This work was supported by Funda&#231;&#227;o de Amparo &#224; Pesquisa do Estado de S&#227;o Paulo (FAPESP), CEPID grant 2013/07600-3 to GO, grant 2018/05130-3 to RSF and 2016/19712-9 to ASG, and Coordena&#231;&#227;o de Aperfei&#231;oamento de Pessoal de N&#237;vel Superior (grant 88887.516153/2020-00) to ASG. We would like to gratefully thank the Medicine for Malaria Ventures (MMV,&#160;www.mmv.org) and the Drugs for Neglected Diseases initiative (DNDi, www.dndi.org) for their support, design of the Pandemic Response Box and supplying the compounds.

1. Luciferase activity assay
NOTE: Ensure that all procedures involving cell culture are conducted in certified biosafety hoods (see Table of Materials).
<ol>
	<li>Prepare growth media consisting in Dulbecco&#39;s Modi&#64257;ed Eagle&#39;s Medium (DMEM) supplemented with 10% FBS and 500 &#181;g/mL G418.</li>
	<li>Prepare a 10 mM stock solution of tested compounds in 100% DMSO, and then dilute them to 1 mM in 100% DMSO.</li>
	<li>Culture ZIKV Rluc r...

<ol>
	<li>Zou, J., Shi, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+Zika+drug+discovery.">Strategies for Zika drug discovery.</a> Current Opinion in Virology. 35, 19-26 (2019).</li><li>Cugola, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Brazilian+Zika+virus+strain+causes+birth+defects+in+experimental+models.">The Brazilian Zika virus strain causes birth defects in experimental models.</a> Nature. 534 (7606), 267-271 (2016).</li><li>de Ara&#250;jo, T. V. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Association+between+microcephaly,+Zika+virus+infection,+and+other+risk+factors+in+Brazil:+Final+report+of+a+case-control+study.">Association between microcephaly, Zika virus infection, and other risk factors in Brazil: Final report of a case-control study.</a> The Lancet Infectious Diseases. 18 (3), 328-336 (2018).</li><li>Cao-Lormeau, V. -. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guillain-Barr&#233;+Syndrome+outbreak+associated+with+Zika+virus+infection+in+French+Polynesia:+a+case-control+study.">Guillain-Barr&#233; Syndrome outbreak associated with Zika virus infection in French Polynesia: a case-control study.</a> The Lancet. 387 (10027), 1531-1539 (2016).</li><li>Pielnaa, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus-spread,+epidemiology,+genome,+transmission+cycle,+clinical+manifestation,+associated+challenges,+vaccine+and+antiviral+drug+development.">Zika virus-spread, epidemiology, genome, transmission cycle, clinical manifestation, associated challenges, vaccine and antiviral drug development.</a> Virology. 543, 34-42 (2020).</li><li>Bollati, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+and+functionality+in+flavivirus+NS-proteins:+Perspectives+for+drug+design+Flaviviral+NS3+protein+Flaviviral+NS5+protein+Protease+Helicase+Polymerase+Methyltransferase+Flavivirus+protein+structure+Antivirals+VIZIER+Consortium.">Structure and functionality in flavivirus NS-proteins: Perspectives for drug design Flaviviral NS3 protein Flaviviral NS5 protein Protease Helicase Polymerase Methyltransferase Flavivirus protein structure Antivirals VIZIER Consortium.</a> Antiviral Research. 87, 125-148 (2010).</li><li>Fernandes, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reporter+replicons+for+antiviral+drug+discovery+against+positive+single-stranded+RNA+viruses.">Reporter replicons for antiviral drug discovery against positive single-stranded RNA viruses.</a> Viruses. 12 (6), (2020).</li><li>Fernandes, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+an+imidazonaphthyridine+and+a+riminophenazine+as+potent+anti-Zika+virus+agents+through+a+replicon-based+high-throughput+screening.">Discovery of an imidazonaphthyridine and a riminophenazine as potent anti-Zika virus agents through a replicon-based high-throughput screening.