Name: high-throughput antiviral assays to screen for inhibitors of zika virus replication
Uploaded: 2021-10-30T14:00:00
Description: Watch this Scientific Journal Video about High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication at JoVE.com

This work was supported by Funda&#231;&#227;o de Amparo &#224; Pesquisa do Estado de S&#227;o Paulo (FAPESP), CEPID grant 2013/07600-3 to GO, grant 2018/05130-3 to RSF and 2016/19712-9 to ASG, and Coordena&#231;&#227;o de Aperfei&#231;oamento de Pessoal de N&#237;vel Superior (grant 88887.516153/2020-00) to ASG. We would like to gratefully thank the Medicine for Malaria Ventures (MMV,&#160;www.mmv.org) and the Drugs for Neglected Diseases initiative (DNDi, www.dndi.org) for their support, design of the Pandemic Response Box and supplying the compounds.

1. Luciferase activity assay
NOTE: Ensure that all procedures involving cell culture are conducted in certified biosafety hoods (see Table of Materials).
<ol>
	<li>Prepare growth media consisting in Dulbecco&#39;s Modi&#64257;ed Eagle&#39;s Medium (DMEM) supplemented with 10% FBS and 500 &#181;g/mL G418.</li>
	<li>Prepare a 10 mM stock solution of tested compounds in 100% DMSO, and then dilute them to 1 mM in 100% DMSO.</li>
	<li>Culture ZIKV Rluc r...

