, I. L. H., Yang, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+developments+in+protease+activity+assays+and+sensors.">Recent developments in protease activity assays and sensors.</a> Analyst. 142 (11), 1867-1881 (2017).</li><li>Eltahla, A. A., Lackovic, K., Marquis, C., Eden, J. S., White, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+high-throughput+screen+to+identify+small+compound+inhibitors+of+the+genotype+3a+hepatitis+c+virus+RNA+polymerase.">A fluorescence-based high-throughput screen to identify small compound inhibitors of the genotype 3a hepatitis c virus RNA polymerase.</a> Journal of Biomolecular Screening. 18 (9), 1027-1034 (2013).</li><li>Eydoux, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+high+throughput-screening+assay+for+the+SARS-CoV+RNA+synthesis+complex.">A fluorescence-based high throughput-screening assay for the SARS-CoV RNA synthesis complex.</a> Journal of Virological Methods. 288, 114013 (2021).</li><li>Shimizu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+small+molecule+inhibitor+targeting+dengue+virus+NS5+RNA-dependent+RNA+polymerase.">Discovery of a small molecule inhibitor targeting dengue virus NS5 RNA-dependent RNA polymerase.</a> PLoS Neglected Tropical Diseases. 13 (11), 1-21 (2019).</li><li>S&#225;ez-&#193;lvarez, Y., Arias, A., del &#193;guila, C., Agudo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+fluorescence-based+method+for+the+rapid+determination+of+Zika+virus+polymerase+activity+and+the+screening+of+antiviral+drugs.">Development of a fluorescence-based method for the rapid determination of Zika virus polymerase activity and the screening of antiviral drugs.</a> Scientific Reports. 9 (1), 1-11 (2019).</li><li>Kocabas, F., Turan, R. D., Aslan, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorometric+RdRp+assay+with+self-priming+RNA.">Fluorometric RdRp assay with self-priming RNA.</a> Virus Genes. 50 (3), 498-504 (2015).</li><li>Niyomrattanakit, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+alkaline+phosphatase-coupled+polymerase+assay+for+identification+of+inhibitors+of+dengue+virus+RNA-Dependent+RNA+polymerase.">A fluorescence-based alkaline phosphatase-coupled polymerase assay for identification of inhibitors of dengue virus RNA-Dependent RNA polymerase.</a> Journal of Biomolecular Screening. 16 (2), 201-210 (2011).</li><li>Simeonov, A., Davis, M. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Interference with Fluorescence and Absorbance Flow Chart Fluorescence Interferences. (Md). , 1-8 (2016).</li><li>Genick, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+biophysics+in+high-+Throughput+screening+hit+validation.">Applications of biophysics in high- Throughput screening hit validation.</a> Journal of Biomolecular Screening. 19 (5), 707-714 (2014).</li><li>Smith, T. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identifying+initiation+and+elongation+inhibitors+of+dengue+virus+RNA+polymerase+in+a+high-throughput+lead-finding+campaign.">Identifying initiation and elongation inhibitors of dengue virus RNA polymerase in a high-throughput lead-finding campaign.</a> Journal of Biomolecular Screening. 20 (1), 153-163 (2015).</li><li>Porecha, R., Herschlag, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+radiolabeling.">RNA radiolabeling.</a> Methods in enzymology. 530, 255-279 (2013).</li></ol>

The protocols described herein could be readily adapted for screenings in a 384 or 1536-well formats. For biochemical and/or cell-based screenings performed in HTS format, the Z&#39; factor value, a statistical parameter, is calculate for each plate to ensure the sensitivity, reproducibility and accuracy of those assays12. A Z&#39; factor value of 0.5 or above is expected for replicon-based screenings while a value of 0.7 or above is expected for the NS3 and NS5 activity assays. For the replicon-b...