</a> Virus Research. 299, 198388 (2021).</li><li>Noske, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+characterization+and+polymorphism+analysis+of+the+NS2B-NS3+protease+from+the+2017+Brazilian+circulating+strain+of+Yellow+Fever+virus.">Structural characterization and polymorphism analysis of the NS2B-NS3 protease from the 2017 Brazilian circulating strain of Yellow Fever virus.</a> Biochimica et Biophysica Acta - General Subjects. 1864 (4), 129521 (2020).</li><li>Godoy, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Zika+virus+NS5+RNA-dependent+RNA+polymerase.">Crystal structure of Zika virus NS5 RNA-dependent RNA polymerase.</a> Nature Communications. 8, 14764 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+adenosine+nucleoside+inhibitor+of+dengue+virus.">An adenosine nucleoside inhibitor of dengue virus.</a> Proceedings of the National Academy of Sciences. 106 (48), 20435-20439 (2009).</li><li>Zhang, J. H., Chung, T. D. Y., Oldenburg, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+statistical+parameter+for+use+in+evaluation+and+validation+of+high+throughput+screening+assays.">A simple statistical parameter for use in evaluation and validation of high throughput screening assays.</a> Journal of Biomolecular Screening. 4 (2), 67-73 (1999).</li><li>Brecher, M., Zhang, J., Li, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+flavivirus+protease+as+a+target+for+drug+discovery.">The flavivirus protease as a target for drug discovery.</a> Virologica Sinica. 28 (6), 326-336 (2013).</li><li>Noble, C. G., Seh, C. C., Chao, A. T., Shi, P. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligand-bound+structures+of+the+dengue+virus+protease+reveal+the+active+conformation.">Ligand-bound structures of the dengue virus protease reveal the active conformation.</a> Journal of Virology. 86 (1), 438-446 (2012).</li><li>Chen, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+activation+and+inhibition+of+Zika+virus+NS2B-NS3+protease.">Mechanisms of activation and inhibition of Zika virus NS2B-NS3 protease.</a> Cell Research. 26 (11), 1260-1263 (2016).</li><li>Eyer, L., Nencka, R., de Clercq, E., Seley-Radtke, K., R&#367;&#382;ek, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleoside+analogs+as+a+rich+source+of+antiviral+agents+active+against+arthropod-borne+flaviviruses.">Nucleoside analogs as a rich source of antiviral agents active against arthropod-borne flaviviruses.</a> Antiviral Chemistry and Chemotherapy. 26, (2018).</li><li>Xie, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus+Replicons+for+Drug+Discovery.">Zika Virus Replicons for Drug Discovery.</a> EBioMedicine. 12, 156-160 (2016).</li><li>Pan, K. L., Lee, J. C., Sung, H. W., Chang, T. Y., Hsu, J. T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+NS3/4A+protease-based+reporter+assay+suitable+for+efficiently+assessing+hepatitis+C+virus+infection.">Development of NS3/4A protease-based reporter assay suitable for efficiently assessing hepatitis C virus infection.</a> Antimicrobial Agents and Chemotherapy. 53 (11), 4825-4834 (2009).</li><li>Khumthong, R., Angsuthanasombat, C., Panyim, S., Katzenmeier, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vitro+Determination+of+Dengue+Virus+Type+2+NS2B-NS3+Protease+Activity+with+Fluorescent+Peptide+Substrates.">In Vitro Determination of Dengue Virus Type 2 NS2B-NS3 Protease Activity with Fluorescent Peptide Substrates.</a> Journal of Biochemistry and Molecular Biology. 35 (2), (2002).