<ol>
	<li>Zou, J., Shi, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+Zika+drug+discovery.">Strategies for Zika drug discovery.</a> Current Opinion in Virology. 35, 19-26 (2019).</li><li>Cugola, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Brazilian+Zika+virus+strain+causes+birth+defects+in+experimental+models.">The Brazilian Zika virus strain causes birth defects in experimental models.</a> Nature. 534 (7606), 267-271 (2016).</li><li>de Ara&#250;jo, T. V. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Association+between+microcephaly,+Zika+virus+infection,+and+other+risk+factors+in+Brazil:+Final+report+of+a+case-control+study.">Association between microcephaly, Zika virus infection, and other risk factors in Brazil: Final report of a case-control study.</a> The Lancet Infectious Diseases. 18 (3), 328-336 (2018).</li><li>Cao-Lormeau, V. -. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guillain-Barr&#233;+Syndrome+outbreak+associated+with+Zika+virus+infection+in+French+Polynesia:+a+case-control+study.">Guillain-Barr&#233; Syndrome outbreak associated with Zika virus infection in French Polynesia: a case-control study.</a> The Lancet. 387 (10027), 1531-1539 (2016).</li><li>Pielnaa, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus-spread,+epidemiology,+genome,+transmission+cycle,+clinical+manifestation,+associated+challenges,+vaccine+and+antiviral+drug+development.">Zika virus-spread, epidemiology, genome, transmission cycle, clinical manifestation, associated challenges, vaccine and antiviral drug development.</a> Virology. 543, 34-42 (2020).</li><li>Bollati, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+and+functionality+in+flavivirus+NS-proteins:+Perspectives+for+drug+design+Flaviviral+NS3+protein+Flaviviral+NS5+protein+Protease+Helicase+Polymerase+Methyltransferase+Flavivirus+protein+structure+Antivirals+VIZIER+Consortium.">Structure and functionality in flavivirus NS-proteins: Perspectives for drug design Flaviviral NS3 protein Flaviviral NS5 protein Protease Helicase Polymerase Methyltransferase Flavivirus protein structure Antivirals VIZIER Consortium.</a> Antiviral Research. 87, 125-148 (2010).</li><li>Fernandes, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reporter+replicons+for+antiviral+drug+discovery+against+positive+single-stranded+RNA+viruses.">Reporter replicons for antiviral drug discovery against positive single-stranded RNA viruses.</a> Viruses. 12 (6), (2020).</li><li>Fernandes, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+an+imidazonaphthyridine+and+a+riminophenazine+as+potent+anti-Zika+virus+agents+through+a+replicon-based+high-throughput+screening.">Discovery of an imidazonaphthyridine and a riminophenazine as potent anti-Zika virus agents through a replicon-based high-throughput screening.</a> Virus Research. 299, 198388 (2021).</li><li>Noske, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+characterization+and+polymorphism+analysis+of+the+NS2B-NS3+protease+from+the+2017+Brazilian+circulating+strain+of+Yellow+Fever+virus.">Structural characterization and polymorphism analysis of the NS2B-NS3 protease from the 2017 Brazilian circulating strain of Yellow Fever virus.</a> Biochimica et Biophysica Acta - General Subjects. 1864 (4), 129521 (2020).</li><li>Godoy, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Zika+virus+NS5+RNA-dependent+RNA+polymerase.">Crystal structure of Zika virus NS5 RNA-dependent RNA polymerase.</a> Nature Communications. 8, 14764 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+adenosine+nucleoside+inhibitor+of+dengue+virus.">An adenosine nucleoside inhibitor of dengue virus.</a> Proceedings of the National Academy of Sciences. 106 (48), 20435-20439 (2009).</li><li>Zhang, J. H., Chung, T. D. Y., Oldenburg, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+statistical+parameter+for+use+in+evaluation+and+validation+of+high+throughput+screening+assays.">A simple statistical parameter for use in evaluation and validation of high throughput screening assays.</a> Journal of Biomolecular Screening. 4 (2), 67-73 (1999).</li><li>Brecher, M., Zhang, J., Li, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+flavivirus+protease+as+a+target+for+drug+discovery.">The flavivirus protease as a target for drug discovery.</a> Virologica Sinica. 28 (6), 326-336 (2013).</li><li>Noble, C. G., Seh, C. C., Chao, A. T., Shi, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-bound+structures+of+the+dengue+virus+protease+reveal+the+active+conformation.">Ligand-bound structures of the dengue virus protease reveal the active conformation.</a> Journal of Virology. 86 (1), 438-446 (2012).</li><li>Chen, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+activation+and+inhibition+of+Zika+virus+NS2B-NS3+protease.">Mechanisms of activation and inhibition of Zika virus NS2B-NS3 protease.</a> Cell Research. 26 (11), 1260-1263 (2016).