نود أن نشكر مونيكا Tarnowska، كورنيليا ألبرخت، وإيوا Skoczylas للمساعدة التقنية الممتازة. وقد تم تمويل هذه الدراسة من قبل الجبهة الوطنية الصومالية SINERGIA منحة CRSI33-125073 لPP.

<ol>
	<li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat. Rev. Genetics. 6, 507-512 (2005).</li><li>Johansson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+zoo+of+mice+for+genetic+analyses:+a+comprehensive+protocol+for+the+rapid+generation+of+BAC+transgenic+mice.">Building a zoo of mice for genetic analyses: a comprehensive protocol for the rapid generation of BAC transgenic mice.</a> Genesis. 48, 264-280 (2010).</li><li>Skarnes, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+knockout+resource+for+the+genome-wide+study+of+mouse+gene+function.">A conditional knockout resource for the genome-wide study of mouse gene function.</a> Nature. 474, 337-342 (2011).</li><li>Carbery, I. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186, 451-459 (2010).</li><li>Meyer, M., de Angelis, M. H., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+by+homologous+recombination+in+mouse+zygotes+mediated+by+zinc-finger+nucleases.">Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 15022-15026 (2010).</li><li>Cui, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+integration+in+rat+and+mouse+embryos+with+zinc-finger+nucleases.">Targeted integration in rat and mouse embryos with zinc-finger nucleases.</a> Nat. Biotechnol. 29, 64-67 (2011).</li><li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat. Biotechnol. 31, 23-24 (2013).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+production+of+mouse+disease+models+by+embryo+microinjection+of+TALENs+and+oligodeoxynucleotides.">Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides.</a> Proc. Natl. Acad. Sci. U.S.A. 110, 3782-3787 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-Step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-Step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153, 910-918 (2013).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genetics. 11, 636-646 (2010).</li><li>ZFN, T. A. L. E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Joung, J. K., Sander, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TALENs:+a+widely+applicable+technology+for+targeted+genome+editing.">TALENs: a widely applicable technology for targeted genome editing.</a> Nat. Rev. Mol. Cell Biol. 14, 49-55 (2013).</li><li>Cermak, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+design+and+assembly+of+custom+TALEN+and+other+TAL+effector-based+constructs+for+DNA+targeting.">Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting.</a> Nucleic Acids Res. 39, (2011).</li><li>Reyon, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH+assembly+of+TALENs+for+high-throughput+genome+editing.">FLASH assembly of TALENs for high-throughput genome editing.</a> Nat. Biotechnol. 30, 460-465 (2012).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcription+activator-like+effector+toolbox+for+genome+engineering.">A transcription activator-like effector toolbox for genome engineering.</a> Nat. Protoc. 7, 171-192 (2012).</li><li>Kim, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+library+of+TAL+effector+nucleases+spanning+the+human+genome.">A library of TAL effector nucleases spanning the human genome.</a> Nat. Biotechnol. 31, 251-258 (2013).</li><li>Schmid-Burgk, J. L., Schmidt, T., Kaiser, V., Honing, K., Hornung, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ligation-independent+cloning+technique+for+high-throughput+assembly+of+transcription+activator-like+effector+genes.">A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes.</a> Nat. Biotechnol. 31, 76-81 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat. Biotechnol. 31, 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat. Biotechnol. 31, 822-826 (2013).</li><li>Hermann, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+OPEN+zinc+finger+nucleases+for+direct+gene+targeting+of+the+ROSA26+locus+in+mouse+embryos.">Evaluation of OPEN zinc finger nucleases for direct gene targeting of the ROSA26 locus in mouse embryos.</a> PLoS ONE. 7, (2012).</li><li>Meyer, M., Ortiz, O., Hrabe de Angelis, M., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+disease+mutations+by+gene+targeting+in+one-cell+mouse+embryos.">Modeling disease mutations by gene targeting in one-cell mouse embryos.</a> Proc. Natl. Acad. Sci. U.S.A. 109, 9354-9359 (2012).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat. Biotechnol. 29, 143-148 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Doyon, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+zinc-finger-nuclease+activity+with+improved+obligate+heterodimeric+architectures.">Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures.</a> Nat. Methods. 8, 74-79 (2011).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Wefers, B., Wurst, W., K&#252;hn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Haueter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+vasectomy-overexpression+of+Prm1-EGFP+fusion+protein+in+elongating+spermatids+causes+dominant+male+sterility+in+mice.">Genetic vasectomy-overexpression of Prm1-EGFP fusion protein in elongating spermatids causes dominant male sterility in mice.</a> Genesis. 48, 151-160 (2010).</li><li>Perez-Pinera, P., Ousterout, D. G., Brown, M. T., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+to+the+ROSA26+locus+directed+by+engineered+zinc+finger+nucleases.">Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases.</a> Nucleic Acids Res. 40, 3741-3752 (2012).</li><li>Bultmann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+transcriptional+activation+of+silent+oct4+pluripotency+gene+by+combining+designer+TALEs+and+inhibition+of+epigenetic+modifiers.">Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers.</a> Nucleic Acids Res. 40, 5368-5377 (2012).</li><li>Valton, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+TALE+DNA+binding+domain+sensitivity+to+cytosine+methylation.">Overcoming TALE DNA binding domain sensitivity to cytosine methylation.</a> J. Biol. Chem. 287, 38427-38432 (2012).</li><li>Cradick, T. J., Ambrosini, G., Iseli, C., Bucher, P., McCaffrey, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN-Site+searches+genomes+for+zinc+finger+nuclease+target+sites+and+off-target+sites.">ZFN-Site searches genomes for zinc finger nuclease target sites and off-target sites.</a> BMC Bioinform. 12, (2011).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Byers, S. L., Payson, S. J., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+ten+inbred+mouse+strains+following+assisted+reproductive+technologies+(ARTs).">Performance of ten inbred mouse strains following assisted reproductive technologies (ARTs).</a> Theriogenology. 65, 1716-1726 (2006).</li><li>Luo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+strategies+for+6+commonly+used+mouse+strains.">Superovulation strategies for 6 commonly used mouse strains.</a> J. Am. Assoc. Lab. Animal Sci. 50, 471-478 (2011).</li><li>Pease, S., Saunders, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> International Society for Transgenic Technologies. Advanced protocols for animal transgenesis : an ISTT manual. , (2011).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+human+genome+engineering+via+Cas9.">RNA-Guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li></ol>

الكتاب تعلن أي تضارب مصالح.