</li><li>Ulanday, G. E. L., Okamoto, K., Morita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+utility+of+an+in+vitro,+fluorescence-based+assay+for+the+discovery+of+novel+compounds+against+dengue+2+viral+protease.">Development and utility of an in vitro, fluorescence-based assay for the discovery of novel compounds against dengue 2 viral protease.</a> Tropical Medicine and Health. 44 (1), 1-10 (2016).</li><li>Ong, I. L. H., Yang, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+developments+in+protease+activity+assays+and+sensors.">Recent developments in protease activity assays and sensors.</a> Analyst. 142 (11), 1867-1881 (2017).</li><li>Eltahla, A. A., Lackovic, K., Marquis, C., Eden, J. S., White, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+high-throughput+screen+to+identify+small+compound+inhibitors+of+the+genotype+3a+hepatitis+c+virus+RNA+polymerase.">A fluorescence-based high-throughput screen to identify small compound inhibitors of the genotype 3a hepatitis c virus RNA polymerase.</a> Journal of Biomolecular Screening. 18 (9), 1027-1034 (2013).</li><li>Eydoux, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+high+throughput-screening+assay+for+the+SARS-CoV+RNA+synthesis+complex.">A fluorescence-based high throughput-screening assay for the SARS-CoV RNA synthesis complex.</a> Journal of Virological Methods. 288, 114013 (2021).</li><li>Shimizu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+a+small+molecule+inhibitor+targeting+dengue+virus+NS5+RNA-dependent+RNA+polymerase.">Discovery of a small molecule inhibitor targeting dengue virus NS5 RNA-dependent RNA polymerase.</a> PLoS Neglected Tropical Diseases. 13 (11), 1-21 (2019).</li><li>S&#225;ez-&#193;lvarez, Y., Arias, A., del &#193;guila, C., Agudo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+fluorescence-based+method+for+the+rapid+determination+of+Zika+virus+polymerase+activity+and+the+screening+of+antiviral+drugs.">Development of a fluorescence-based method for the rapid determination of Zika virus polymerase activity and the screening of antiviral drugs.</a> Scientific Reports. 9 (1), 1-11 (2019).</li><li>Kocabas, F., Turan, R. D., Aslan, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorometric+RdRp+assay+with+self-priming+RNA.">Fluorometric RdRp assay with self-priming RNA.</a> Virus Genes. 50 (3), 498-504 (2015).</li><li>Niyomrattanakit, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+alkaline+phosphatase-coupled+polymerase+assay+for+identification+of+inhibitors+of+dengue+virus+RNA-Dependent+RNA+polymerase.">A fluorescence-based alkaline phosphatase-coupled polymerase assay for identification of inhibitors of dengue virus RNA-Dependent RNA polymerase.</a> Journal of Biomolecular Screening. 16 (2), 201-210 (2011).</li><li>Simeonov, A., Davis, M. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Interference with Fluorescence and Absorbance Flow Chart Fluorescence Interferences. (Md). , 1-8 (2016).</li><li>Genick, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+biophysics+in+high-+Throughput+screening+hit+validation.">Applications of biophysics in high- Throughput screening hit validation.</a> Journal of Biomolecular Screening. 19 (5), 707-714 (2014).</li><li>Smith, T. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identifying+initiation+and+elongation+inhibitors+of+dengue+virus+RNA+polymerase+in+a+high-throughput+lead-finding+campaign.">Identifying initiation and elongation inhibitors of dengue virus RNA polymerase in a high-throughput lead-finding campaign.</a> Journal of Biomolecular Screening. 20 (1), 153-163 (2015).</li><li>Porecha, R., Herschlag, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+radiolabeling.">RNA radiolabeling.</a> Methods in enzymology. 530, 255-279 (2013).</li></ol>

