This work was supported by Funda&#231;&#227;o de Amparo &#224; Pesquisa do Estado de S&#227;o Paulo (FAPESP), CEPID grant 2013/07600-3 to GO, grant 2018/05130-3 to RSF and 2016/19712-9 to ASG, and Coordena&#231;&#227;o de Aperfei&#231;oamento de Pessoal de N&#237;vel Superior (grant 88887.516153/2020-00) to ASG. We would like to gratefully thank the Medicine for Malaria Ventures (MMV,&#160;www.mmv.org) and the Drugs for Neglected Diseases initiative (DNDi, www.dndi.org) for their support, design of the Pandemic Response Box and supplying the compounds.

1. Luciferase activity assay
NOTE: Ensure that all procedures involving cell culture are conducted in certified biosafety hoods (see Table of Materials).
<ol>
	<li>Prepare growth media consisting in Dulbecco&#39;s Modi&#64257;ed Eagle&#39;s Medium (DMEM) supplemented with 10% FBS and 500 &#181;g/mL G418.</li>
	<li>Prepare a 10 mM stock solution of tested compounds in 100% DMSO, and then dilute them to 1 mM in 100% DMSO.</li>
	<li>Culture ZIKV Rluc replicon cells in growth media in a 75 cm2 culture flask at 37 &#176;C in a CO2-humidified incubator (see Table of Materials) until they reach 70-90% confluency.</li>
	<li>Discard the medium. Add 5 mL of trypsin-EDTA to the flask for 5 to 10 min and then centrifuge the cells at 125 x g for 5 min.</li>
	<li>Discard the supernatant, resuspend the cells in 5 mL of DMEM 10% FBS and count 10 &#181;L of resuspended cells at a hemocytometer.</li>
	<li>Adjust the cells to 2 x 104 cells/well in DMEM 10% FBS and seed 100 &#181;L of cells per well in a 96-well cell culture plate (see Table of Materials).</li>
	<li>Incubate the plate for 16 h at 37 &#176;C in a CO2-humidified incubator (see Table of Materials).</li>
	<li>Next, discard the medium with a multichannel micropipette and add 100 &#181;L/well of DMEM 2% FBS to the plate.</li>
	<li>Add 1 &#181;L of the compounds per well to result in a final concentration of 10 &#181;M 1% DMSO in assay medium. In the first column, add only 1% DMSO as a no inhibition control and NITD008 in the last column, as a positive control (100% inhibition).</li>
	<li>Incubate the plate for 48 h at 37 &#176;C in a CO2-humidified incubator (see Table of Materials).</li>
	<li>Thaw the Renilla luciferase Assay System kit at room temperature, prepare a 1x Renilla luciferase Lysis Buffer working solution and an appropriate volume of Renilla Luciferase reagent (Assay buffer + substrate; 100 &#181;L per well), according to the manufacturer&#39;s instructions.</li>
	<li>Discard the supernatant from the cells with a multichannel micropipette and add 25 &#181;L of 1x Renilla luciferase Lysis Buffer per well.</li>
	<li>Incubate the plate at room temperature for 15 min and then transfer 20 &#181;L of cell lysates with a multichannel micropipette to a white opaque 96-well plate (see Table of Materials) containing 100 &#181;L/well of Renilla luciferase Assay Reagent.</li>
	<li>Read the luminescent signals in a luminometer or in any equipment that has the option to read luminescence (see Table of Materials).</li>
	<li>For each plate, calculate the Z-factor value 12, as follows: Z&#8242; = 1 - ((3SD of sample + 3SD of control)/&#9474;Mean of sample - Mean of control&#9474;); SD - standard deviation. A Z-factor between 0.5 and 1.0 means a good quality assay 12.</li>
	<li>To determine the EC50 values of compounds, proceed as described in steps 1.3 to 1.8 and then add the compounds serially diluted to the cells , together with the negative (1% DMSO) and positive (NITD008 at 10 &#181;M) controls. Perform the assay twice in duplicates.</li>
	<li>Plot the average values of inhibition rates per compound concentration and use a graph analysis software to perform a sigmoidal fitting and obtain the EC50 values.</li>
</ol>
2. Cell proliferation-based MTT assay
<ol>
	<li>Proceed as described in item 1 steps 1.1 to 1.8.</li>
	<li>Add the compounds initially at 10 &#181;M and the control 1% DMSO to the cells.</li>
	<li>Prepare a 5 mg/mL MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) solution in phosphate buffered saline (PBS - 137 mM NaCl, 2,7 mM KCl, 10 mM Na2HPO4, 1,8 mM KH2PO4; pH 7.4) and vortex until complete solubilization of MTT.</li>
	<li>Add the MTT solution to the cells at one tenth of the well volume (10 &#181;L/well).</li>
	<li>Incubate the plate at 37 &#176;C in a CO2-humidified incubator (see Table of Materials) for 3-4 h.</li>
	<li>Discard the supernatant with a multichannel micropipette and add 100 &#181;L of DMSO (100%) to each well.</li>
	<li>Solubilize the formazan crystals by pipetting up and down and then read the absorbance at 570 nm in a spectrophotometer (see Table of Materials).</li>