</li><li>Eyer, L., Nencka, R., de Clercq, E., Seley-Radtke, K., R&#367;&#382;ek, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleoside+analogs+as+a+rich+source+of+antiviral+agents+active+against+arthropod-borne+flaviviruses.">Nucleoside analogs as a rich source of antiviral agents active against arthropod-borne flaviviruses.</a> Antiviral Chemistry and Chemotherapy. 26, (2018).</li><li>Xie, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus+Replicons+for+Drug+Discovery.">Zika Virus Replicons for Drug Discovery.</a> EBioMedicine. 12, 156-160 (2016).</li><li>Pan, K. L., Lee, J. C., Sung, H. W., Chang, T. Y., Hsu, J. T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+NS3/4A+protease-based+reporter+assay+suitable+for+efficiently+assessing+hepatitis+C+virus+infection.">Development of NS3/4A protease-based reporter assay suitable for efficiently assessing hepatitis C virus infection.</a> Antimicrobial Agents and Chemotherapy. 53 (11), 4825-4834 (2009).</li><li>Khumthong, R., Angsuthanasombat, C., Panyim, S., Katzenmeier, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vitro+Determination+of+Dengue+Virus+Type+2+NS2B-NS3+Protease+Activity+with+Fluorescent+Peptide+Substrates.">In Vitro Determination of Dengue Virus Type 2 NS2B-NS3 Protease Activity with Fluorescent Peptide Substrates.</a> Journal of Biochemistry and Molecular Biology. 35 (2), (2002).</li><li>Ulanday, G. E. L., Okamoto, K., Morita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+utility+of+an+in+vitro,+fluorescence-based+assay+for+the+discovery+of+novel+compounds+against+dengue+2+viral+protease.">Development and utility of an in vitro, fluorescence-based assay for the discovery of novel compounds against dengue 2 viral protease.</a> Tropical Medicine and Health. 44 (1), 1-10 (2016).</li><li>Ong, I. L. H., Yang, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+developments+in+protease+activity+assays+and+sensors.">Recent developments in protease activity assays and sensors.</a> Analyst. 142 (11), 1867-1881 (2017).</li><li>Eltahla, A. A., Lackovic, K., Marquis, C., Eden, J. S., White, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+high-throughput+screen+to+identify+small+compound+inhibitors+of+the+genotype+3a+hepatitis+c+virus+RNA+polymerase.">A fluorescence-based high-throughput screen to identify small compound inhibitors of the genotype 3a hepatitis c virus RNA polymerase.</a> Journal of Biomolecular Screening. 18 (9), 1027-1034 (2013).</li><li>Eydoux, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+high+throughput-screening+assay+for+the+SARS-CoV+RNA+synthesis+complex.">A fluorescence-based high throughput-screening assay for the SARS-CoV RNA synthesis complex.</a> Journal of Virological Methods. 288, 114013 (2021).</li><li>Shimizu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+small+molecule+inhibitor+targeting+dengue+virus+NS5+RNA-dependent+RNA+polymerase.">Discovery of a small molecule inhibitor targeting dengue virus NS5 RNA-dependent RNA polymerase.</a> PLoS Neglected Tropical Diseases. 13 (11), 1-21 (2019).</li><li>S&#225;ez-&#193;lvarez, Y., Arias, A., del &#193;guila, C., Agudo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+fluorescence-based+method+for+the+rapid+determination+of+Zika+virus+polymerase+activity+and+the+screening+of+antiviral+drugs.">Development of a fluorescence-based method for the rapid determination of Zika virus polymerase activity and the screening of antiviral drugs.</a> Scientific Reports. 9 (1), 1-11 (2019).</li><li>Kocabas, F., Turan, R. D., Aslan, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorometric+RdRp+assay+with+self-priming+RNA.">Fluorometric RdRp assay with self-priming RNA.</a> Virus Genes. 50 (3), 498-504 (2015).</li><li>Niyomrattanakit, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+alkaline+phosphatase-coupled+polymerase+assay+for+identification+of+inhibitors+of+dengue+virus+RNA-Dependent+RNA+polymerase.">A fluorescence-based alkaline phosphatase-coupled polymerase assay for identification of inhibitors of dengue virus RNA-Dependent RNA polymerase.</a> Journal of Biomolecular Screening. 16 (2), 201-210 (2011).</li><li>Simeonov, A., Davis, M. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Interference with Fluorescence and Absorbance Flow Chart Fluorescence Interferences. (Md). , 1-8 (2016).</li><li>Genick, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+biophysics+in+high-+Throughput+screening+hit+validation.">Applications of biophysics in high- Throughput screening hit validation.</a> Journal of Biomolecular Screening. 19 (5), 707-714 (2014).</li><li>Smith, T. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identifying+initiation+and+elongation+inhibitors+of+dengue+virus+RNA+polymerase+in+a+high-throughput+lead-finding+campaign.">Identifying initiation and elongation inhibitors of dengue virus RNA polymerase in a high-throughput lead-finding campaign.</a> Journal of Biomolecular Screening. 20 (1), 153-163 (2015).</li><li>Porecha, R., Herschlag, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+radiolabeling.">RNA radiolabeling.</a> Methods in enzymology. 530, 255-279 (2013).</li></ol>