The protocols described herein could be readily adapted for screenings in a 384 or 1536-well formats. For biochemical and/or cell-based screenings performed in HTS format, the Z&#39; factor value, a statistical parameter, is calculate for each plate to ensure the sensitivity, reproducibility and accuracy of those assays12. A Z&#39; factor value of 0.5 or above is expected for replicon-based screenings while a value of 0.7 or above is expected for the NS3 and NS5 activity assays. For the replicon-b...

The Zika virus (ZIKV) is an emerging arthropod-borne virus member of the genus Flavivirus, which includes the closely related Dengue virus (DENV), Japanese encephalitis virus (JEV) and Yellow Fever virus (YFV), that pose constant threats to public health1. The 2015-16 ZIKV outbreak in the Americas received global attention following its emergence in Brazil due to the association with severe neurological disorders, such as congenital ZIKV-associated microcephaly in newborns2,3&#160;and Guillain-Barr&#233; syndrome in adults4. Although the number of infection cases declined throughout the next two years, autochthonous mosquito-borne transmissions of ZIKV were verified in 87 countries and territories in 2019, therefore, evidencing the potential of the virus to re-emerge as an epidemic5. To date, there are no approved vaccines or effective drugs against ZIKV infection.
Antiviral drug discovery requires the development of reliable cellular and biochemical assays that can be performed in high-throughput screening (HTS) formats. Replicon-based screenings and viral enzyme-based assays are two valuable strategies to test small-molecule compounds for inhibitors of ZIKV1. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC)6. The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication6.
Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity7. Herein, we describe the protocols used for screening inhibitors of the ZIKV replication in a 96-well plate format. The replicon-based assays were performed using a BHK-21 ZIKV Rluc replicon cell line that we have recently developed8. To characterize the specific targets of identified compounds, we established in vitro fluorescence-based assays for recombinantly expressed NS3 protease using the fluorogenic peptide substrate, Bz-nKRR-AMC, whereas for NS5 RdRp we measured the elongation of the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;), using the intercalating dye SYBR Green I.
The ZIKV protease (45-96 residues of NS2B cofactor linked to residues 1-177 of NS3 protease domain by a glycine rich linker [G4SG4]) was obtained, as described for YFV9, while the polymerase (276-898 residues of RdRp domain) was cloned and expressed, as detailed in10. Both enzyme sequences were derived from GenBank ALU33341.1. As primary antiviral screenings, compounds are tested at 10 &#181;M and those showing activities &#8805; 80% are then evaluated in a dose-dependent manner, resulting in the effective/inhibition (EC50 or IC50) and the cytotoxic (CC50) concentrations. In the context of representative results, the EC50 and CC50 values of NITD008, a known flaviviruses inhibitor11, from replicon-based screenings are shown. For the enzymatic assays, the IC50 values of two compounds from the MMV/DNDi Pandemic Response Box, a library composed of 400 molecules with antibacterial, antifungal and antiviral activities, are shown. The protocols described in this work could be modified to screen for inhibitors of other related flaviviruses.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5&#39;-biotin-U30- ACUGGAGAUCGAUCUCCAGU -3&#39;</td>
			<td>Dharmacon</td>
			<td>-</td>
			<td>100 ng</td>
		</tr>
		<tr>
			<td>96-well cell culture plates</td>
			<td>KASVI</td>
			<td>K12-096</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well PCR Microplate</td>
			<td>KASVI</td>
			<td>K4-9610</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well White Flat Bottom Polystyrene High Bind Microplate</td>
			<td>Corning</td>
			<td>3922</td>
			<td></td>
		</tr>
		<tr>
			<td>AMC (7-amine-4-methylcoumarine)</td>
			<td>SIGMA-Aldrich</td>
			<td>257370</td>
			<td>100 mg</td>
		</tr>
		<tr>
			<td>Aprotinin from bovine lung</td>
			<td>SIGMA-Aldrich</td>
			<td>A1153</td>
			<td>10 mg</td>
		</tr>
		<tr>
			<td>ATP</td>
			<td>JenaBioscience</td>
			<td>NU-1010-1G</td>
			<td>1 g</td>
		</tr>
		<tr>
			<td>Bz-nKRR-AMC</td>
			<td>International Peptides</td>
			<td>-</td>
			<td>5 mg</td>
		</tr>
		<tr>
			<td>Class II Biohazard Safety Cabinet</td>
			<td>ESCO</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Diethyl pyrocarbonate</td>
			<td>SIGMA-Aldrich</td>
			<td>D5758</td>
			<td>25 mL</td>
		</tr>
		<tr>
			<td>DMSO (Dimethyl sulfoxide)</td>
			<td>SIGMA-Aldrich</td>
			<td>472301</td>
			<td>1 L</td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Modified Eagle Medium</td>
			<td>GIBCO</td>
			<td>3760091</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>GIBCO</td>
			<td>12657-029</td>
			<td>500 mL</td>
		</tr>
		<tr>
			<td>G418</td>
			<td>SIGMA-Aldrich</td>
			<td>A1720</td>
			<td>Disulfate salt</td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>SIGMA-Aldrich</td>
			<td>G5516</td>
			<td>1 L</td>
		</tr>
		<tr>
			<td>HERACELL VIOS 160i CO2 incubator</td>
			<td>Thermo Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>MnCl2 tetrahydrate</td>
			<td>SIGMA-Aldrich</td>
			<td>203734</td>
			<td>25 g</td>
		</tr>
		<tr>
			<td>MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide)</td>
			<td>Invitrogen</td>
			<td>M6494</td>
			<td></td>
		</tr>
		<tr>
			<td>NITD008 &#8805;98% (HPLC)</td>
			<td>Sigma-Aldrich</td>
			<td>SML2409</td>
			<td>5 mg</td>
		</tr>
		<tr>
			<td>qPCR system Mx3000P</td>
			<td>Agilent</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Renilla luciferase Assay System</td>
			<td>PROMEGA</td>
			<td>E2810</td>
			<td></td>
		</tr>
		<tr>
			<td>SpectraMax Gemini EM Fluorescence Reader</td>
			<td>Molecular Devices</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SpectraMax i3 Multi-Mode Detection Platform</td>
			<td>Molecular Devices</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SpectraMax Plus 384 Absorbance Microplate Reader</td>
			<td>Molecular Devices</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green I</td>
			<td>Invitrogen</td>
			<td>S7563</td>
			<td>500 &#181;l</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>SIGMA-Aldrich</td>
			<td>X100</td>
			<td>500 mL</td>
		</tr>
		<tr>
			<td>Trizma base</td>
			<td>SIGMA-Aldrich</td>
			<td>T1503</td>
			<td>1 kg</td>
		</tr>
		<tr>
			<td>Trypsin-EDTA Solution 1X</td>
			<td>SIGMA-Aldrich</td>
			<td>59417-C</td>
			<td>100 mL</td>
		</tr>
	</tbody>
</table>