	<li>To determine the CC50 values of compounds, proceed as described in item 1 steps 1.1 to 1.8 and then add the compounds serially diluted to the cells, together the negative (1% DMSO) control. Perform the assay twice in duplicates.</li>
	<li>Plot the average values of inhibition rates per compound concentration and use a graph analysis software to perform a sigmoidal fitting and obtain the CC50 values.</li>
</ol>
3. NS2B-NS3 protease activity assay
<ol>
	<li>Thaw a protein aliquot on ice.</li>
	<li>Set the plate reader (see Table of Materials) temperature to 37&#176;C.</li>
	<li>Prepare the appropriated amount of protein diluted to 80 nM (5 &#181;L/well). Final protein concentration is 4 nM.</li>
	<li>Thaw the appropriate amount of Bz-nKRR-AMC substrate on ice (300 &#181;M stock solution diluted in assay buffer, 10 &#181;L/well).</li>
	<li>In a 96-well white plate (see Table of Materials), dispense 84 &#181;L of assay buffer (20 mM Tris pH 8.5, 5% glycerol and 0.01% Triton X-100) in each well.</li>
	<li>To make the positive control reaction, to each well of the last column dispense 1 &#181;L of Aprotinin to achieve final concentration of 1 &#181;M (stock solution 100 &#181;M diluted in water)</li>
	<li>To make the negative control reaction, to the first column dispense 1 &#181;L of DMSO (final concentration 1%).</li>
	<li>To perform the compound screening, dispense 1 &#181;L of each compound to achieve final concentration of 10 &#181;M (1 mM stock concentration) excluding positive and negative control wells.</li>
	<li>Dispense 5 &#181;L of the protease solution.</li>
	<li>Incubate the plate at 4 &#176;C for 30 minutes.</li>
	<li>To start the reaction, dispense 10 &#181;L of Bz-nKRR-AMC stock solution (final concentration of 30 &#181;M).</li>
	<li>Set the excitation wavelength to 380 nm and emission to 460 nm and read the fluorescence for 30 min every 1 min in a microplate reader (see Table of Materials). Perform the entire experiment at 37 &#176;C.</li>
	<li>Calculate the mean values of the fluorescence for positive and negative control reactions. Set as 100% of protease activity the mean value of fluorescence for negative control reactions subtracted of the mean value of positive control and calculate the percentages of activity for each compound.</li>
	<li>For each plate, calculate the Z-factor value, as described in step 1.15.</li>
	<li>Proceed with IC50 determination for compounds that exhibited an inhibition rate higher than 80%.</li>
	<li>Perform the assay in triplicates as described in steps 3.1-3.13, using a serial dilution of the compound.</li>
	<li>Plot the average values of inhibition rates per compound concentration and use a graph analysis software to perform a sigmoidal fitting and obtain the IC50 values.</li>
</ol>
4. NS5 RdRp elongation assay
NOTE: All materials used in this assay are RNase, DNase and pyrogenase free certified.
<ol>
	<li>Prepare both the assay buffer (50 mM Tris pH 7.0, 2.5 mM MnCl2, 0.01% Triton X-100) and the 200 mM ATP stock solution with 0.1% diethylpyrocarbonate (DEPC) treated water.</li>
	<li>Anneal a 5 &#181;L aliquot of 200 &#181;M 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;) in PCR treated water by incubating it for 5 minutes at 55 &#176;C in a thermocycler.</li>
	<li>Thaw the stock solution of NS5 RdRp, 200 mM ATP and x10.000 SYBR Green I on ice.</li>
	<li>Dilute the protein to a final concentration of 250 nM in 3 mL of assay buffer.</li>
	<li>Prepare substrate solution by diluting the stock solutions of the ATP, 3&#39;UTR-U30 and SYBR Green I in 3 mL of assay buffer to a final concentration of 1 mM, 300 nM and 1X, respectively.</li>
	<li>In a 96-well PCR plate (see Table of Materials), add 24.5 &#181;L of diluted protein in columns 1 to 11 of each row. Add the same volume of assay buffer in the remaining wells.</li>
	<li>For control and blank reaction, add 0.5 &#181;L of DMSO in columns 1 and 12. Add 0.5 &#181;L of compound diluted in DMSO to a final concentration of 10 &#181;M 1mM stock solution).</li>
	<li>Seal the plate with a sealing film and incubate at room temperature for 15 minutes.</li>
	<li>Start the reaction by adding 25 &#181;L of substrate solution and seal the plate again.</li>
	<li>Incubate at 30 &#176;C in a real-time PCR system (see Table of Materials) and monitor the fluorescence for 1 hour, measuring the fluorescence every 30 s with the FAM filter (Emission:494 nm/Excitation:521 nm).</li>
	<li>For each plate, calculate the Z-factor value, as described in step 1.15.</li>
	<li>Proceed with IC50 determination for compounds that exhibited an inhibition rate higher than 80%, as described in step 3.15.</li>
	<li>Plot the average values of inhibition rates per compound concentration and use a graph analysis software to perform a sigmoidal fitting and obtain the IC50 values.</li>
</ol>