The protocols described herein could be readily adapted for screenings in a 384 or 1536-well formats. For biochemical and/or cell-based screenings performed in HTS format, the Z&#39; factor value, a statistical parameter, is calculate for each plate to ensure the sensitivity, reproducibility and accuracy of those assays12. A Z&#39; factor value of 0.5 or above is expected for replicon-based screenings while a value of 0.7 or above is expected for the NS3 and NS5 activity assays. For the replicon-b...

The Zika virus (ZIKV) is an emerging arthropod-borne virus member of the genus Flavivirus, which includes the closely related Dengue virus (DENV), Japanese encephalitis virus (JEV) and Yellow Fever virus (YFV), that pose constant threats to public health1. The 2015-16 ZIKV outbreak in the Americas received global attention following its emergence in Brazil due to the association with severe neurological disorders, such as congenital ZIKV-associated microcephaly in newborns2,3&#160;and Guillain-Barr&#233; syndrome in adults4. Although the number of infection cases declined throughout the next two years, autochthonous mosquito-borne transmissions of ZIKV were verified in 87 countries and territories in 2019, therefore, evidencing the potential of the virus to re-emerge as an epidemic5. To date, there are no approved vaccines or effective drugs against ZIKV infection.
Antiviral drug discovery requires the development of reliable cellular and biochemical assays that can be performed in high-throughput screening (HTS) formats. Replicon-based screenings and viral enzyme-based assays are two valuable strategies to test small-molecule compounds for inhibitors of ZIKV1. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC)6. The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication6.
Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity7. Herein, we describe the protocols used for screening inhibitors of the ZIKV replication in a 96-well plate format. The replicon-based assays were performed using a BHK-21 ZIKV Rluc replicon cell line that we have recently developed8. To characterize the specific targets of identified compounds, we established in vitro fluorescence-based assays for recombinantly expressed NS3 protease using the fluorogenic peptide substrate, Bz-nKRR-AMC, whereas for NS5 RdRp we measured the elongation of the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;), using the intercalating dye SYBR Green I.
The ZIKV protease (45-96 residues of NS2B cofactor linked to residues 1-177 of NS3 protease domain by a glycine rich linker [G4SG4]) was obtained, as described for YFV9, while the polymerase (276-898 residues of RdRp domain) was cloned and expressed, as detailed in10. Both enzyme sequences were derived from GenBank ALU33341.1. As primary antiviral screenings, compounds are tested at 10 &#181;M and those showing activities &#8805; 80% are then evaluated in a dose-dependent manner, resulting in the effective/inhibition (EC50 or IC50) and the cytotoxic (CC50) concentrations. In the context of representative results, the EC50 and CC50 values of NITD008, a known flaviviruses inhibitor11, from replicon-based screenings are shown. For the enzymatic assays, the IC50 values of two compounds from the MMV/DNDi Pandemic Response Box, a library composed of 400 molecules with antibacterial, antifungal and antiviral activities, are shown. The protocols described in this work could be modified to screen for inhibitors of other related flaviviruses.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5&#39;-biotin-U30- ACUGGAGAUCGAUCUCCAGU -3&#39;</td>
			<td>Dharmacon</td>
			<td>-</td>
			<td>100 ng</td>
		</tr>
		<tr>
			<td>96-well cell culture plates</td>
			<td>KASVI</td>
			<td>K12-096</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well PCR Microplate</td>
			<td>KASVI</td>
			<td>K4-9610</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well White Flat Bottom Polystyrene High Bind Microplate</td>
			<td>Corning</td>
			<td>3922</td>
			<td></td>
		</tr>
		<tr>
			<td>AMC (7-amine-4-methylcoumarine)</td>
			<td>SIGMA-Aldrich</td>
			<td>257370</td>
			<td>100 mg</td>
		</tr>
		<tr>
			<td>Aprotinin from bovine lung</td>
			<td>SIGMA-Aldrich</td>
			<td>A1153</td>
			<td>10 mg</td>
		</tr>
		<tr>
			<td>ATP</td>
			<td>JenaBioscience</td>
			<td>NU-1010-1G</td>
			<td>1 g</td>
		</tr>
		<tr>
			<td>Bz-nKRR-AMC</td>
			<td>International Peptides</td>
			<td>-</td>
			<td>5 mg</td>
		</tr>
		<tr>
			<td>Class II Biohazard Safety Cabinet</td>
			<td>ESCO</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Diethyl pyrocarbonate</td>
			<td>SIGMA-Aldrich</td>
			<td>D5758</td>
			<td>25 mL</td>
		</tr>
		<tr>
			<td>DMSO (Dimethyl sulfoxide)</td>
			<td>SIGMA-Aldrich</td>
			<td>472301</td>
			<td>1 L</td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Modified Eagle Medium</td>
			<td>GIBCO</td>
			<td>3760091</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>GIBCO</td>
			<td>12657-029</td>
			<td>500 mL</td>
		</tr>
		<tr>
			<td>G418</td>
			<td>SIGMA-Aldrich</td>
			<td>A1720</td>
			<td>Disulfate salt</td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>SIGMA-Aldrich</td>
			<td>G5516</td>
			<td>1 L</td>
		</tr>
		<tr>
			<td>HERACELL VIOS 160i CO2 incubator</td>
			<td>Thermo Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>MnCl2 tetrahydrate</td>
			<td>SIGMA-Aldrich</td>
			<td>203734</td>
			<td>25 g</td>
		</tr>
		<tr>
			<td>MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide)</td>
			<td>Invitrogen</td>
			<td>M6494</td>
			<td></td>
		</tr>
		<tr>
			<td>NITD008 &#8805;98% (HPLC)</td>
			<td>Sigma-Aldrich</td>
			<td>SML2409</td>
			<td>5 mg</td>
		</tr>
		<tr>
			<td>qPCR system Mx3000P</td>
			<td>Agilent</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Renilla luciferase Assay System</td>
			<td>PROMEGA</td>
			<td>E2810</td>
			<td></td>
		</tr>
		<tr>
			<td>SpectraMax Gemini EM Fluorescence Reader</td>
			<td>Molecular Devices</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SpectraMax i3 Multi-Mode Detection Platform</td>
			<td>Molecular Devices</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SpectraMax Plus 384 Absorbance Microplate Reader</td>
			<td>Molecular Devices</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green I</td>
			<td>Invitrogen</td>
			<td>S7563</td>
			<td>500 &#181;l</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>SIGMA-Aldrich</td>
			<td>X100</td>
			<td>500 mL</td>
		</tr>
		<tr>
			<td>Trizma base</td>
			<td>SIGMA-Aldrich</td>
			<td>T1503</td>
			<td>1 kg</td>
		</tr>
		<tr>
			<td>Trypsin-EDTA Solution 1X</td>
			<td>SIGMA-Aldrich</td>
			<td>59417-C</td>
			<td>100 mL</td>
		</tr>
	</tbody>
</table>

high-throughput antiviral assays to screen for inhibitors of zika virus replication

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;).

All the protocols described herein were stablished in 96-well plates and allows the evaluation of 80 compounds per plate in a primary screening of a single concentration, including the negative and positive controls placed at the first and last column of the plates, respectively. The replicon-based screenings are represented in Figure 1, which includes the RNA construct developed to obtain the BHK-21-RepZIKV_IRES-Neo cell line (Figure 1A), the assays schematic r...

Watch this Scientific Journal Video about High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication at JoVE.com

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) ...

