Biz mükemmel teknik yardım için Monika Tarnowska, Cornelia Albrecht, ve Ewa Skoczylas teşekkür etmek istiyorum. Bu çalışma SNF Sinergia hibe CRSI33-125073 PP tarafından finanse edildi.

<ol>
	<li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat. Rev. Genetics. 6, 507-512 (2005).</li><li>Johansson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+zoo+of+mice+for+genetic+analyses:+a+comprehensive+protocol+for+the+rapid+generation+of+BAC+transgenic+mice.">Building a zoo of mice for genetic analyses: a comprehensive protocol for the rapid generation of BAC transgenic mice.</a> Genesis. 48, 264-280 (2010).</li><li>Skarnes, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+knockout+resource+for+the+genome-wide+study+of+mouse+gene+function.">A conditional knockout resource for the genome-wide study of mouse gene function.</a> Nature. 474, 337-342 (2011).</li><li>Carbery, I. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186, 451-459 (2010).</li><li>Meyer, M., de Angelis, M. H., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+by+homologous+recombination+in+mouse+zygotes+mediated+by+zinc-finger+nucleases.">Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 15022-15026 (2010).</li><li>Cui, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+integration+in+rat+and+mouse+embryos+with+zinc-finger+nucleases.">Targeted integration in rat and mouse embryos with zinc-finger nucleases.</a> Nat. Biotechnol. 29, 64-67 (2011).</li><li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat. Biotechnol. 31, 23-24 (2013).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+production+of+mouse+disease+models+by+embryo+microinjection+of+TALENs+and+oligodeoxynucleotides.">Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides.</a> Proc. Natl. Acad. Sci. U.S.A. 110, 3782-3787 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-Step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-Step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153, 910-918 (2013).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genetics. 11, 636-646 (2010).</li><li>ZFN, T. A. L. E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Joung, J. K., Sander, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TALENs:+a+widely+applicable+technology+for+targeted+genome+editing.">TALENs: a widely applicable technology for targeted genome editing.</a> Nat. Rev. Mol. Cell Biol. 14, 49-55 (2013).</li><li>Cermak, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+design+and+assembly+of+custom+TALEN+and+other+TAL+effector-based+constructs+for+DNA+targeting.">Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting.</a> Nucleic Acids Res. 39, (2011).</li><li>Reyon, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH+assembly+of+TALENs+for+high-throughput+genome+editing.">FLASH assembly of TALENs for high-throughput genome editing.</a> Nat. Biotechnol. 30, 460-465 (2012).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcription+activator-like+effector+toolbox+for+genome+engineering.">A transcription activator-like effector toolbox for genome engineering.</a> Nat. Protoc. 7, 171-192 (2012).</li><li>Kim, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+library+of+TAL+effector+nucleases+spanning+the+human+genome.">A library of TAL effector nucleases spanning the human genome.</a> Nat. Biotechnol. 31, 251-258 (2013).</li><li>Schmid-Burgk, J. L., Schmidt, T., Kaiser, V., Honing, K., Hornung, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ligation-independent+cloning+technique+for+high-throughput+assembly+of+transcription+activator-like+effector+genes.">A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes.</a> Nat. Biotechnol. 31, 76-81 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat. Biotechnol. 31, 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat. Biotechnol. 31, 822-826 (2013).</li><li>Hermann, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+OPEN+zinc+finger+nucleases+for+direct+gene+targeting+of+the+ROSA26+locus+in+mouse+embryos.">Evaluation of OPEN zinc finger nucleases for direct gene targeting of the ROSA26 locus in mouse embryos.</a> PLoS ONE. 7, (2012).