مصمم يحركها نوكلياز الجينوم النهج التحرير قمنا بمد بشكل كبير من مجموعة من الأنواع قابلة للتعديلات التي تستهدف جينوم كل منهما 10،12. في الفئران، وقد تم في خلايا ES-استهداف الجينات تقنية قياسية لأكثر من عقدين من الزمن؛ ومع ذلك، فقد ثبت صعوبة في التكيف مع الخلايا الجذعية الجنينية من الأنواع الأخرى من الماوس، وإن كان هناك بعض النجاح الذي تحقق مؤخرا في الفئران خلايا ES. حتى مع توافر &quot;قبالة الجاهزة للاستخدام&quot; الماوس ES استنساخ الخلايا المستهدفة الجينات التي تقدمها اتحادات مثل EUCOMM، KOMP، أو NorCOMM 3 الجينوم التحرير من قبل ZFN وTALEN يوفر أعلى من الدقة والمرونة فيما يتعلق الطيف من التعديلات التي يمكن أن تكون أدخلت جينوم الفأر. الحيوانات مؤسس تحمل طفرات بوساطة نوكلياز يبدو أن غاية الجرثومية خط المختصة 4-6،20،21، وهي ليست الحال دائما للالوهم القادمة من حقن الكيسة الخلايا ES. وبالتالي، في بعض الحالات Microinjection من قصريمكن nucleases igner يؤدي إلى توليد أسرع بكثير من خطوط الماوس رواية مع بعض التعديلات الجينوم المستهدفة. الجيل الناجح من الفئران خروج المغلوب عن طريق الحقن من ZFN وTALEN يعتمد إلى حد كبير على نشاط الزوج نوكلياز حقن. وقد ثبت TALENs أن يكون لها نسبة نجاح عالية في استهداف مجموعة واسعة من الجينات في عدد من الكائنات الحية؛ ومع ذلك، تشير الدراسات الحديثة أن TALEN ملزمة حساس للالسيتوزين مثيلة 30،31. وهكذا، ولدت حديثا نوكلياز أزواج، على سبيل المثال TALENs المستنسخة في ناقلات pCAG-T7، يمكن عابر في خط الخلية الماوس مثل NIH-3T3 أو العصبية -2A، التي تحاكي الدولة لونين من الجنين الماوس إلى حد ما. هنا، والنشاط نوكلياز يمكن تقديرها باستخدام نوكلياز داخلية مقايسة T7 أو تقييد هضم المنتج PCR كما هو موضح في القسم 5 قبل التوليف مرنا وحقن مكروي. نوصي التسلسل الجيني في المنطقة من مصلحة في احترامإيف خط الخلية وسلالة الماوس تستخدم للتجارب حقن مكروي. في بيضات ملقحة الماوس، سوف TALEN مختلفة أو ZFN أزواج تعمل على النحو الأمثل بتركيزات مختلفة مرنا وبالتالي فإن تركيز العمل الأمثل للنوكلياز مرنا microinjected قد تضطر إلى أن تحدد تجريبيا. اعتمادا على الزوج نوكلياز، وتركيز منخفض جدا يؤدي إلى أي انشقاق في حين مرتفعة جدا يمكن أن يؤدي إلى الجنين الفتك. اعتمادا على الزوج نوكلياز، لقد حققنا نجاحا باستخدام مجموع تركيزات منخفضة مرنا قدر 2 نانوغرام / ميكرولتر ويصل إلى 200 ميكروغرام / شباط. هذه الآثار يصعب التنبؤ بها من التجارب في خلية ثقافة والأمثل تركيز نوكلياز لكلا بقاء الجنين ومعدل تعديل موضع الهدف يحتاج إلى أن تحدد تجريبيا. ZFN نشطة للغاية أو TALEN يمكن يلتصق تسلسل هدفهم تجاوز مرحلة خلية واحدة من الجنين، وبالتالي يسبب microinjected أنماط معقدة من الطفرات ود الاصباغ في المؤسسين. نحن وآخرون 4 لاحظت ثلاثة أو أكثر من الأليلات تحور واضح في مؤسس واحد (الشكل 5C). وبالتالي، عند إنشاء خط الفأرة الجديدة من هؤلاء المؤسسين، والأبناء لا بد من فحص بعناية من قبل تسلسل لوجود الطفرة مواتية منذ المقايسات الهضم تقديم الدليل الوحيد على أن طفرة غير معروف موجودا. واحدة من الانتقادات في كثير من الأحيان اعرب ضد أنظمة ZFN وTALEN هو احتمال أن هذه nucleases هي أيضا قادرة على الشق تسلسل الحاضر في مكان آخر في الجينوم التي تشبه إلى المواقع المستهدفة. وقد لوحظت هذه التأثيرات خارج الهدف مع الكواشف الجيل المبكر باستخدام المجال homodimeric FokI، وصممت ثوابت مغاير للتخفيف من آثار خارج الهدف 25. يمكن التنبؤ مواقع خارج هدفا محتملا إلى حد ما في سيليكون 32،33 وفرزهم من قبل PCR والتسلسل. ميزة واضحة سو باستخدام ZFNs وTALENs لتوليد الفئران بدلا من خطوط الخلايا هي إمكانية إزالة من الطفرات الهدف المنشود غير المرتبطة لتعديل الجينوم عن طريق إجراء العديد من backcrosses لسلالة من النوع البري في الاختيار. لتحليل عدد كبير من الفئران مؤسس، الجيل القادم التسلسل العميقة للمنتجات PCR ولدت من موضع استهداف ونوكلياز في سيليكون توقع خارج الهدف مواضع قد تقدم قراءات النوعي والكمي بديل لفحوصات هضم منتجات PCR. هي الأمثل للتقنيات المساعدة على الإنجاب وصفها في هذا البروتوكول لسلالات الفئران القياسية المستخدمة في التجارب حقن مكروي مثل C57BL/6J أو B6D2F1. الفئران من أصول مختلفة، مثل سلالات الأباعد، يمكن من حيث المبدأ أن تستخدم لنهج تحرير الجينوم ويمكن أن توفر خلفية وراثية أكثر ملاءمة للأسئلة بحثية محددة. أداء تقنيات الإنجاب المساعدة مثل فرط الإباضة يمكن أن يكون prediالمديرية لعدد من سلالات 34-36 ولكن قد تحتاج إلى مزيد من التحسين لسلالات غير قياسي من أجل الحصول على عدد كاف من الأجنة لحقن مكروي نوكلياز. إلى جانب ZFN وTALEN، والآن أدخلت nucleases مصمم جديدة مثل موجهة RNA نظام CRISPR/Cas9 9،37،38 لتطبيقات التحرير الجينوم. جميع الطرق لحقن مكروي وتحليل الحيوانات مؤسس وصفها هنا قابلة للتطبيق على CRISPR/Cas9 وسائط مستقبل تحرير الجينوم أيضا.