The overall goal of these procedures is to screen for inhibitors of Zika virus replication in a high-throughput screening format, using a replicon-based and/or a viral enzyme-based assays. Antiviral drug discovery requires the development of reliable cellular and biochemical assays that can be performed in high-throughput screening formats. Replicon-based screenings and viral enzyme-based assays are two valuable strategies to test small molecule compounds as inhibitors of Zika virus.Replicons are self-replicating subgenomic systems expressed in mammalian cells in which the viral structural genes are replaced by a reporter gene. In our lab, we developed a Zika virus replicon system, including the Renilla luciferase, which is stably expressed in baby hamster BHK-21 cell lines. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the luciferase activity.To characterize the specific targets of identified compounds, we established in vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RNA-dependent RNA polymerase, the RdRp. Start by culturing Zika viral replicon cells until they reach 70 to 90 percent confluence. In a sterile laminar flow, remove and discard the media from the flask.Add five mils of trypsin-EDTA to the flask. Spread the trypsin solution over the cells and leave the flask for five to 10 minutes for cells to detach. Harvest the resuspended cells and place it in the sterile 50 mil tube and centrifuge it for 125G during five minutes.After discarding the supernatant, resuspend the cells in five mils of DMEM 10%FBS for counting. Adjust the cells to two times 10 to four per well and seed them in a 96-well plate. Then incubate the plate for 16 hours at 37 celsius in a CO2 humidifier incubator.Next discard the medium and add 100 microliters per well of DMEM 2%FBS. Add one microliter of the compound per well to result in a final concentration of 10 micromolar and 1%DMSO in the assay medium. In the first and in the last column, prepare the positive and negative control.Incubate the plate for 48 hours at 37 celsius in a CO2 humidifier incubator. Prepare Renilla luciferase lysis buffer in reagent according to the manufacture instructions. After discarding the supernatant from the cells add 25 microliters of Renilla luciferase lyse buffer per well.Add 100 microliters of Renilla luciferase assay reagent per well to a white opaque 96-well plate. Transfer 20 microliters of the cell lysate to the white plate and then read the luminescence signals in luminometer. For the MTT assay, procedure has previously demonstrated and after compound incubation add 10 microliters per well of MTT solution to the cells and incubate the plate at 37 celsius in a CO2 humidifier for 24 hours.Discard the supernatant and add 100 microliters of DMSO to each well, and then solubilize the formazan crystals by pipetting up and down. Read the absorbents at 570 nanometers in a spectrophotometer. After thawing materials on ice, prepare an appropriate amount of protein dilution to reach a final concentration of four nanomolar per well.In a 96-well white plate, dispense 84 microliters of the assay buffer in each well. To prepare a control reaction, add one microliter of DMSO to the first column of the plate. Add one microliter of the tested compounds to reach a final concentration of 10 micromolar to the plate.Dispense five microliters per well of protease solution, excluding controls and incubate the plate at four celsius for 30 minutes. To start the reaction, dispense 10 microliters of fluorogenic substrate stock solution to the wells. Follow their reaction using a fluorometer set in appropriate parameters.For this session, all reagents must be prepared with DEPC treated water. Anneal the polyuridine RNA by incubating it at 55 Celsius for five minutes in a thermal cycler. Thaw materials on ice and dilute the protein to reach a final concentration of 250 nanomolar in the assay buffer.Prepare the SYBR Green I solution assay buffer, and then add ATP and the anealed RNA to a final concentration of one millimolar and 300 nanomolar, respectively. In a PCR plate, add 24.5 microliters of the diluted protein in columns one to 11. Add the same volume of the assay buffer in the remaining wells.Add 0.5 microliters per well of compounds and controls to reach a final concentration of 10 micromolar. After 15 minutes incubation, start the reaction by adding 25 microliters of the substrate solution and seal the plate. Follow the reaction in a real-time PCR system incubated at 30 Celsius using a FAM filter.In figure 1A, we see a schematic representation of the RNA construct developed to obtain Zika viral replicon cell lines, showing that Rluc gene replacing the structural sequences and the IRES new cassette inserted at 3'end. It also includes a T7 promoter in the hepatitis delta virus ribozyme sequence for in vitro transcription and for generation of the authentic 3'end and the RNA transcript, respectively. In figure 1B, we see a schematic representation of the replicon-based cell assay.In figure 1C, we see the dose-response curves and the cytotoxicity curves of a given compound obtained using the Rluc replicon system. In figure 2A, we see an schematic representation of the assay used to determine the activity of the NS2B-NS3 protease. In figure 2B, we see the dose-response curve of a given inhibitor targeting the NS2B-NS3 protease.In figure 2C, we see an schematic representation of the elongation assay used to determine the NS5 RdRp activity. In figure 2D, we see the dose-response group of a given inhibitor targeting the Zika virus RdRp activity. The demonstrated procedures could be readily adapted for screenings in a 384 or 1, 536-well formats.For the replicon-based high-throughput screenings, we developed a stable cell line harboring a replicative Zika virus replicon containing a Renilla luciferase sequence at the 5'end, and also a neomycin phosphotransferase gene driven by an internal ribosomal entry site at the 3'end. Due to the lack of structural genes, replicons do not produce progeny virions. Thus, eliminating the risk of laboratory acquired viral infection.In addition, we also demonstrated the procedures used in viral enzyme-based assays for the recombinant NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using a fluorogenic peptide substrate, which contains the Zika virus protease recognition and cleavage sequences coupled with the fluorescence stock aminomethylcoumarin. Regarding the NS5 RNA-dependent RNA polymerase, its elongation activity is directly detected by the increase of the fluorescent signal of SYBR Green I.These implementation, direct measurement, and affordability are key points to the user's florescence-based methods as high-throughput screening platforms.