The Zika virus (ZIKV) is an emerging arthropod-borne virus member of the genus Flavivirus, which includes the closely related Dengue virus (DENV), Japanese encephalitis virus (JEV) and Yellow Fever virus (YFV), that pose constant threats to public health1. The 2015-16 ZIKV outbreak in the Americas received global attention following its emergence in Brazil due to the association with severe neurological disorders, such as congenital ZIKV-associated microcephaly in newborns2,3&#160;and Guillain-Barr&#233; syndrome in adults4. Although the number of infection cases declined throughout the next two years, autochthonous mosquito-borne transmissions of ZIKV were verified in 87 countries and territories in 2019, therefore, evidencing the potential of the virus to re-emerge as an epidemic5. To date, there are no approved vaccines or effective drugs against ZIKV infection.
Antiviral drug discovery requires the development of reliable cellular and biochemical assays that can be performed in high-throughput screening (HTS) formats. Replicon-based screenings and viral enzyme-based assays are two valuable strategies to test small-molecule compounds for inhibitors of ZIKV1. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC)6. The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication6.
Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity7. Herein, we describe the protocols used for screening inhibitors of the ZIKV replication in a 96-well plate format. The replicon-based assays were performed using a BHK-21 ZIKV Rluc replicon cell line that we have recently developed8. To characterize the specific targets of identified compounds, we established in vitro fluorescence-based assays for recombinantly expressed NS3 protease using the fluorogenic peptide substrate, Bz-nKRR-AMC, whereas for NS5 RdRp we measured the elongation of the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;), using the intercalating dye SYBR Green I.
The ZIKV protease (45-96 residues of NS2B cofactor linked to residues 1-177 of NS3 protease domain by a glycine rich linker [G4SG4]) was obtained, as described for YFV9, while the polymerase (276-898 residues of RdRp domain) was cloned and expressed, as detailed in10. Both enzyme sequences were derived from GenBank ALU33341.1. As primary antiviral screenings, compounds are tested at 10 &#181;M and those showing activities &#8805; 80% are then evaluated in a dose-dependent manner, resulting in the effective/inhibition (EC50 or IC50) and the cytotoxic (CC50) concentrations. In the context of representative results, the EC50 and CC50 values of NITD008, a known flaviviruses inhibitor11, from replicon-based screenings are shown. For the enzymatic assays, the IC50 values of two compounds from the MMV/DNDi Pandemic Response Box, a library composed of 400 molecules with antibacterial, antifungal and antiviral activities, are shown. The protocols described in this work could be modified to screen for inhibitors of other related flaviviruses.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5&#39;-biotin-U30- ACUGGAGAUCGAUCUCCAGU -3&#39;</td>
			<td>Dharmacon</td>
			<td>-</td>
			<td>100 ng</td>
		</tr>
		<tr>
			<td>96-well cell culture plates</td>
			<td>KASVI</td>
			<td>K12-096</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well PCR Microplate</td>
			<td>KASVI</td>
			<td>K4-9610</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well White Flat Bottom Polystyrene High Bind Microplate</td>
			<td>Corning</td>
			<td>3922</td>
			<td></td>
		</tr>
		<tr>
			<td>AMC (7-amine-4-methylcoumarine)</td>
			<td>SIGMA-Aldrich</td>
			<td>257370</td>
			<td>100 mg</td>
		</tr>
		<tr>
			<td>Aprotinin from bovine lung</td>
			<td>SIGMA-Aldrich</td>
			<td>A1153</td>
			<td>10 mg</td>
		</tr>
		<tr>
			<td>ATP</td>
			<td>JenaBioscience</td>
			<td>NU-1010-1G</td>
			<td>1 g</td>
		</tr>
		<tr>
			<td>Bz-nKRR-AMC</td>
			<td>International Peptides</td>
			<td>-</td>
			<td>5 mg</td>
		</tr>
		<tr>
			<td>Class II Biohazard Safety Cabinet</td>
			<td>ESCO</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Diethyl pyrocarbonate</td>
			<td>SIGMA-Aldrich</td>
			<td>D5758</td>
			<td>25 mL</td>
		</tr>
		<tr>
			<td>DMSO (Dimethyl sulfoxide)</td>
			<td>SIGMA-Aldrich</td>
			<td>472301</td>
			<td>1 L</td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Modified Eagle Medium</td>
			<td>GIBCO</td>
			<td>3760091</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>GIBCO</td>
			<td>12657-029</td>
			<td>500 mL</td>
		</tr>
		<tr>
			<td>G418</td>
			<td>SIGMA-Aldrich</td>
			<td>A1720</td>
			<td>Disulfate salt</td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>SIGMA-Aldrich</td>
			<td>G5516</td>
			<td>1 L</td>
		</tr>
		<tr>
			<td>HERACELL VIOS 160i CO2 incubator</td>
			<td>Thermo Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>MnCl2 tetrahydrate</td>
			<td>SIGMA-Aldrich</td>
			<td>203734</td>
			<td>25 g</td>
		</tr>
		<tr>
			<td>MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide)</td>
			<td>Invitrogen</td>
			<td>M6494</td>
			<td></td>
		</tr>
		<tr>
			<td>NITD008 &#8805;98% (HPLC)</td>
			<td>Sigma-Aldrich</td>
			<td>SML2409</td>
			<td>5 mg</td>
		</tr>
		<tr>
			<td>qPCR system Mx3000P</td>
			<td>Agilent</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Renilla luciferase Assay System</td>
			<td>PROMEGA</td>
			<td>E2810</td>
			<td></td>
		</tr>
		<tr>
			<td>SpectraMax Gemini EM Fluorescence Reader</td>
			<td>Molecular Devices</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SpectraMax i3 Multi-Mode Detection Platform</td>
			<td>Molecular Devices</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SpectraMax Plus 384 Absorbance Microplate Reader</td>
			<td>Molecular Devices</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green I</td>
			<td>Invitrogen</td>
			<td>S7563</td>
			<td>500 &#181;l</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>SIGMA-Aldrich</td>
			<td>X100</td>
			<td>500 mL</td>
		</tr>
		<tr>
			<td>Trizma base</td>
			<td>SIGMA-Aldrich</td>
			<td>T1503</td>
			<td>1 kg</td>
		</tr>
		<tr>
			<td>Trypsin-EDTA Solution 1X</td>
			<td>SIGMA-Aldrich</td>
			<td>59417-C</td>
			<td>100 mL</td>
		</tr>
	</tbody>
</table>