<ol>
	<li>Zou, J., Shi, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+Zika+drug+discovery.">Strategies for Zika drug discovery.</a> Current Opinion in Virology. 35, 19-26 (2019).</li><li>Cugola, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Brazilian+Zika+virus+strain+causes+birth+defects+in+experimental+models.">The Brazilian Zika virus strain causes birth defects in experimental models.</a> Nature. 534 (7606), 267-271 (2016).</li><li>de Ara&#250;jo, T. V. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Association+between+microcephaly,+Zika+virus+infection,+and+other+risk+factors+in+Brazil:+Final+report+of+a+case-control+study.">Association between microcephaly, Zika virus infection, and other risk factors in Brazil: Final report of a case-control study.</a> The Lancet Infectious Diseases. 18 (3), 328-336 (2018).</li><li>Cao-Lormeau, V. -. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guillain-Barr&#233;+Syndrome+outbreak+associated+with+Zika+virus+infection+in+French+Polynesia:+a+case-control+study.">Guillain-Barr&#233; Syndrome outbreak associated with Zika virus infection in French Polynesia: a case-control study.</a> The Lancet. 387 (10027), 1531-1539 (2016).</li><li>Pielnaa, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus-spread,+epidemiology,+genome,+transmission+cycle,+clinical+manifestation,+associated+challenges,+vaccine+and+antiviral+drug+development.">Zika virus-spread, epidemiology, genome, transmission cycle, clinical manifestation, associated challenges, vaccine and antiviral drug development.</a> Virology. 543, 34-42 (2020).</li><li>Bollati, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+and+functionality+in+flavivirus+NS-proteins:+Perspectives+for+drug+design+Flaviviral+NS3+protein+Flaviviral+NS5+protein+Protease+Helicase+Polymerase+Methyltransferase+Flavivirus+protein+structure+Antivirals+VIZIER+Consortium.">Structure and functionality in flavivirus NS-proteins: Perspectives for drug design Flaviviral NS3 protein Flaviviral NS5 protein Protease Helicase Polymerase Methyltransferase Flavivirus protein structure Antivirals VIZIER Consortium.</a> Antiviral Research. 87, 125-148 (2010).</li><li>Fernandes, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reporter+replicons+for+antiviral+drug+discovery+against+positive+single-stranded+RNA+viruses.">Reporter replicons for antiviral drug discovery against positive single-stranded RNA viruses.</a> Viruses. 12 (6), (2020).</li><li>Fernandes, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+an+imidazonaphthyridine+and+a+riminophenazine+as+potent+anti-Zika+virus+agents+through+a+replicon-based+high-throughput+screening.">Discovery of an imidazonaphthyridine and a riminophenazine as potent anti-Zika virus agents through a replicon-based high-throughput screening.</a> Virus Research. 299, 198388 (2021).</li><li>Noske, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+characterization+and+polymorphism+analysis+of+the+NS2B-NS3+protease+from+the+2017+Brazilian+circulating+strain+of+Yellow+Fever+virus.">Structural characterization and polymorphism analysis of the NS2B-NS3 protease from the 2017 Brazilian circulating strain of Yellow Fever virus.</a> Biochimica et Biophysica Acta - General Subjects. 1864 (4), 129521 (2020).</li><li>Godoy, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Zika+virus+NS5+RNA-dependent+RNA+polymerase.">Crystal structure of Zika virus NS5 RNA-dependent RNA polymerase.</a> Nature Communications. 8, 14764 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+adenosine+nucleoside+inhibitor+of+dengue+virus.">An adenosine nucleoside inhibitor of dengue virus.</a> Proceedings of the National Academy of Sciences. 106 (48), 20435-20439 (2009).</li><li>Zhang, J. H., Chung, T. D. Y., Oldenburg, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+statistical+parameter+for+use+in+evaluation+and+validation+of+high+throughput+screening+assays.">A simple statistical parameter for use in evaluation and validation of high throughput screening assays.</a> Journal of Biomolecular Screening. 4 (2), 67-73 (1999).</li><li>Brecher, M., Zhang, J., Li, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+flavivirus+protease+as+a+target+for+drug+discovery.">The flavivirus protease as a target for drug discovery.</a> Virologica Sinica. 28 (6), 326-336 (2013).</li><li>Noble, C. G., Seh, C. C., Chao, A. T., Shi, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-bound+structures+of+the+dengue+virus+protease+reveal+the+active+conformation.">Ligand-bound structures of the dengue virus protease reveal the active conformation.</a> Journal of Virology. 86 (1), 438-446 (2012).</li><li>Chen, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+activation+and+inhibition+of+Zika+virus+NS2B-NS3+protease.">Mechanisms of activation and inhibition of Zika virus NS2B-NS3 protease.</a> Cell Research. 26 (11), 1260-1263 (2016).