high-throughput-antiviral-assays-to-screen-for-inhibitors-zika-virus

Research

JoVE Journal

Immunology and Infection

Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus

In response to viral infection, a host develops various defensive responses, such as activating innate immune signaling pathways that lead to antiviral cytokine production1,2. In order to colonize the host, viruses are obligate to evade host antiviral responses and manipulate signaling pathways. Unraveling the host-virus interaction will shed light on the development of novel therapeutic strategies against viral infection.
Murine &gamma;HV68 is closely related to human oncogenic Kaposi's sarcoma-associated herpesvirus and Epsten-Barr virus3,4. &gamma;HV68 infection in laboratory mice provides a tractable small animal model to examine the entire course of host responses and viral infection in vivo, which are not available for human herpesviruses. In this protocol, we present a panel of methods for phenotypic characterization and molecular dissection of host signaling components in &gamma;HV68 lytic replication both in vivo and ex vivo. The availability of genetically modified mouse strains permits the interrogation of the roles of host signaling pathways during &gamma;HV68 acute infection in vivo. Additionally, mouse embryonic fibroblasts (MEFs) isolated from these deficient mouse strains can be used to further dissect roles of these molecules during &gamma;HV68 lytic replication ex vivo.
Using virological and molecular biology assays, we can pinpoint the molecular mechanism of host-virus interactions and identify host and viral genes essential for viral lytic replication. Finally, a bacterial artificial chromosome (BAC) system facilitates the introduction of mutations into the viral factor(s) that specifically interrupt the host-virus interaction. Recombinant &gamma;HV68 carrying these mutations can be used to recapitulate the phenotypes of &gamma;HV68 lytic replication in MEFs deficient in key host signaling components. This protocol offers an excellent strategy to interrogate host-pathogen interaction at multiple levels of intervention in vivo and ex vivo.
Recently, we have discovered that &gamma;HV68 usurps an innate immune signaling pathway to promote viral lytic replication5. Specifically, &gamma;HV68 de novo infection activates the immune kinase IKK&beta; and activated IKK&beta; phosphorylates the master viral transcription factor, replication and transactivator (RTA), to promote viral transcriptional activation. In doing so, &gamma;HV68 efficiently couples its transcriptional activation to host innate immune activation, thereby facilitating viral transcription and lytic replication. This study provides an excellent example that can be applied to other viruses to interrogate host-virus interaction.

We describe a protocol to identify key roles of host signaling molecules in lytic replication of a model herpesvirus, gamma herpesvirus 68 (&gamma;HV68). Utilizing genetically modified mouse strains and embryonic fibroblasts for &gamma;HV68 lytic replication, the protocol permits both phenotypic characterization and molecular interrogation of virus-host interactions in viral lytic replication.

In response to viral infection, a host develops various defensive responses, such as activating innate immune signaling pathways that lead to antiviral ...

High-throughput Detection Method for Influenza Virus

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, precise diagnosis of the infecting strain and rapid high-throughput screening of vast numbers of clinical samples is paramount to control the spread of pandemic infections. Current clinical diagnoses of influenza infections are based on serologic testing, polymerase chain reaction, direct specimen immunofluorescence and cell culture 1,2.
Here, we report the development of a novel diagnostic technique used to detect live influenza viruses. We used the mouse-adapted human A/PR/8/34 (PR8, H1N1) virus 3 to test the efficacy of this technique using MDCK cells 4. MDCK cells (104 or 5 x 103 per well) were cultured in 96- or 384-well plates, infected with PR8 and viral proteins were detected using anti-M2 followed by an IR dye-conjugated secondary antibody. M2 5 and hemagglutinin 1 are two major marker proteins used in many different diagnostic assays. Employing IR-dye-conjugated secondary antibodies minimized the autofluorescence associated with other fluorescent dyes. The use of anti-M2 antibody allowed us to use the antigen-specific fluorescence intensity as a direct metric of viral quantity. To enumerate the fluorescence intensity, we used the LI-COR Odyssey-based IR scanner. This system uses two channel laser-based IR detections to identify fluorophores and differentiate them from background noise. The first channel excites at 680 nm and emits at 700 nm to help quantify the background. The second channel detects fluorophores that excite at 780 nm and emit at 800 nm. Scanning of PR8-infected MDCK cells in the IR scanner indicated a viral titer-dependent bright fluorescence. A positive correlation of fluorescence intensity to virus titer starting from 102-105 PFU could be consistently observed. Minimal but detectable positivity consistently seen with 102-103 PFU PR8 viral titers demonstrated the high sensitivity of the near-IR dyes. The signal-to-noise ratio was determined by comparing the mock-infected or isotype antibody-treated MDCK cells.
Using the fluorescence intensities from 96- or 384-well plate formats, we constructed standard titration curves. In these calculations, the first variable is the viral titer while the second variable is the fluorescence intensity. Therefore, we used the exponential distribution to generate a curve-fit to determine the polynomial relationship between the viral titers and fluorescence intensities. Collectively, we conclude that IR dye-based protein detection system can help diagnose infecting viral strains and precisely enumerate the titer of the infecting pathogens.