</li><li>Meyer, M., Ortiz, O., Hrabe de Angelis, M., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+disease+mutations+by+gene+targeting+in+one-cell+mouse+embryos.">Modeling disease mutations by gene targeting in one-cell mouse embryos.</a> Proc. Natl. Acad. Sci. U.S.A. 109, 9354-9359 (2012).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat. Biotechnol. 29, 143-148 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Doyon, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+zinc-finger-nuclease+activity+with+improved+obligate+heterodimeric+architectures.">Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures.</a> Nat. Methods. 8, 74-79 (2011).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Wefers, B., Wurst, W., K&#252;hn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Haueter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+vasectomy-overexpression+of+Prm1-EGFP+fusion+protein+in+elongating+spermatids+causes+dominant+male+sterility+in+mice.">Genetic vasectomy-overexpression of Prm1-EGFP fusion protein in elongating spermatids causes dominant male sterility in mice.</a> Genesis. 48, 151-160 (2010).</li><li>Perez-Pinera, P., Ousterout, D. G., Brown, M. T., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+to+the+ROSA26+locus+directed+by+engineered+zinc+finger+nucleases.">Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases.</a> Nucleic Acids Res. 40, 3741-3752 (2012).</li><li>Bultmann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+transcriptional+activation+of+silent+oct4+pluripotency+gene+by+combining+designer+TALEs+and+inhibition+of+epigenetic+modifiers.">Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers.</a> Nucleic Acids Res. 40, 5368-5377 (2012).</li><li>Valton, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+TALE+DNA+binding+domain+sensitivity+to+cytosine+methylation.">Overcoming TALE DNA binding domain sensitivity to cytosine methylation.</a> J. Biol. Chem. 287, 38427-38432 (2012).</li><li>Cradick, T. J., Ambrosini, G., Iseli, C., Bucher, P., McCaffrey, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN-Site+searches+genomes+for+zinc+finger+nuclease+target+sites+and+off-target+sites.">ZFN-Site searches genomes for zinc finger nuclease target sites and off-target sites.</a> BMC Bioinform. 12, (2011).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Byers, S. L., Payson, S. J., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+ten+inbred+mouse+strains+following+assisted+reproductive+technologies+(ARTs).">Performance of ten inbred mouse strains following assisted reproductive technologies (ARTs).</a> Theriogenology. 65, 1716-1726 (2006).</li><li>Luo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+strategies+for+6+commonly+used+mouse+strains.">Superovulation strategies for 6 commonly used mouse strains.</a> J. Am. Assoc. Lab. Animal Sci. 50, 471-478 (2011).</li><li>Pease, S., Saunders, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> International Society for Transgenic Technologies. Advanced protocols for animal transgenesis : an ISTT manual. , (2011).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+human+genome+engineering+via+Cas9.">RNA-Guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li></ol>

Yazarlar herhangi bir çıkar çatışması beyan ederim.

Tasarımcı Nükleaza odaklı genom düzenleme yaklaşımları önemli ölçüde kendi genomları 10,12 hedeflenen değişiklikler için uygun türlerin yelpazesini genişletmiştir. Farelerde, gen hedefleme ES hücrelerinin iki yıldır standart bir teknik olmuştur; fare ES hücreleri, bazı son başarılı olmuştur, ancak bununla birlikte, bu, fare dışındaki türlerden ES hücrelerine adapte zor olduğu kanıtlanmıştır. Hatta böyle EUCOMM, KOMP veya ZFN ve TALEN yüksek hassasiyet olabilir ve değişiklikler yelpazenin ilgili esneklik sağlar tarafından NorCOMM 3 genom düzenleme gibi konsorsiyumlar tarafından sunulan &quot;off-the-raf&quot; gen-hedefli fare ES hücre klonlarının durumu ile fare genomuna sokulur. Nükleaz aracılı mutasyonlar taşıyan Kurucu hayvanların her zaman ES hücrelerinin enjeksiyonu blastosist kaynaklanan kimera için durum böyle değildir yüksek germ-hattı yetkili 4-6,20,21, görünmektedir. Bu nedenle, bazı durumlarda des