الفئران هي الآن الأكثر شعبية منصة لتوليد النماذج الحيوانية المعدلة وراثيا. الأدوات تنوعا للهندسة الوراثية للجنين الفأر 1-3 وقد تم تمديد مؤخرا من قبل نهج التحرير الجينوم على أساس nucleases مصمم مثل nucleases إصبع الزنك (ZFN) 4-6، والنسخ مثل المنشط nucleases المستجيب (TALEN) 7،8، وتتجمع interspaced بانتظام يكرر المتناوب قصيرة (CRISPR) / (CAS) 9 المرتبط CRISPR نظام 9. ZFN وظيفة TALEN كما أزواج اثنين من المجالات مصمم خصيصا البروتين على أساس ملزم الحمض النووي (صفائف من الزنك الاصبع البروتينات وتكرار متغير ثنائي بقايا (RVDs)، على التوالي) التي تقترن كل لنوكلياز داخلية FokI 10-12. على العكس، يتم توفير خصوصية Cas9 بوساطة الانقسام الحمض النووي عن طريق transactivating الرنا CRISPR (crRNA وtracrRNA، والتي يمكن أيضا أن تكون مجتمعة في واحدة جزيء RNA خيالية تسمى دليل الحمض النووي الريبي) 11 التي تعمل في مجمع معالبروتين CRISPR. TALENs مع تسلسل محدد من RVDs يمكن بناؤها بسرعة عن طريق المجربون الفردية مع العديد من الاستراتيجيات لاختيار التجمع 13-17. CRISPR/Cas9 عود الجيل كثيفة العمالة حتى أقل من nucleases مصمم، ولكن خصوصية دليل الحمض النووي الريبي الحمض النووي ملزمة لم يتم حل تماما 18،19. جيل من ZFNs مخصص وقد تم حتى الآن تقتصر على مختبرات الأكاديمية المتخصصة والتجارية للموردين مثل Sangamo العلوم البيولوجية والخدمة سيغما CompoZr. بشكل عام، يهدف الجينوم التحرير مع nucleases مصمم على تقديم فواصل حبلا مزدوجة (DSB) في مواضع محددة الجيني، والتي تجذب فيما بعد نهاية امتماثلان الانضمام (NHEJ) أو إعادة التركيب مثلي (HR) الأجهزة إصلاح الحمض النووي 10،12. إصلاح NHEJ بوساطة من جهاز تسوية المنازعات غالبا ما يؤدي إلى إدخال الإدراج والحذف على مقربة من موقع الإصلاح. NHEJ بالتالي إصلاح جويمكن استغلالها لضرب وظيفة الجين المستهدف من خلال إدخال طفرة الإطار تحول في الجينات ترميز بروتين تسلسل 4،7،9. بدلا من ذلك، بالإضافة إلى تعريف أو استبدال المعلومات الوراثية يمكن أن يتحقق من خلال توفير المانحة الحمض النووي مع nucleases المصمم. وتضم الجهات المانحة والحمض النووي تسلسل الحمض النووي مصمم المحقق يحيط بها مناطق التماثل مع مكان الهدف، وبالتالي تخدم كنموذج لإصلاح جهاز تسوية المنازعات عن طريق الموارد البشرية. كلا البلازميدات 5،6،20 واحد أليغنوكليوتيد] الذين تقطعت بهم السبل 8،9،21 وقد استخدمت بنجاح الجهات المانحة. لا تتطلب NHEJ-HR ولا بوساطة الجينوم تحرير إدخال علامة اختيار في جينوم الجنين الماوس، الأمر الذي يجعل هذه الاستراتيجيات لا سيما مناسبة تماما لخلق تغييرات صغيرة في تسلسل النوكليوتيدات من دون إزعاج العمارة الوراثية بشكل عام. في هذا البروتوكول وصفنا جميع الإجراءات الضرورية لتحرير الجينوم فيجنين فأر باستخدام TALENs. وتشمل هذه 1) تحديد موقع الهدف TALEN 22، 2) بناء TALENs كتبها golden بوابة الاستنساخ 13، 3) في المختبر توليف TALEN مرنا، 4) Microinjection من TALEN مرنا في البويضات المخصبة الماوس، 5) العمليات الجراحية لنقل الأجنة و6) تحليل الطفرات المستحثة TALEN في الحيوانات مؤسس. ونحن نركز على TALEN مرنا حقن مكروي والفرز من المؤسسين لNHEJ التي يسببها الإدراج / حذف. لهذا الغرض، ونحن قد ولدت يبني TALEN bifunctional التي تسمح على حد سواء التعبير في خلايا الثدييات عندما transfected البلازميدات وكما في التوليف المختبر من TALEN مرنا لحقن مكروي في أجنة الفئران. تتكون هذه التركيبات حكاية العمود الفقري اقتطاع 23 تنصهر لheterodimeric FokI النطاقات 24،25 الأمثل لتحرير الجينوم في خلايا الثدييات. ويمكن أيضا أن يعتمد هذا البروتوكول لMicroinjection من غيرها nucleases مصمم أو حقن مشتركة من nucleases مصممويبني المانحة (وقد وصفت تصميم المانحين الحمض النووي في المطبوعات الفنية الممتازة التي Wefers آخرون 26،27). بيان الأخلاقية أجريت جميع التجارب على الحيوانات وفقا للمبادئ التوجيهية واللوائح من المكتب البيطري كانتون كانتون زيوريخ.