This method describes the use of Infrared dye based imaging system for detection of H1N1 in bronchioalveolar lavage (BAL) fluid of infected mice at a high sensitivity. This methodology can be performed in a 96- or 384-well plate, requires &lt;10 &mu;l volume of test material and has the potential for concurrent screening of multiple pathogens.

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

A Protocol for Analyzing Hepatitis C Virus Replication

Hepatitis C Virus (HCV) affects 3% of the world&#8217;s population and causes serious liver ailments including&#160;chronic hepatitis, cirrhosis, and hepatocellular carcinoma. HCV is an enveloped RNA virus belonging to the family Flaviviridae. Current treatment is not fully effective and causes adverse side effects. There is no HCV vaccine available. Thus, continued effort is required for developing a vaccine and better therapy. An HCV cell culture system is critical for studying various stages of HCV growth including viral entry, genome replication, packaging, and egress. In the current procedure presented, we used a wild-type intragenotype 2a chimeric virus, FNX-HCV, and a recombinant FNX-Rluc virus carrying a Renilla luciferase reporter gene to study the virus replication. A human hepatoma cell line (Huh-7 based) was used for transfection of in vitro transcribed HCV genomic RNAs. Cell-free culture supernatants, protein lysates and total RNA were harvested at various time points post-transfection to assess HCV growth. HCV genome replication status was evaluated by quantitative RT-PCR and visualizing the presence of HCV double-stranded RNA. The HCV protein expression was verified by Western blot and immunofluorescence assays using antibodies specific for HCV NS3 and NS5A proteins. HCV RNA transfected cells released infectious particles into culture supernatant and the viral titer was measured. Luciferase assays were utilized to assess the replication level and infectivity of reporter HCV. In conclusion, we present various virological assays for characterizing different stages of the HCV replication cycle.

Hepatitis C Virus (HCV) is a major human pathogen that causes liver disorders, including cirrhosis and cancer. An HCV infectious cell culture system is essential for understanding the molecular mechanism of HCV replication and developing new therapeutic approaches. Here we describe a protocol to investigate various stages of the HCV replication cycle.

Hepatitis C Virus (HCV) affects 3% of the world&#8217;s population and causes serious liver ailments including&#160;chronic hepatitis, cirrhosis, and ...

High-throughput Assay to Phenotype Salmonella enterica Typhimurium Association, Invasion, and Replication in Macrophages

Salmonella species are zoonotic pathogens and leading causes of food borne illnesses in humans and livestock1. Understanding the mechanisms underlying Salmonella-host interactions are&#160;important to elucidate the molecular pathogenesis of Salmonella infection. The Gentamicin protection assay to phenotype Salmonella association, invasion and replication in phagocytic cells was adapted to allow high-throughput screening to define the roles of deletion mutants of Salmonella enterica serotype Typhimurium in host interactions using RAW 264.7 murine macrophages. Under this protocol, the variance in measurements is significantly reduced compared to the standard protocol, because wild-type and multiple mutant strains can be tested in the same culture dish and at the same time. The use of multichannel pipettes increases the throughput and enhances precision. Furthermore, concerns related to using less host cells per well in 96-well culture dish were addressed. Here, the protocol of the modified in vitro Salmonella invasion assay using phagocytic cells was successfully employed to phenotype 38 individual Salmonella deletion mutants for association, invasion and intracellular replication. The in vitro phenotypes are presented, some of which were subsequently confirmed to have in vivo phenotypes in an animal model. Thus, the modified, standardized assay to phenotype Salmonella association, invasion and replication in macrophages with high-throughput capacity could be utilized more broadly to study bacterial-host interactions.

High-throughput Assay to Phenotype Salmonella enterica Typhimurium Association, Invasion, and Replication in Macrophages

A high-throughput assay to in vitro phenotype Salmonella or other bacterial association, invasion, and replication in phagocytic cells with high-throughput capacity was developed. The method was employed to evaluate Salmonella gene knockout mutant strains for their involvements in host-pathogen interactions.

Salmonella species are zoonotic pathogens and leading causes of food borne illnesses in humans and livestock1. Understanding the mechanisms underlying ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic approach to identify and evaluate antiviral agents that target specific steps of the viral entry. In this report, the methods of examining viral inactivation, viral attachment, and viral entry/fusion as antiviral assays for such purposes are described, using hepatitis C virus as a model. These assays should be useful for discovering novel antagonists/inhibitors to early viral entry and help expand the scope of candidate antiviral agents for further drug development.

Here, we present a protocol that examines specific steps of the viral entry to identify and evaluate novel antiviral agents.