</li><li>Eyer, L., Nencka, R., de Clercq, E., Seley-Radtke, K., R&#367;&#382;ek, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleoside+analogs+as+a+rich+source+of+antiviral+agents+active+against+arthropod-borne+flaviviruses.">Nucleoside analogs as a rich source of antiviral agents active against arthropod-borne flaviviruses.</a> Antiviral Chemistry and Chemotherapy. 26, (2018).</li><li>Xie, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus+Replicons+for+Drug+Discovery.">Zika Virus Replicons for Drug Discovery.</a> EBioMedicine. 12, 156-160 (2016).</li><li>Pan, K. L., Lee, J. C., Sung, H. W., Chang, T. Y., Hsu, J. T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+NS3/4A+protease-based+reporter+assay+suitable+for+efficiently+assessing+hepatitis+C+virus+infection.">Development of NS3/4A protease-based reporter assay suitable for efficiently assessing hepatitis C virus infection.</a> Antimicrobial Agents and Chemotherapy. 53 (11), 4825-4834 (2009).</li><li>Khumthong, R., Angsuthanasombat, C., Panyim, S., Katzenmeier, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vitro+Determination+of+Dengue+Virus+Type+2+NS2B-NS3+Protease+Activity+with+Fluorescent+Peptide+Substrates.">In Vitro Determination of Dengue Virus Type 2 NS2B-NS3 Protease Activity with Fluorescent Peptide Substrates.</a> Journal of Biochemistry and Molecular Biology. 35 (2), (2002).</li><li>Ulanday, G. E. L., Okamoto, K., Morita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+utility+of+an+in+vitro,+fluorescence-based+assay+for+the+discovery+of+novel+compounds+against+dengue+2+viral+protease.">Development and utility of an in vitro, fluorescence-based assay for the discovery of novel compounds against dengue 2 viral protease.</a> Tropical Medicine and Health. 44 (1), 1-10 (2016).</li><li>Ong, I. L. H., Yang, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+developments+in+protease+activity+assays+and+sensors.">Recent developments in protease activity assays and sensors.</a> Analyst. 142 (11), 1867-1881 (2017).</li><li>Eltahla, A. A., Lackovic, K., Marquis, C., Eden, J. S., White, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+high-throughput+screen+to+identify+small+compound+inhibitors+of+the+genotype+3a+hepatitis+c+virus+RNA+polymerase.">A fluorescence-based high-throughput screen to identify small compound inhibitors of the genotype 3a hepatitis c virus RNA polymerase.</a> Journal of Biomolecular Screening. 18 (9), 1027-1034 (2013).</li><li>Eydoux, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+high+throughput-screening+assay+for+the+SARS-CoV+RNA+synthesis+complex.">A fluorescence-based high throughput-screening assay for the SARS-CoV RNA synthesis complex.</a> Journal of Virological Methods. 288, 114013 (2021).</li><li>Shimizu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+small+molecule+inhibitor+targeting+dengue+virus+NS5+RNA-dependent+RNA+polymerase.">Discovery of a small molecule inhibitor targeting dengue virus NS5 RNA-dependent RNA polymerase.</a> PLoS Neglected Tropical Diseases. 13 (11), 1-21 (2019).</li><li>S&#225;ez-&#193;lvarez, Y., Arias, A., del &#193;guila, C., Agudo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+fluorescence-based+method+for+the+rapid+determination+of+Zika+virus+polymerase+activity+and+the+screening+of+antiviral+drugs.">Development of a fluorescence-based method for the rapid determination of Zika virus polymerase activity and the screening of antiviral drugs.</a> Scientific Reports. 9 (1), 1-11 (2019).</li><li>Kocabas, F., Turan, R. D., Aslan, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorometric+RdRp+assay+with+self-priming+RNA.">Fluorometric RdRp assay with self-priming RNA.</a> Virus Genes. 50 (3), 498-504 (2015).</li><li>Niyomrattanakit, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+alkaline+phosphatase-coupled+polymerase+assay+for+identification+of+inhibitors+of+dengue+virus+RNA-Dependent+RNA+polymerase.">A fluorescence-based alkaline phosphatase-coupled polymerase assay for identification of inhibitors of dengue virus RNA-Dependent RNA polymerase.</a> Journal of Biomolecular Screening. 16 (2), 201-210 (2011).</li><li>Simeonov, A., Davis, M. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Interference with Fluorescence and Absorbance Flow Chart Fluorescence Interferences. (Md). , 1-8 (2016).</li><li>Genick, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+biophysics+in+high-+Throughput+screening+hit+validation.">Applications of biophysics in high- Throughput screening hit validation.</a> Journal of Biomolecular Screening. 19 (5), 707-714 (2014).</li><li>Smith, T. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identifying+initiation+and+elongation+inhibitors+of+dengue+virus+RNA+polymerase+in+a+high-throughput+lead-finding+campaign.">Identifying initiation and elongation inhibitors of dengue virus RNA polymerase in a high-throughput lead-finding campaign.</a> Journal of Biomolecular Screening. 20 (1), 153-163 (2015).</li><li>Porecha, R., Herschlag, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+radiolabeling.">RNA radiolabeling.</a> Methods in enzymology. 530, 255-279 (2013).</li></ol>