<table border="0" cellpadding="0" cellspacing="0" width="524">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">BsaI</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">R0535S or L</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Esp3I</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">ER0451</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T4 Ligase</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0202S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Spectinomycin</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">S0692-1ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ampicillin&#160;</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">A0166</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">X-Gal</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">B4252</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">IPTG</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">I6758</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Plasmid-Safe nuclease</td>
			<td style="width:111px;">Epicentre</td>
			<td style="width:119px;">E3101K</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">27106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAGEN Plasmid Midi Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">12143</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAquick PCR Purification Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">28106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">mMESSAGE mMACHINE T7 Ultra Kit</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM1345</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NucAway Spin Columns</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM10070</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNaseZAP</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">R2020-250ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NorthernMax Formaldyde Load Dye</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM8552</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNA Millennium Markers</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM7150</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">10x TBE buffer</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">B52</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T7 endonuclease</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0302S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">pGEM-T EasyVector System I</td>
			<td style="width:111px;">Promega</td>
			<td style="width:119px;">A3600</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">SYBR Green I Nucleic Acid Gel Stain</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">S-7563</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">pregnant mare&#39;s serum gonadotrophin (PMSG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">G4877</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">human chorionic gonadotropin (hCG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">CG5</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M2 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7167</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M16 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7292</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Mineral oil, embryo tested</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M8410</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ketamine</td>
			<td style="width:111px;">CentraVet</td>
			<td style="width:119px;">Ket 201</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Xylazine</td>
			<td style="width:111px;">Sigma Aldrich</td>
			<td style="width:119px;">46995</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Equipment/Tools</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Inverted microscope with Nomarski DIC optics (for example Nikon Eclipse TE200)</td>
			<td style="width:111px;">Nikon</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Micromanipulator units (for example Narishige, NT88NF)</td>
			<td style="width:111px;">&#160;Narishige</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo holding capillaries</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;">B100-75-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo injection capillaries</td>
			<td style="width:111px;">Narishige</td>
			<td style="width:119px;">GD-1</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Capillary puller (for example Sutter P97)</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Microforge (for example Narishige MF-900)</td>
			<td style="width:111px;">Narishige&#160;</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Walton skin scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14077-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14041-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical probe</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">10140-03</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clip system (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12031-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clips (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12032-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dumont fine forceps 5</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11254-20</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria curvrd forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11370-31</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria fine forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11399-80</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dietrich bulldog clamp</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">18038-45</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Animals</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">C57BL/6J mice</td>
			<td style="width:111px;">Jackson labs</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">CD-1 mice</td>
			<td style="width:111px;">Charles river</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
	</tbody>
</table>

mouse genome engineering using designer nucleases

الفئران المعدلة وراثيا تحمل تعديلات في مواقع محددة الجينوم (خروج المغلوب، الضربة القاضية في) هي ذات أهمية حيوية لتشريح النظم البيولوجية المعقدة، فضلا عن الأمراض التي تصيب الإنسان لنمذجة واختبار الاستراتيجيات العلاجية. التطورات الحديثة في استخدام nucleases مصمم مثل nucleases إصبع الزنك (ZFNs)، والنسخ مثل المنشط nucleases المستجيب (TALENs)، وتتجمع interspaced بانتظام يكرر المتناوب قصيرة (CRISPR) / (CAS) المرتبطة CRISPR 9 نظام للموقع الهندسة الجينوم محددة فتح إمكانية لإجراء تعديل سريع الجينوم المستهدفة في الواقع أي الأنواع المختبر دون الحاجة إلى الاعتماد على الجذعية الجنينية (ES) تكنولوجيا الخلايا. يبدأ تجربة تحرير الجينوم عادة مع تحديد المواقع المستهدفة نوكلياز مصمم ضمن الجينات في المصالح تليها بناء المجالات الحمض النووي ملزم مخصصة لتوجيه النشاط نوكلياز إلى موضع الجيني محددة المحقق. البلازميدات مصمم نوكلياز في المختبر &lt;م /&gt; كتب لتوليد مرنا لMicroinjection من البويضات المخصبة الماوس. هنا، ونحن نقدم بروتوكول لتحقيق المستهدف تعديل الجينوم عن طريق الحقن المباشر للTALEN مرنا في البويضات المخصبة الماوس.