mikroenjeksiyon inigner nükleazlar hedef genom modifikasyonlarla yeni fare hatları önemli ölçüde daha hızlı üretimi ile sonuçlanabilir. ZFN ve yetenekleri yeri püskürtülmesiyle knockout farelerde başarılı bir şekilde üretimi enjekte nükleaz çiftinin aktivitesi üzerinde büyük ölçüde bağlıdır. TALENS organizma bir dizi gen geniş bir hedef yüksek başarı oranına sahip olduğu gösterilmiştir; Bununla birlikte, son çalışmalar TALEN bağlayıcı sitozin metilasyon 30,31 duyarlı olduğunu göstermektedir. Böylece, yeni üretilen nükleaz çiftleri, örneğin TALENS pCAG-T7 vektörlerine klonlanır, örneğin NIH-3T3 veya Nöro gibi bir fare hücre hattı içine geçici olarak transfekte edilebilir bir ölçüde fare embriyo kromatin durumunu taklit-2a. Burada, nükleaz aktivitesi önceden mRNA sentezi ve mikroenjeksiyon bölüm 5&#39;de tarif edildiği gibi T7 endonükleaz analizi ya da PCR ürünü bir sınırlama sindirimi kullanan tahmin edilebilir. Bu bağlamda ilgili genomik bölgenin sıralama tavsiyehücre çizgisi ve mikro-enjeksiyon deneyleri için kullanılan fare suşu ive. Fare zigot, farklı TALEN veya ZFN çiftleri farklı mRNA konsantrasyonlarda en iyi şekilde çalışır ve bu nedenle mikro-enjekte nükleaz mRNA&#39;nın en uygun çalışma konsantrasyonu deneysel olarak tespit edilmesi gerekebilir. Çok yüksek embriyo ölümcül neden olabilir, oysa nükleaz çift bağlı olarak, çok düşük bir konsantrasyonunun bir yarılmaya neden olur. Nukleaz çifti bağlı olarak, 2 ng / ul ve 200 mikrogram / ul gibi yüksek kadar düşük toplam mRNA konsantrasyonları kullanarak başarı oldu. Bu etkiler, hücre kültürü ve embriyo hayatta kalma ve hedef lokusunun modifikasyonu oranı her iki deneysel olarak tespit edilmesi gerekmektedir için optimum konsantrasyon nükleaz deney tahmin etmek güçtür. Yüksek aktif ZFN veya TALEN mikroenjeksiyon embriyo tek hücreli aşamada ötesinde hedef sekansı ayrılması ve bu nedenle mutagenez An karmaşık kalıpları neden olabilirkurucuları d mozaisizm. Biz ve diğerleri 4, tek bir kurucu (Şekil 5C) üç veya daha fazla farklı mutasyona uğramış allelleri gözlemledik. Bu kurucuları yeni bir fare hattı kurulması Böylece, yavrular dikkatle sindirim deneyler, tanımlanmamış bir mutasyon mevcut tek olduğunu kanıtlar sağlarlar uygun mutasyonun varlığı için sıralanmasıyla taranmalıdır. Eleştirilerden biri sık sık ZFN ve TALEN sistemlerine karşı dile getirdiği bu nükleazlar da hedef sitelere benzer genomunda başka bir yerde mevcut dizilerini klivajlayabilen olasılığıdır. Bu gibi hedef dışı etkiler homodimerik Fokl alanı kullanarak erken üretimi reaktifleri ile gözlenmiştir ve heterodimer konstruktları hedef dışı etkiler 25 hafifletmek için dizayn edilmiştir. Olası hedef dışı siteleri silico 32,33 bir dereceye kadar öngörülen ve PCR ve dizileme ile taranabilir. Bariz bir avantaj of yerine hücre çizgileri daha farelerin üretilmesi için ZFNs ve TALENS kullanan tercih edilen bir vahşi tip suşu için çeşitli çaprazlamaların gerçekleştirerek arzu edilen genom modifikasyona bağlanmamış hedef mutasyonları kapalı kaldırma olasılığıdır. Kurucu farelerin çok sayıda, nükleaz hedefli lokusundan üretilir ve siliko hedef dışı tahmin edilen PCR ürünlerinin nesil derin sekanslama analizi için noktalar, PCR ürünlerinin sindirim deneyleri için alternatif bir nicel ve nitel okuma sunabilir. Bu protokol açıklanan yardımla üreme teknikleri gibi C57Bl/6J veya B6D2F1 gibi mikroenjeksiyon deneyleri için kullanılan standart fare suşları için optimize edilmiştir. Bu tür suşlar outbred gibi farklı orijinlerden Fareler, prensip olarak genom düzenleme yaklaşımlar için kullanılabilir ve özel araştırma soru için daha uygun bir genetik arka planı sağlayabilir. Böyle süperovülasyon gibi yardımla üreme tekniklerinin performansı predi olabilirsuşları 34-36 bir dizi cted ama nükleaz mikroenjeksiyon için embriyo yeterli sayıda elde etmek için standart olmayan suşlar için daha fazla optimizasyon gerektirebilir. ZFN ve Yeten yanı sıra, bu tür RNA-güdümlü CRISPR/Cas9 sistemi 9,37,38 gibi yeni tasarımcı nükleazlar şimdi genom düzenleme uygulamaları için getirilmiştir. Mikroenjeksiyon ve burada tarif edilen kurucu hayvan analiz için tüm yöntemler de CRISPR/Cas9 ve genom düzenleme gelecek modları için de geçerlidir.