Authors declare no conflict of interest.

The protocols described herein could be readily adapted for screenings in a 384 or 1536-well formats. For biochemical and/or cell-based screenings performed in HTS format, the Z&#39; factor value, a statistical parameter, is calculate for each plate to ensure the sensitivity, reproducibility and accuracy of those assays12. A Z&#39; factor value of 0.5 or above is expected for replicon-based screenings while a value of 0.7 or above is expected for the NS3 and NS5 activity assays. For the replicon-b...

The Zika virus (ZIKV) is an emerging arthropod-borne virus member of the genus Flavivirus, which includes the closely related Dengue virus (DENV), Japanese encephalitis virus (JEV) and Yellow Fever virus (YFV), that pose constant threats to public health1. The 2015-16 ZIKV outbreak in the Americas received global attention following its emergence in Brazil due to the association with severe neurological disorders, such as congenital ZIKV-associated microcephaly in newborns2,3&#160;and Guillain-Barr&#233; syndrome in adults4. Although the number of infection cases declined throughout the next two years, autochthonous mosquito-borne transmissions of ZIKV were verified in 87 countries and territories in 2019, therefore, evidencing the potential of the virus to re-emerge as an epidemic5. To date, there are no approved vaccines or effective drugs against ZIKV infection.
Antiviral drug discovery requires the development of reliable cellular and biochemical assays that can be performed in high-throughput screening (HTS) formats. Replicon-based screenings and viral enzyme-based assays are two valuable strategies to test small-molecule compounds for inhibitors of ZIKV1. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC)6. The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication6.
Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity7. Herein, we describe the protocols used for screening inhibitors of the ZIKV replication in a 96-well plate format. The replicon-based assays were performed using a BHK-21 ZIKV Rluc replicon cell line that we have recently developed8. To characterize the specific targets of identified compounds, we established in vitro fluorescence-based assays for recombinantly expressed NS3 protease using the fluorogenic peptide substrate, Bz-nKRR-AMC, whereas for NS5 RdRp we measured the elongation of the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;), using the intercalating dye SYBR Green I.
The ZIKV protease (45-96 residues of NS2B cofactor linked to residues 1-177 of NS3 protease domain by a glycine rich linker [G4SG4]) was obtained, as described for YFV9, while the polymerase (276-898 residues of RdRp domain) was cloned and expressed, as detailed in10. Both enzyme sequences were derived from GenBank ALU33341.1. As primary antiviral screenings, compounds are tested at 10 &#181;M and those showing activities &#8805; 80% are then evaluated in a dose-dependent manner, resulting in the effective/inhibition (EC50 or IC50) and the cytotoxic (CC50) concentrations. In the context of representative results, the EC50 and CC50 values of NITD008, a known flaviviruses inhibitor11, from replicon-based screenings are shown. For the enzymatic assays, the IC50 values of two compounds from the MMV/DNDi Pandemic Response Box, a library composed of 400 molecules with antibacterial, antifungal and antiviral activities, are shown. The protocols described in this work could be modified to screen for inhibitors of other related flaviviruses.