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

Using Zebrafish Models of Human Influenza A Virus Infections to Screen Antiviral Drugs and Characterize Host Immune Cell Responses

Each year, seasonal influenza outbreaks profoundly affect societies worldwide. In spite of global efforts, influenza remains an intractable healthcare burden. The principle strategy to curtail infections is yearly vaccination. In individuals who have contracted influenza, antiviral drugs can mitigate symptoms. There is a clear and unmet need to develop alternative strategies to combat influenza. Several animal models have been created to model host-influenza interactions. Here, protocols for generating zebrafish models for systemic and localized human influenza A virus (IAV) infection are described. Using a systemic IAV infection model, small molecules with potential antiviral activity can be screened. As a proof-of-principle, a protocol that demonstrates the efficacy of the antiviral drug Zanamivir in IAV-infected zebrafish is described. It shows how disease phenotypes can be quantified to score the relative efficacy of potential antivirals in IAV-infected zebrafish. In recent years, there has been increased appreciation for the critical role neutrophils play in the human host response to influenza infection. The zebrafish has proven to be an indispensable model for the study of neutrophil biology, with direct impacts on human medicine. A protocol to generate a localized IAV infection in the Tg(mpx:mCherry) zebrafish line to study neutrophil biology in the context of a localized viral infection is described. Neutrophil recruitment to localized infection sites provides an additional quantifiable phenotype for assessing experimental manipulations that may have therapeutic applications. Both zebrafish protocols described faithfully recapitulate aspects of human IAV infection. The zebrafish model possesses numerous inherent advantages, including high fecundity, optical clarity, amenability to drug screening, and availability of transgenic lines, including those in which immune cells such as neutrophils are labeled with fluorescent proteins. The protocols detailed here exploit these advantages and have the potential to reveal critical insights into host-IAV interactions that may ultimately translate into the clinic.

Systemic and localized zebrafish infection models for human influenza A virus are demonstrated. Using a systemic infection model, zebrafish can be used to screen antiviral drugs. Using a localized infection model, zebrafish can be used to characterize host immune cell responses.

Each year, seasonal influenza outbreaks profoundly affect societies worldwide. In spite of global efforts, influenza remains an intractable healthcare ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral evolution. Here we describe the construction of an infectious clone for Zika virus (ZIKV), which is currently causing an explosive outbreak in the Americas. To prevent toxicity to bacteria that is commonly observed with flavivirus-derived plasmids, we generated a two-plasmid system which separates the genome at the NS1 gene and is more stable than full-length constructs that could not be successfully recovered without mutations. After digestion and ligation to join the two fragments, full-length viral RNA can be generated by in vitro transcription with T7 RNA polymerase. Following electroporation of transcribed RNA into cells, virus was recovered that exhibited similar in vitro growth kinetics and in vivo virulence and infection phenotypes in mice and mosquitoes, respectively.

This protocol describes the recovery of infectious Zika virus from a two-plasmid infectious cDNA clone.

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Zika Virus Specific Diagnostic Epitope Discovery

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for drug discovery, therapeutic target identification, and developing of diagnostics. Here, we present a protocol to discover specific Zika virus (ZIKV) diagnostic peptides using a high-density peptide microarray. A human serum sample validated for ZIKV infection was incubated with a high-density peptide microarray containing the entire ZIKV protein translated into 3,423 unique 15 linear amino acid (aa) residues with a 14-aa residue overlap printed in duplicate. Staining with different secondary antibodies within the same array, we detected peptides that bind to Immunoglobulin M (IgM) and Immunoglobulin G (IgG) antibodies present in serum. These peptides were selected for further validation experiments. In this protocol, we describe the strategy followed to design, process, and analyze a high-density peptide microarray.

In this protocol, we describe a technique to discover Zika virus specific diagnostic peptides using a high-density peptide microarray. This protocol can readly be adapted for other emerging infectious diseases.

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for ...

A High-throughput Cre-Lox Activated Viral Membrane Fusion Assay to Identify Inhibitors of HIV-1 Viral Membrane Fusion

This assay is designed to specifically report on HIV-1 fusion via the expression of green fluorescent protein (GFP) detectable by flow cytometry or fluorescence microscopy. An HIV-1 reporter virus (HIV-1 Gag-iCre) is generated by inserting Cre recombinase into the HIV-1 genome between the matrix and the capsid proteins of the Gag polyprotein. This results in a packaging of Cre recombinase into virus particles, which is then released into a target cell line stably expressing a Cre recombinase-activated red fluorescent protein (RFP) to GFP switch cassette. In the basal state, this cassette expresses RFP only. Following the delivery of Cre recombinase into the target cell, the RFP, flanked by loxP sites, excises, resulting in GFP expression. This assay can be used to test any inhibitors of viral entry (specifically at the fusion step) in cell-free and cell-to-cell infection systems and has been used to identify a class of purinergic receptor antagonists as novel inhibitors of HIV-1 viral membrane fusion.

We describe a cell-based assay to report on HIV-1 fusion via the expression of green fluorescent protein detectable by flow cytometry or fluorescence microscopy. It can be used to test inhibitors of viral entry (specifically at the fusion step) in cell-free and cell-to-cell infection systems.

This assay is designed to specifically report on HIV-1 fusion via the expression of green fluorescent protein (GFP) detectable by flow cytometry or ...