اقمنا البلازميدات الوجهة متوافق مع التجمع الذهبي GateTALEN نشرته سيرماك وآخرون 13 التي تسمح للتعبير عن TALENs في خلايا الثدييات وكذلك في المختبر التوليف مرنا من المروج T7 فج (الشكل 1C). هذه البلازميدات تحمل المجالات FokI heterodimeric (ELD أو KKR الطفرات) التي ثبت للحد من آثار خارج الهدف النسبي لhomodimers FokI وتعزيز النشاط الانقسام بالمقارنة مع الجيل الأول FokI heterodimers 25،29. ردود الفعل التجمع البوابة الذهبية رقم 1 ورقم 2 وعادة ما تكون فعالة جدا وكل مستعمرة بيضاء، عند تحليلها من قبل مستعمرة PCR، ويظهر النمط المتوقع لعدد معين من RVDs المستنسخة (الأرقام 1B و 1D). تحليل هلام في المختبر توليفها مرنا (الشكل 2) يجب أن تكشف عن وجود الفرقة مميزة واحدة مع مسحة ضئيلة أو معدومة لتحليل كل عينة. يجب أن يكون هناك تحول واضح بين حجم العينات L1/R1 وL2/R2، L3/R3، مما يدل على تذييل بعديد الأدينيلات ناجحة. مؤسس الحيوانات يمكن فرزهم لNHEJ التي يسببها الأليلات تحور باستخدام التنميط الجيني PCR تليها إما الهضم T7 نوكلياز داخلية (الشكل 3) أو تقييد هضم باستخدام الانزيم الذي يشق تسلسل نوع البرية في المنطقة فاصل من الزوج نوكلياز (الشكل 4). مقايسة T7 نوكلياز داخلية قابلة للتطبيق على أي نوع من الطفرة بغض النظر عن التسلسل الجيني محددة داخل المنطقة فاصل من الزوج نوكلياز حقن؛ ومع ذلك، فإنه يكشف عدم التطابق بين جدائل الحمض النووي فقط في المنتجات PCR مضاعف متغاير. وبالتالي، في حالة نادرة أن مؤسس يحمل اثنين من الأليلات تحور مماثل، ومنتجات PCR لن تظهر أي نمط T7 الهضم. مثل هذا التمييز هو، ومع ذلك، من الممكن دائما عندما يقع موقع قيود محددة داخل المنطقة الفاصل نوكلياز التي سيتم القضاء عليه من خلال NHEJالتي يسببها الإدراج / حذف (الشكل 5). هنا، والعصابات غير مهضوم تشير إلى وجود الطفرات، وعدم وجود أي منتجات هضمها يوحي بقوة مؤسس تحمل طفرات في كل من الأليلات من الجينات المستهدفة (التي تحمل العلامات النجمية في الشكل 4B). <img alt="الشكل 1" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig1highres.jpg" src="/files/ftp_upload/50930/50930fig1.jpg" width="600" /> الشكل 1. جولدن جيت استنساخ TALEN RVDs في heterodimeric pCAG-T7-الوجهة ناقلات ألف) جمعية صفائف RVD في ناقلات pFUS. هنا يظهر مثال لزوج TALEN مع صفائف حكاية فردية تضم 15 RVDs و 17 RVDs، على التوالي (للصفائف حكاية أطول من 21 RVDs، هناك حاجة إلى ثلاث pFUS-RVDs الجمعيات، لا تظهر). السهام تشير الاشعال لpFUS محددة تفاعلات مستعمرة PCR. ب) المنتجات PCRتضخيمه من التجميعات pFUS الصحيح عادة تظهر الفرقة المقابلة لطول مجتمعة من جميع RVDs المستنسخة (على سبيل المثال حوالي 1.1 كيلو بايت لمدة 10 RVDs) و &quot;سلم&quot; من العصابات أقل بروزا أصغر نظرا لطبيعة المتكررة من صفائف RVD. C) التجميع النهائي صفائف pFUS-RVD والبلازميد التي تحتوي على تكرار الماضي (بلر) في heterodimeric TALEN ناقلات تعبير وFokIELD وFokIKKR المتغيرات، على التوالي. العمود الفقري TALEN (المشروح في N و C) تمثل العمارة التي نشرتها ميلر وآخرون 23 CAG (CMV عنصر محسن المبكر / الدجاج بيتا الأكتين) مروج يضمن مستويات عالية التعبير في خلايا الثدييات transfected، في حين يسمح المروج T7 فج في المختبر مرنا التوليف (استخدام SACI عن الخطية من ناقلات المصب من نوكلياز إيقاف كودون). D) مستعمرة PCR باستخدام بادئات يتبين من السهام في C) يسمح تحديد تجميعها بشكل صحيح TALENs. كامل lengtح المنتجات PCR غالبا ما تكون أقل وضوحا في حين أن &quot;تأثير سلم&quot; يمثل مؤشرا قويا التجمع ناجحة. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig1highres.jpg" target="_blank">اضغط هنا لمشاهدة صورة بشكل اكبر</a> . <img alt="الرقم 2" fo:content-width="3in" fo:src="/files/ftp_upload/50930/50930fig2highres.jpg" src="/files/ftp_upload/50930/50930fig2.jpg" width="300" /> الشكل 2. . مراقبة جودة نوكلياز مرنا في تركيب المختبر باستخدام الاغاروز الكهربائي للهلام ترد mRNAs وZFN كمثال (L، غادر ZFN؛ R، الحق ZFN). عينات L1/R1 تظهر مرنا قبل تذييل بعديد الأدينيلات، وعينات L2/R2 المعرض مذيل بعديد الأدينيلات مرنا وL3/R3 تظهر مرنا مذيل بعديد الأدينيلات المنقى. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig2highres.jpg" target="_blank">اضغط هنا لمشاهدة صورة بشكل اكبر</a> . <img<html> بديل = &quot;الشكل 3&quot; FO: محتوى العرض = &quot;6in&quot; FO: SRC = &quot;/ files/ftp_upload/50930/50930fig3highres.jpg&quot; سرك = &quot;/ files/ftp_upload/50930/50930fig3.jpg&quot; العرض = &quot;600&quot; /&gt; الرقم 3. مثال على نوكلياز داخلية مقايسة T7 تستخدم لتحديد الحيوانات مؤسس تحمل الطفرات التي يسببها نوكلياز من موضع الهدف. A) وقد صمم زوج TALEN ليلتصق داخل المنطقة الترميز من الفأرة بروتين بريون الجين (Prnp، يمكن تقديم تسلسل الهدف TALEN عند الطلب). يتم إنشاء المنتج PCR باستخدام التمهيدي إلى الأمام (F) تقع 110 سنة مضت المنبع والتمهيدي العكسي (R) 250 سنة مضت المصب من موقع الانقسام TALEN. ب) يخضع المنتج PCR لاحقا إلى تشكيل مضاعف متغاير وT7 نوكلياز داخلية الهضم. C) وكشف الطفرات المستحثة TALEN داخل المنطقة الجيني المستهدفة من مؤسسي واحد عن طريق وجود كامل طول PCR المنتج مع منتجات الهضم من 250 و 110 نقطة أساس.50930/50930fig3highres.jpg &quot;الهدف =&quot; _blank &quot;&gt; اضغط هنا لمشاهدة صورة أكبر. <img alt="الرقم 4" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig4highres.jpg" src="/files/ftp_upload/50930/50930fig4.jpg" width="600" /> الشكل 4. مثال على تقييد هضم منتجات PCR تستخدم لتحديد الحيوانات مؤسس تحمل الطفرات التي يسببها نوكلياز من موضع الهدف. ZFN محددة للفأر Rosa26 موضع الهدف 29 موقع تقييد XbaI داخل إنترون 1. تم فحص A) من قبل المؤسسين التنميط الجيني PCR باستخدام التمهيدي إلى الأمام (F) يقع على بعد 500 سنة مضت المنبع والتمهيدي العكسي (R) 250 سنة مضت المصب من موقع الانقسام. ب) هضم منتجات PCR مع XbaI يكشف أنماط الهضم مما يدل الفئران مع الطفرات ثنائية أليلية (المشار إليها بعلامة النجمة)، مونو -أليلية الطفرات (العصابات هضمها وعسر الهضم، مثل الحيوان 2)والفئران وزن (الهضم كاملة، مثل الحيوان 21). C) تسلسل من الفئران مع تعديلات ثنائية أليلية المحتملة يظهر إلى 3 (الحيوانية 24) مميزة الإدراج / حذف. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig4highres.jpg" target="_blank">اضغط هنا لمشاهدة صورة بشكل اكبر</a> . <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> اسم التمهيدي </td><td> تسلسل 5 &#39;إلى 3&#39; </td></tr><tr><td> pCR8_F1 </td><td> ttgatgcctggcagttccct </td></tr><tr><td> pCR8_R1 </td><td> cgaaccgaacaggcttatgt </td></tr><tr><td> TAL_F1 </td><td> ttggcgtcggcaaacagtgg </td></tr><tr><td> TAL_R2 </td><td> ggcgacgaggtggtcgttgg </td></tr><tr><td> TAL_Seq_5-1 </td><td> catcgcgcaatgcactgac </td></tr></tbody></table> الجدول 1. تسلسل الاشعال المستخدمة في تقارير إتمام المشروعات مستعمرة وتسلسلها داخل التجمع جولدن جيت TALENالبروتوكول. <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> البلازميد / كوكتيل </td><td> مساهم </td><td> Addgene ID </td><td> تعليقات </td></tr><tr><td> جولدن جيت TALEN وTAL المستجيب كيت 2.0 </td><td> Voytas المختبر </td><td> 1000000024 </td><td> يحتوي على جميع البلازميدات اللازمة لجولدن جيت TALEN التجمع </td></tr><tr><td> pCAG-T7-TALEN -KKR/ELD ناقلات الوجهة </td><td> Pelczar المختبر </td><td> 40131، 40132 </td><td> إضافة على البلازميدات لTALEN التعبير في خلايا الثدييات والتوليف مرنا في المختبر </td></tr></tbody></table> الجدول 2. ويمكن الحصول على البلازميدات ومجموعات البلازميد اللازمة لجولدن جيت TALEN التجمع من Addgene ( <a href="http://www.addgene.org">www.addgene.org</a> ). <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> على الانترنتمورد </td><td> تعليقات </td></tr><tr><td> http://tale-nt.cac.cornell.edu </td><td> تصميم TALEN؛ TALEN التنبؤ خارج الهدف </td></tr><tr><td> http://zifit.partners.org/ZiFiT/ </td><td> تصميم TALEN، مفتوح ZFN، كودا ZFN، CRISPR/Cas9 </td></tr><tr><td> http://www.genome-engineering.org </td><td> تصميم TALEN، CRISPR/Cas9؛ CRISPR/Cas9 خارج الهدف التنبؤ </td></tr><tr><td> http://baolab.bme.gatech.edu/Research/BioinformaticTools/assembleTALSequences.html </td><td> جمعية TALEN متواليات لتأكيد نتائج التسلسل </td></tr><tr><td> http://pgfe.umassmed.edu/ZFPmo dularsearchV2.html </td><td> تصميم وحدات التجميع ZFN </td></tr><tr><td> www.genomecenter.ucdavis.edu/s egallab / segallabsoftware </td><td> تصميم وحدات التجميع ZFN </td></tr></tbody></table> الجدول 3. الموارد على الانترنت لتصميم ZFN، TALEN، وCRISPR/Cas9. </sترونج&gt;