<table><tbody><tr><td>5&#039;-biotin-U&lt;sub&gt;30-&lt;/sub&gt; ACUGGAGAUCGAUCUCCAGU -3&#039;</td><td>Dharmacon</td><td>-</td><td>100 ng</td></tr><tr><td>96-well cell culture plates</td><td>KASVI</td><td>K12-096</td><td></td></tr><tr><td>96-well PCR Microplate</td><td>KASVI</td><td>K4-9610</td><td></td></tr><tr><td>96-well White Flat Bottom Polystyrene High Bind Microplate</td><td>Corning</td><td>3922</td><td></td></tr><tr><td>AMC (7-amine-4-methylcoumarin)</td><td>SIGMA-Aldrich</td><td>257370</td><td>100 mg</td></tr><tr><td>Aprotinin from bovine lung</td><td>SIGMA-Aldrich</td><td>A1153</td><td>10 mg</td></tr><tr><td>ATP</td><td>JenaBioscience</td><td>NU-1010-1G</td><td>1 g</td></tr><tr><td>Bz-nKRR-AMC</td><td>International Peptides</td><td>-</td><td>5 mg</td></tr><tr><td>Class II Biohazard Safety Cabinet</td><td>ESCO</td><td></td><td></td></tr><tr><td>Diethyl pyrocarbonate</td><td>SIGMA-Aldrich</td><td>D5758</td><td>25 mL</td></tr><tr><td>DMSO (Dimethyl sulfoxide)</td><td>SIGMA-Aldrich</td><td>472301</td><td>1 L</td></tr><tr><td>Dulbecco&amp;rsquo;s Modified Eagle Medium</td><td>GIBCO</td><td>3760091</td><td></td></tr><tr><td>Fetal Bovine Serum</td><td>GIBCO</td><td>12657-029</td><td>500 mL</td></tr><tr><td>G418</td><td>SIGMA-Aldrich</td><td>A1720</td><td>Disulfate salt</td></tr><tr><td>Glycerol</td><td>SIGMA-Aldrich</td><td>G5516</td><td>1 L</td></tr><tr><td>HERACELL VIOS 160i CO2 incubator</td><td>Thermo Scientific</td><td></td><td></td></tr><tr><td>MnCl&lt;sub&gt;2&lt;/sub&gt; tetrahydrate</td><td>SIGMA-Aldrich</td><td>203734</td><td>25 g</td></tr><tr><td>MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide)</td><td>Invitrogen</td><td>M6494</td><td></td></tr><tr><td>NITD008 &amp;ge;98% (HPLC)</td><td>Sigma-Aldrich</td><td>SML2409</td><td>5 mg</td></tr><tr><td>qPCR system Mx3000P</td><td>Agilent</td><td></td><td></td></tr><tr><td>&lt;em&gt;Renilla &lt;/em&gt;luciferase Assay System</td><td>PROMEGA</td><td>E2810</td><td></td></tr><tr><td>SpectraMax Gemini EM Fluorescence Reader</td><td>Molecular Devices</td><td></td><td></td></tr><tr><td>SpectraMax i3 Multi-Mode Detection Platform</td><td>Molecular Devices</td><td></td><td></td></tr><tr><td>SpectraMax Plus 384 Absorbance Microplate Reader</td><td>Molecular Devices</td><td></td><td></td></tr><tr><td>SYBR Green I</td><td>Invitrogen</td><td>S7563</td><td>500 &amp;micro;l</td></tr><tr><td>Triton X-100</td><td>SIGMA-Aldrich</td><td>X100</td><td>500 mL</td></tr><tr><td>Trizma base</td><td>SIGMA-Aldrich</td><td>T1503</td><td>1 kg</td></tr><tr><td>Trypsin-EDTA Solution 1X</td><td>SIGMA-Aldrich</td><td>59417-C</td><td>100 mL</td></tr></tbody></table>

high-throughput antiviral assays to screen for inhibitors of zika virus replication

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;).

All the protocols described herein were stablished in 96-well plates and allows the evaluation of 80 compounds per plate in a primary screening of a single concentration, including the negative and positive controls placed at the first and last column of the plates, respectively. The replicon-based screenings are represented in Figure 1, which includes the RNA construct developed to obtain the BHK-21-RepZIKV_IRES-Neo cell line (Figure 1A), the assays schematic r...