high-throughput antiviral assays to screen for inhibitors of zika virus replication

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3&#8242;UTR-U30 (5&#39;-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3&#39;).

All the protocols described herein were stablished in 96-well plates and allows the evaluation of 80 compounds per plate in a primary screening of a single concentration, including the negative and positive controls placed at the first and last column of the plates, respectively. The replicon-based screenings are represented in Figure 1, which includes the RNA construct developed to obtain the BHK-21-RepZIKV_IRES-Neo cell line (Figure 1A), the assays schematic r...

Watch this Scientific Journal Video about High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication at JoVE.com

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) ...

The overall goal of these procedures is to screen for inhibitors of Zika virus replication in a high-throughput screening format, using a replicon-based and/or a viral enzyme-based assays. Antiviral drug discovery requires the development of reliable cellular and biochemical assays that can be performed in high-throughput screening formats. Replicon-based screenings and viral enzyme-based assays are two valuable strategies to test small molecule compounds as inhibitors of Zika virus.Replicons are self-replicating subgenomic systems expressed in mammalian cells in which the viral structural genes are replaced by a reporter gene. In our lab, we developed a Zika virus replicon system, including the Renilla luciferase, which is stably expressed in baby hamster BHK-21 cell lines. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the luciferase activity.To characterize the specific targets of identified compounds, we established in vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RNA-dependent RNA polymerase, the RdRp. Start by culturing Zika viral replicon cells until they reach 70 to 90 percent confluence. In a sterile laminar flow, remove and discard the media from the flask.Add five mils of trypsin-EDTA to the flask. Spread the trypsin solution over the cells and leave the flask for five to 10 minutes for cells to detach. Harvest the resuspended cells and place it in the sterile 50 mil tube and centrifuge it for 125G during five minutes.After discarding the supernatant, resuspend the cells in five mils of DMEM 10%FBS for counting. Adjust the cells to two times 10 to four per well and seed them in a 96-well plate. Then incubate the plate for 16 hours at 37 celsius in a CO2 humidifier incubator.Next discard the medium and add 100 microliters per well of DMEM 2%FBS. Add one microliter of the compound per well to result in a final concentration of 10 micromolar and 1%DMSO in the assay medium. In the first and in the last column, prepare the positive and negative control.Incubate the plate for 48 hours at 37 celsius in a CO2 humidifier incubator. Prepare Renilla luciferase lysis buffer in reagent according to the manufacture instructions. After discarding the supernatant from the cells add 25 microliters of Renilla luciferase lyse buffer per well.Add 100 microliters of Renilla luciferase assay reagent per well to a white opaque 96-well plate. Transfer 20 microliters of the cell lysate to the white plate and then read the luminescence signals in luminometer. For the MTT assay, procedure has previously demonstrated and after compound incubation add 10 microliters per well of MTT solution to the cells and incubate the plate at 37 celsius in a CO2 humidifier for 24 hours.Discard the supernatant and add 100 microliters of DMSO to each well, and then solubilize the formazan crystals by pipetting up and down. Read the absorbents at 570 nanometers in a spectrophotometer. After thawing materials on ice, prepare an appropriate amount of protein dilution to reach a final concentration of four nanomolar per well.In a 96-well white plate, dispense 84 microliters of the assay buffer in each well. To prepare a control reaction, add one microliter of DMSO to the first column of the plate. Add one microliter of the tested compounds