high-throughput antiviral assays to screen for inhibitors of zika virus replication

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;).

All the protocols described herein were stablished in 96-well plates and allows the evaluation of 80 compounds per plate in a primary screening of a single concentration, including the negative and positive controls placed at the first and last column of the plates, respectively. The replicon-based screenings are represented in Figure 1, which includes the RNA construct developed to obtain the BHK-21-RepZIKV_IRES-Neo cell line (Figure 1A), the assays schematic r...

Watch this Scientific Journal Video about High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication at JoVE.com

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) ...

Research

JoVE Journal

Immunology and Infection

Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus

In response to viral infection, a host develops various defensive responses, such as activating innate immune signaling pathways that lead to antiviral ...

High-throughput Detection Method for Influenza Virus

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

A Protocol for Analyzing Hepatitis C Virus Replication

Hepatitis C Virus (HCV) affects 3% of the world&#8217;s population and causes serious liver ailments including&#160;chronic hepatitis, cirrhosis, and ...

High-throughput Assay to Phenotype Salmonella enterica Typhimurium Association, Invasion, and Replication in Macrophages

High-throughput Assay to Phenotype Salmonella enterica Typhimurium Association, Invasion, and Replication in Macrophages

Salmonella species are zoonotic pathogens and leading causes of food borne illnesses in humans and livestock1. Understanding the mechanisms underlying ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

Using Zebrafish Models of Human Influenza A Virus Infections to Screen Antiviral Drugs and Characterize Host Immune Cell Responses

Each year, seasonal influenza outbreaks profoundly affect societies worldwide. In spite of global efforts, influenza remains an intractable healthcare ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Zika Virus Specific Diagnostic Epitope Discovery

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for ...

A High-throughput Cre-Lox Activated Viral Membrane Fusion Assay to Identify Inhibitors of HIV-1 Viral Membrane Fusion

This assay is designed to specifically report on HIV-1 fusion via the expression of green fluorescent protein (GFP) detectable by flow cytometry or ...