Watch this Scientific Journal Video about High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication at JoVE.com

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) ...

high-throughput-antiviral-assays-to-screen-for-inhibitors-zika-virus

Research

JoVE Journal

Immunology and Infection

3.6K Views.  University of Sao Paulo. In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Video: High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

Multiplexed Isothermal Amplification Based Diagnostic Platform to Detect Zika, Chikungunya, and Dengue 1

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different downstream patient-to-patient transmission potentials, and require very different patient treatments. Thus, recent Zika outbreaks make it urgent to develop tools that rapidly discriminate these viruses in patients and trapped mosquitoes, to select the correct patient treatment, and to understand and manage their epidemiology in real time.
Unfortunately, current diagnostic tests, including those receiving 2016 emergency use authorizations and fast-track status, detect viral RNA by reverse transcription polymerase chain reaction (RT-PCR), which requires instrumentation, trained users, and considerable sample preparation. Thus, they must be sent to &#34;approved&#34; reference laboratories, requiring time. Indeed, in August 2016, the Center for Disease Control (CDC) was asking pregnant women who had been bitten by a mosquito and developed a Zika-indicating rash to wait an unacceptable 2 to 4 weeks before learning whether they were infected. We very much need tests that can be done on site, with few resources, and by trained but not necessarily licensed personnel.
This video demonstrates an assay that meets these specifications, working with urine or serum (for patients) or crushed mosquito carcasses (for environmental surveillance), all without much sample preparation. Mosquito carcasses are captured on paper carrying quaternary ammonium groups (Q-paper) followed by ammonia treatment to manage biohazards. These are then directly, without RNA isolation, put into assay tubes containing freeze-dried reagents that need no chain of refrigeration. A modified form of reverse transcription loop-mediated isothermal amplification with target-specific fluorescently tagged displaceable probes produces readout, in 30 min, as a three-color fluorescence signal. This is visualized with a handheld, battery-powered device with an orange filter. Forward contamination is prevented with sealed tubes, and the use of thermolabile uracil DNA glycosylase (UDG) in the presence of dUTP in the amplification mixture.

Current multiplexed diagnostics to detect Zika, chikungunya, and dengue viruses require complex sample preparation and expensive instrumentation, and are difficult to use in low resource environments. We show a diagnostic that uses isothermal amplification with target-specific strand displaceable probes to detect and differentiate these viruses with high sensitivity and specificity.

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different ...

Biochemistry

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth defects. The goal of this protocol is to quickly detect ZIKV in both human and mosquito samples. The current gold standard for ZIKV detection is quantitative reverse transcription PCR (qRT-PCR); reverse transcription loop-mediated isothermal amplification (RT-LAMP) may allow for a more efficient and low-cost testing without the need for expensive equipment. In this study, RT-LAMP is used for ZIKV detection in various biological samples within 30 min, without first isolating the RNA from the sample. This technique is demonstrated using ZIKV infected patient urine and serum, and infected mosquito samples. 18S ribosomal ribonucleic acid and actin are used as controls in human and mosquito samples, respectively.

Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

This protocol provides an efficient and low-cost method to detect Zika virus or control targets in human urine and serum samples or in mosquitoes by reverse transcription loop-mediated isothermal amplification (RT-LAMP). This method does not require RNA isolation and can be done within 30 min.

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth ...

Genetics

Assays for the Identification of Novel Antivirals against Bluetongue Virus

To identify potential antivirals against BTV, we have developed, optimized and validated three assays presented here. The CPE-based assay was the first assay developed to evaluate whether a compound showed any antiviral efficacy and have been used to screen large compound library. Meanwhile, cytotoxicity of antivirals could also be evaluated using the CPE-based assay. The dose-response assay was designed to determine the range of efficacy for the selected antiviral, i.e. 50% inhibitory concentration (IC50) or effective concentration (EC50), as well as its range of cytotoxicity (CC50). The ToA assay was employed for the initial MoA study to determine the underlying mechanism of the novel antivirals during BTV viral lifecycle or the possible effect on host cellular machinery. These assays are vital for the evaluation of antiviral efficacy in cell culture system, and have been used for our recent researches leading to the identification of a number of novel antivirals against BTV.

Three assays, including the cytopathic effect (CPE)-based assay, dose-response assay and Time-of-Addition (ToA) assay have been developed, optimized, validated and utilized to identify novel antivirals against Bluetongue virus (BTV), as well as to determine the possible Mechanism-of-Action (MoA) for newly identified antivirals.

To identify potential antivirals against BTV, we have  developed, optimized and validated three assays presented here. The CPE-based  assay was the first ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Rapid Screening of HIV Reverse Transcriptase and Integrase Inhibitors

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify new compounds that can inhibit infection by the common drug resistant HIV-1 strains with minimal toxicity. Here we describe an efficient assay that can be used to rapidly determine the cellular cytotoxicity and efficacy of a compound against WT and mutant viral strains.
The desired target cell line is seeded in a 96-well plate and, after a 24 hr incubation, serially dilutions of the compounds to be tested are added. No further manipulations are necessary for cellular cytotoxicity assays; for anti HIV assays a predetermined amount of either a WT or drug resistant HIV-1 vector that expresses luciferase is added to the cells. Cytotoxicity is measured by using an ATP dependent luminescence assay and the impact of the compounds on infectivity is measured by determining the amount of luciferase in the presence or the absence of the putative inhibitors.
This screening assay takes 4 days to complete and multiple compounds can be screened in parallel. Compounds are screened in triplicate and the data are normalized to the infectivity/ATP levels in absence of target compounds. This technique provides a quick and accurate measurement of the efficacy and toxicity of potential anti HIV compounds.