to reach a final concentration of 10 micromolar to the plate.Dispense five microliters per well of protease solution, excluding controls and incubate the plate at four celsius for 30 minutes. To start the reaction, dispense 10 microliters of fluorogenic substrate stock solution to the wells. Follow their reaction using a fluorometer set in appropriate parameters.For this session, all reagents must be prepared with DEPC treated water. Anneal the polyuridine RNA by incubating it at 55 Celsius for five minutes in a thermal cycler. Thaw materials on ice and dilute the protein to reach a final concentration of 250 nanomolar in the assay buffer.Prepare the SYBR Green I solution assay buffer, and then add ATP and the anealed RNA to a final concentration of one millimolar and 300 nanomolar, respectively. In a PCR plate, add 24.5 microliters of the diluted protein in columns one to 11. Add the same volume of the assay buffer in the remaining wells.Add 0.5 microliters per well of compounds and controls to reach a final concentration of 10 micromolar. After 15 minutes incubation, start the reaction by adding 25 microliters of the substrate solution and seal the plate. Follow the reaction in a real-time PCR system incubated at 30 Celsius using a FAM filter.In figure 1A, we see a schematic representation of the RNA construct developed to obtain Zika viral replicon cell lines, showing that Rluc gene replacing the structural sequences and the IRES new cassette inserted at 3'end. It also includes a T7 promoter in the hepatitis delta virus ribozyme sequence for in vitro transcription and for generation of the authentic 3'end and the RNA transcript, respectively. In figure 1B, we see a schematic representation of the replicon-based cell assay.In figure 1C, we see the dose-response curves and the cytotoxicity curves of a given compound obtained using the Rluc replicon system. In figure 2A, we see an schematic representation of the assay used to determine the activity of the NS2B-NS3 protease. In figure 2B, we see the dose-response curve of a given inhibitor targeting the NS2B-NS3 protease.In figure 2C, we see an schematic representation of the elongation assay used to determine the NS5 RdRp activity. In figure 2D, we see the dose-response group of a given inhibitor targeting the Zika virus RdRp activity. The demonstrated procedures could be readily adapted for screenings in a 384 or 1, 536-well formats.For the replicon-based high-throughput screenings, we developed a stable cell line harboring a replicative Zika virus replicon containing a Renilla luciferase sequence at the 5'end, and also a neomycin phosphotransferase gene driven by an internal ribosomal entry site at the 3'end. Due to the lack of structural genes, replicons do not produce progeny virions. Thus, eliminating the risk of laboratory acquired viral infection.In addition, we also demonstrated the procedures used in viral enzyme-based assays for the recombinant NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using a fluorogenic peptide substrate, which contains the Zika virus protease recognition and cleavage sequences coupled with the fluorescence stock aminomethylcoumarin. Regarding the NS5 RNA-dependent RNA polymerase, its elongation activity is directly detected by the increase of the fluorescent signal of SYBR Green I.These implementation, direct measurement, and affordability are key points to the user's florescence-based methods as high-throughput screening platforms.

high-throughput-antiviral-assays-to-screen-for-inhibitors-zika-virus

Research

JoVE Journal

Immunology and Infection

3.5K vistas.  University of Sao Paulo. El objetivo general de estos procedimientos es detectar inhibidores de la replicación del virus del Zika en un formato de detección de alto rendimiento, utilizando un ensayo basado en replicon y / o en enzimas virales. El descubrimiento de fármacos antivirales requiere el desarrollo de ensayos celulares y bioquímicos confiables que se puedan realizar en formatos de detección de alto rendimiento. Los exámenes basados en replicon y los ensayos basados en enzimas virales son dos estrategia...