Watch this Scientific Journal Video about Mouse Genome Engineering Using Designer Nucleases at JoVE.com

Mouse Genome Engineering Using Designer Nucleases

nucleases مصمم مثل nucleases إصبع الزنك (ZFNs) والنسخ مثل المنشط nucleases المستجيب (TALENs) يمكن استخدامها لتعديل جينوم الفأر الأجنة سابق للانغراس عن طريق إحداث كلا نهاية امتماثلان الانضمام (NHEJ) وإعادة التركيب مثلي (HR) مسارات. هذه التطورات تمكين جيل من الفئران السريع مع التعديلات الجينية دقيقة.

الماوس الجينوم الهندسية عن طريق Nucleases مصمم

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

mouse-genome-engineering-using-designer-nucleases

Research

JoVE Journal

Biology

28.7K Views.  University of Zurich.  nucleases مصمم مثل nucleases إصبع الزنك (ZFNs) والنسخ مثل المنشط nucleases المستجيب (TALENs) يمكن استخدامها لتعديل جينوم الفأر الأجنة سابق للانغراس عن طريق إحداث كلا نهاية امتماثلان الانضمام (NHEJ) وإعادة التركيب مثلي (HR) مسارات. هذه التطورات تمكين جيل من الفئرا...

Video: Mouse Genome Engineering Using Designer Nucleases

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the cellular and molecular features of the epithelia, which are mainly composed of two types of cells: hair cells (HCs) and supporting cells (SCs). Here we choose to study the inner ear sensory epithelia in adult zebrafish not only because the epithelial structures are highly conserved in all vertebrates studied, but also because the adult zebrafish is able to regenerate HCs, an ability that mammals lose shortly after birth. We use the inner ear of adult zebrafish as a model system to study the mechanisms of inner ear HC regeneration in adult vertebrates that could be helpful for clinical therapy of hearing/balance deficits in human as a result of HC loss.
Here we demonstrate how to do gross and fine dissections of inner ear sensory epithelia in adult zebrafish. The gross dissection removes the tissues surrounding the inner ear and is helpful for preparing tissue sections, which allows us to examine the detailed structure of the sensory epithelia. The fine dissection cleans up the non-sensory-epithelial tissues of each individual epithelium and enables us to examine the heterogeneity of the whole epithelium easily in whole-mount epithelial samples.

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

The inner ear sensory epithelium of adult zebrafish is a good model system for understanding the mechanisms of hair cell regeneration in adult vertebrates. This protocol demonstrates the fine dissection of the epithelia, through which we can get tissue samples for studying the regenerative events at cellular and subcellular levels.

الجسيمة والجميلة تشريح الأذن الداخلية الظهارة الحسية في اسماك الزرد الكبار ( دانيو rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Engineering Cell-permeable Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can make use of the translocating ability of so-called cell penetrating peptides (CPPs), also designated as protein transduction domains (PTDs). The TAT-CPP derived from the human immunodeficiency virus type 1 (HIV-1) Tat (trans-activator of transcription) protein has been widely used. The positively charged TAT promotes cell permeability thereby overcoming the barriers of the cellular membrane by endocytosis or/and direct membrane penetration2. In combination with a nuclear localization signal (NLS) fusion proteins are able to enter the nucleus exhibiting functionality. Our video presentation demonstrates, as an exemplification for the engineering of cell-permeable proteins, the construction, production and application of a cell-permeable version of the DNA-modifying enzyme Cre.
Cre is a site-specific recombinase that is able to recognize and recombine 34 base pair loxP sites in mammalian cells in vitro and in vivo. Therefore the Cre/loxP system is widely used to conditionally induce mutations in the genome of living cells3,4. The delivery of active Cre recombinase to cells, however, represents a limitation.
We describe the pSESAME vector system, which allows a direct insertion of the gene-of-interest and provides a platform to rapidly clone different domains and tags used within the vector in a convenient and standardized manner. Rearranging of the different tags has been shown to modify the biochemical properties of the fusion proteins providing a possibility to achieve higher yield and better solubility. We demonstrate how to express and purify recombinant cell-permeant proteins in and from E. coli. The functionality of the recombinant Cre protein is finally validated in cell culture by assessing its intracellular recombinase activity.

Protein transduction enables the direct delivery of biologically active proteins into cells. In contrast to conventional methods such as DNA transfection or viral transduction this non-invasive paradigm allows highly efficient cellular manipulation in a titratable manner circumventing cellular toxicity and the risk of oncogenic transformation by permanent genetic modification.

هندسة الخلايا المنفذة للبروتين

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

الجينوم على نطاق الشاشة لأهداف ميرنا باستخدام معرف الهدف المكتبة MISSION

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

الجينوم التحرير مع مخصص Nucleases CompoZr فنجر الزنك (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

Detection of Rare Genomic Variants from Pooled Sequencing Using SPLINTER

As DNA sequencing technology has markedly advanced in recent years2, it has become increasingly evident that the amount of genetic variation between any two individuals is greater than previously thought3. In contrast, array-based genotyping has failed to identify a significant contribution of common sequence variants to the phenotypic variability of common disease4,5. Taken together, these observations have led to the evolution of the Common Disease / Rare Variant hypothesis suggesting that the majority of the "missing heritability" in common and complex phenotypes is instead due to an individual's personal profile of rare or private DNA variants6-8. However, characterizing how rare variation impacts complex phenotypes requires the analysis of many affected individuals at many genomic loci, and is ideally compared to a similar survey in an unaffected cohort. Despite the sequencing power offered by today's platforms, a population-based survey of many genomic loci and the subsequent computational analysis required remains prohibitive for many investigators.
To address this need, we have developed a pooled sequencing approach1,9 and a novel software package1 for highly accurate rare variant detection from the resulting data. The ability to pool genomes from entire populations of affected individuals and survey the degree of genetic variation at multiple targeted regions in a single sequencing library provides excellent cost and time savings to traditional single-sample sequencing methodology. With a mean sequencing coverage per allele of 25-fold, our custom algorithm, SPLINTER, uses an internal variant calling control strategy to call insertions, deletions and substitutions up to four base pairs in length with high sensitivity and specificity from pools of up to 1 mutant allele in 500 individuals. Here we describe the method for preparing the pooled sequencing library followed by step-by-step instructions on how to use the SPLINTER package for pooled sequencing analysis (<a href="http://www.ibridgenetwork.org/wustl/splinter" target="_blank">http://www.ibridgenetwork.org/wustl/splinter</a>). We show a comparison between pooled sequencing of 947 individuals, all of whom also underwent genome-wide array, at over 20kb of sequencing per person. Concordance between genotyping of tagged and novel variants called in the pooled sample were excellent. This method can be easily scaled up to any number of genomic loci and any number of individuals. By incorporating the internal positive and negative amplicon controls at ratios that mimic the population under study, the algorithm can be calibrated for optimal performance. This strategy can also be modified for use with hybridization capture or individual-specific barcodes and can be applied to the sequencing of naturally heterogeneous samples, such as tumor DNA.

Pooled DNA sequencing is a fast and cost-effective strategy to detect rare variants associated with complex phenotypes in large cohorts. Here we describe the computational analysis of pooled, next-generation sequencing of 32 cancer-related genes using the SPLINTER software package. This method is scalable, and applicable to any phenotype of interest.