Here we describe cellular cytotoxicity and single round infectivity assays that allow for the rapid and accurate screening of compounds to determine their cellular cytotoxicity (CC50) and IC50 values against WT and drug resistant HIV-1.

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify ...

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Zika Virus Specific Diagnostic Epitope Discovery

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for drug discovery, therapeutic target identification, and developing of diagnostics. Here, we present a protocol to discover specific Zika virus (ZIKV) diagnostic peptides using a high-density peptide microarray. A human serum sample validated for ZIKV infection was incubated with a high-density peptide microarray containing the entire ZIKV protein translated into 3,423 unique 15 linear amino acid (aa) residues with a 14-aa residue overlap printed in duplicate. Staining with different secondary antibodies within the same array, we detected peptides that bind to Immunoglobulin M (IgM) and Immunoglobulin G (IgG) antibodies present in serum. These peptides were selected for further validation experiments. In this protocol, we describe the strategy followed to design, process, and analyze a high-density peptide microarray.

In this protocol, we describe a technique to discover Zika virus specific diagnostic peptides using a high-density peptide microarray. This protocol can readly be adapted for other emerging infectious diseases.

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral load. The purpose of the procedure is to quantify viral titers in peripheral and CNS areas of the mouse at different time points post infection or under different experimental conditions to identify virologic and immunological factors that regulate Zika virus infection. The organ isolation procedures demonstrated allow for both focus forming assay quantification and quantitative PCR assessment of viral titers. The rapid organ isolation techniques are designed for the preservation of virus titer. Viral titer quantification by focus forming assay allows for the rapid throughput assessment of Zika virus. The benefit of the focus forming assay is the assessment of infectious virus, the limitation of this assay is the potential for organ toxicity reducing the limit of detection. Viral titer assessment is combined with quantitative PCR, and using a recombinant RNA copy control viral genome copy number within the organ is assessed with low limit of detection. Overall these techniques provide an accurate rapid high throughput method for the analysis of Zika viral titers in the periphery and CNS of Zika virus infected animals and can be applied to the assessment of viral titers in the organs of animals infected with most pathogens, including Dengue virus.

The goal of the protocol is to demonstrate the techniques used to investigate viral disease by isolating and quantifying Zika virus, from multiple organs in a mouse following infection.

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral ...

Cell-Based Electrical Impedance Platform to Evaluate Zika Virus Inhibitors in Real Time

Cell-based electrical impedance (CEI)&#160;technology measures changes in impedance caused by a growing or manipulated adherent cell monolayer on culture plate wells embedded with electrodes. The technology can be used to monitor the consequences of Zika virus (ZIKV) infection and adherent cell replication in real time, as this virus is highly cytopathogenic. It is a straightforward assay that does not require the use of labels or invasive methods and has the benefit of providing real-time data. The kinetics of ZIKV infection are highly dependent on the employed cell line, virus strain, and multiplicity of infection (MOI), which cannot be easily studied with conventional endpoint assays. Furthermore, the CEI assay can also be used for the evaluation and characterization of antiviral compounds, which can also have dynamic inhibitory properties over the course of infection. This methods article gives a detailed explanation of the practical execution of the CEI assay and its potential applications in ZIKV research and antiviral research in general.

Here, we demonstrate the use of cell-based electrical impedance (CEI) as a very easy and straightforward method to study Zika virus infection and replication in human cells in real time. Furthermore, the CEI assay is useful for the evaluation of antiviral compounds.

Cell-based electrical impedance (CEI)&#160;technology measures changes in impedance caused by a growing or manipulated adherent cell monolayer on culture ...

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

Summary

Explore More Videos

Chapters in this video

Multiplexed Isothermal Amplification Based Diagnostic Platform to Detect Zika, Chikungunya, and Dengue 1

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Assays for the Identification of Novel Antivirals against Bluetongue Virus

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

Rapid Screening of HIV Reverse Transcriptase and Integrase Inhibitors

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus Specific Diagnostic Epitope Discovery

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

Cell-Based Electrical Impedance Platform to Evaluate Zika Virus Inhibitors in Real Time