الكشف عن المتغيرات الجينية النادرة من تسلسل المجمعة عن طريق سبلينتر

As DNA sequencing technology has markedly advanced in recent years2, it has become increasingly evident that the amount of genetic variation between any ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. iPSCs may be generated using multiple protocols and derived from multiple cell sources. Once generated, iPSCs are tested using a variety of assays including immunostaining for pluripotency markers, generation of three germ layers in embryoid bodies and teratomas, comparisons of gene expression with embryonic stem cells (ESCs) and production of chimeric mice with or without germline contribution2. Importantly, iPSC lines that pass these tests still vary in their capacity to produce different differentiated cell types2. This has made it difficult to establish which iPSC derivation protocols, donor cell sources or selection methods are most useful for different applications.
The most stringent test of whether a stem cell line has sufficient developmental potential to generate all tissues required for survival of an organism (termed full pluripotency) is tetraploid embryo complementation (TEC)3-5. Technically, TEC involves electrofusion of two-cell embryos to generate tetraploid (4n) one-cell embryos that can be cultured in vitro to the blastocyst stage6. Diploid (2n) pluripotent stem cells (e.g. ESCs or iPSCs) are then injected into the blastocoel cavity of the tetraploid blastocyst and transferred to a recipient female for gestation (see Figure 1). The tetraploid component of the complemented embryo contributes almost exclusively to the extraembryonic tissues (placenta, yolk sac), whereas the diploid cells constitute the embryo proper, resulting in a fetus derived entirely from the injected stem cell line.
Recently, we reported the derivation of iPSC lines that reproducibly generate adult mice via TEC1. These iPSC lines give rise to viable pups with efficiencies of 5-13%, which is comparable to ESCs3,4,7 and higher than that reported for most other iPSC lines8-12. These reports show that direct reprogramming can produce fully pluripotent iPSCs that match ESCs in their developmental potential and efficiency of generating pups in TEC tests. At present, it is not clear what distinguishes between fully pluripotent iPSCs and less potent lines13-15. Nor is it clear which reprogramming methods will produce these lines with the highest efficiency. Here we describe one method that produces fully pluripotent iPSCs and "all- iPSC" mice, which may be helpful for investigators wishing to compare the pluripotency of iPSC lines or establish the equivalence of different reprogramming methods.

Generating induced pluripotent stem cell (iPSC) lines produces lines of differing developmental potential even when they pass standard tests for pluripotency. Here we describe a protocol to produce mice derived entirely from iPSCs, which defines the iPSC lines as possessing full pluripotency1.

جيل من الفئران المستمدة من الخلايا الجذعية المحفزة المستحثة

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

Design and Use of Multiplexed Chemostat Arrays

Chemostats are continuous culture systems in which cells are grown in a tightly controlled, chemically constant environment where culture density is constrained by limiting specific nutrients.1,2 Data from chemostats are highly reproducible for the measurement of quantitative phenotypes as they provide a constant growth rate and environment at steady state. For these reasons, chemostats have become useful tools for fine-scale characterization of physiology through analysis of gene expression3-6 and other characteristics of cultures at steady-state equilibrium.7 Long-term experiments in chemostats can highlight specific trajectories that microbial populations adopt during adaptive evolution in a controlled environment. In fact, chemostats have been used for experimental evolution since their invention.8 A common result in evolution experiments is for each biological replicate to acquire a unique repertoire of mutations.9-13 This diversity suggests that there is much left to be discovered by performing evolution experiments with far greater throughput. 
We present here the design and operation of a relatively simple, low cost array of miniature chemostats&mdash;or ministats&mdash;and validate their use in determination of physiology and in evolution experiments with yeast. This approach entails growth of tens of chemostats run off a single multiplexed peristaltic pump. The cultures are maintained at a 20 ml working volume, which is practical for a variety of applications. It is our hope that increasing throughput, decreasing expense, and providing detailed building and operation instructions may also motivate research and industrial application of this design as a general platform for functionally characterizing large numbers of strains, species, and growth parameters, as well as genetic or drug libraries.

We developed and validated a small-footprint array of miniature chemostats built from readily available parts for low cost. Physiological and experimental evolution results were similar to larger volume chemostats. The ministat array provides a compact, inexpensive, and accessible platform for traditional chemostat experiments, functional genomics, and chemical screening applications.

تصميم واستخدام المصفوفات ناظم كيميائي تعدد في الإرسال

Chemostats are continuous culture systems in which cells are grown in a tightly controlled, chemically constant environment where culture density is ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

في النمذجة فيفو من المهووسين الجينوم البشري باستخدام دانيو rerio

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Gene-targeting mutagenesis is now possible in a wide range of organisms using genome editing techniques. Here, we demonstrate a protocol for targeted gene mutagenesis using transcription activator like effector nucleases (TALENs) in Astyanax mexicanus, a species of fish that includes surface fish and cavefish.

الجينوم التحرير في<em&gt; Astyanax mexicanus</em&gt; استخدام النسخ المنشط مثل المستجيب Nucleases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs.  Towards this end, much recent ...

Trans-inner Cell Mass Injection of Embryonic Stem Cells Leads to Higher Chimerism Rates

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current blastocyst injection protocol. Here we report that a simple rotation of the embryo, and injection through Trans-Inner cell mass (TICM) increased the percentage of chimeric mice from 31% to 50%, with no additional equipment or further specialized training. 26 different inbred clones, and 35 total clones were injected over a period of 9 months. There was no significant difference in either pregnancy rate or recovery rate of embryos between traditional injection techniques and TICM. Therefore, without any major alteration in the injection process and a simple positioning of the blastocyst and injecting through the ICM, releasing the ES cells into the blastocoel cavity can potentially improve the quantity of chimeric production and subsequent germline transmission.

Here we present a protocol to increase chimera production without the use of new equipment. A simple orientation change of the embryo for injection can increase the number of embryos produced, and potentially reduce the timeline to germline transmission.

حقن الخلية الداخلية عبر كتلة من الخلايا الجذعية الجنينية يؤدي إلى ارتفاع في أسعار تشيميريسم

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current ...