Fareler transgenik hayvan modelleri oluşturmak için ana kadar en popüler platform tarafından bulunmaktadır. Fare embriyo 1-3 genetik mühendisliği için çok yönlü bir araç son zamanlarda, örneğin çinko parmak nükleazlara (ZFN) gibi tasarımcı nükleazlara göre genom düzenleme yaklaşımlarla 4-6, transkripsiyon aktivatör gibi efektör nükleazlar (TALEN) 7,8 uzatıldı ve kümelenmiş düzenli interspaced kısa palindromık tekrarlar (CRISPR) / CRISPR-ilişkili (Cas) 9 9. ZFN ve her Fokl endonükleaz 10-12 birleştirilir (sırasıyla çinko parmak proteinlerin dizileri ve tekrar-değişken di-tortuları (RVDs),), iki özel olarak tasarlanmış protein bazlı DNA-bağlayıcı etki çiftleri olarak işlev TALEN. Tersine, Cas9-aracılı DNA parçalanmasının özgüllüğü (aynı zamanda, tek bir kimerik RNA molekülü olarak geçecek kılavuz RNA birleştirilebilir crRNA ve tracrRNA) CRISPR RNA transaktive tarafından sağlanan ile bir kompleks içinde hareket 11CRISPR proteini. RVDs tanımlanmış bir dizi ile Talens hızla 13-17 seçmek için montaj stratejileri çok sayıda bireysel deneyciler tarafından inşa edilebilir. CRISPR/Cas9 ancak kılavuz RNA-DNA özgünlüğü hala tam 18,19 çözülmüş değil bağlama, tasarımcı nükleazların daha az emek-yoğun nesil vaat ediyor. Özel ZFNs nesil şimdiye kadar uzman akademik laboratuarları ve bu Sangamo Biyobilimlerdeki ve Sigma CompoZr hizmet olarak ticari tedarikçiler ile sınırlı olmuştur. Genel olarak, tasarımcı nükleazlara ile düzenleme genom sonradan katılan homolog olmayan uç (NHEJ) veya homolog rekombinasyon (HR) DNA onarım makine 10,12 çekmek tanımlanan genomik loci, at çift iplikli sonları (DSB) tanıtmayı amaçlamaktadır. Bir DSB aracılı NHEJ onarım genellikle tamir yerinde yakın eklemeler ve silmeler getirilmesi ile sonuçlanır. Böylece NHEJ onarım cBir genlerin protein kodlama sekansı 4,7,9 içinde bir çerçeve kayma mutasyonu getirerek, bir hedef genin işlevi nakavt için yararlanılabilir. Alternatif olarak, ek veya tanımlanmış genetik bilginin değiştirilmesi tasarımcı nükleazlar ile birlikte bir DNA donör temin edilmesiyle elde edilebilir. Bir DNA donör Böylece HR ile DSB onarım için bir şablon olarak hizmet veren hedef alan ile homoloji bölgeleri ile çevrili araştırmacı tasarlanmış DNA dizileri içerir. Plazmidler 5,6,20 ve tek sarmallı oligonükleotid 8,9,21 Hem verici olarak başarılı bir şekilde kullanılmıştır. NHEJ-nor HR-aracılı genom düzenleme ne genel genetik mimari bozmadan nükleotid sekansında küçük değişikliklere oluşturmak için bu stratejiler özellikle uygun hale getirir, fare embriyo, genomuna bir seçilebilir markerin giriş gerektirir. Bu protokolde genom düzenleme için gerekli tüm prosedürler açıklanmaktadırTalens kullanılarak fare embriyosu. Bunlar TALEN hedef site 22 1) tanımlanmasını içerir, golden gate klonlama 13 tarafından Talens 2) yapım, TALEN mRNA, döllenmiş fare oosit, embriyo transferi için 5) cerrahi girişimler içine TALEN mRNA 4) mikroenjeksiyon 3) in vitro sentez ve 6) kurucusu hayvanlarda TALEN kaynaklı mutagenez analizi. Biz TALEN mRNA mikroenjeksiyon ve NHEJ kaynaklı eklemeler / silmeler için kurucularından tarama odaklanmak. Bu amaçla plazmid olarak ve fare embriyoları mikro enjeksiyon için TALEN mRNA in vitro sentezi transfekte zaman memeli hücrelerinde hem de ifade edilmesine olanak iki fonksiyonlu TALEN yapıları yarattı. Bu yapılar, heterodimerik Foki kaynaşmış bir kesik TALE omurga 23 Memeli hücrelerinde optimum genom düzenleme için 24,25 etki içermektedir. Bu protokol, aynı zamanda, diğer tasarım nükleazlara mikroenjeksiyonu için veya tasarımcı nükleazlara birleşik enjeksiyon için kabul edilebilirve verici yapıları (DNA donör tasarım Wefers et al. 26,27 ile mükemmel bir teknik yayınlarda tarif edilmiştir). Etik Bildirimi Tüm hayvan deneyleri Kanton Zürih Kanton Veteriner Ofisi kurallara ve yönetmeliklere uygun olarak yapıldı.

<table border="0" cellpadding="0" cellspacing="0" width="524">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">BsaI</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">R0535S or L</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Esp3I</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">ER0451</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T4 Ligase</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0202S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Spectinomycin</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">S0692-1ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ampicillin&#160;</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">A0166</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">X-Gal</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">B4252</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">IPTG</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">I6758</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Plasmid-Safe nuclease</td>
			<td style="width:111px;">Epicentre</td>
			<td style="width:119px;">E3101K</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">27106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAGEN Plasmid Midi Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">12143</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAquick PCR Purification Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">28106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">mMESSAGE mMACHINE T7 Ultra Kit</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM1345</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NucAway Spin Columns</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM10070</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNaseZAP</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">R2020-250ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NorthernMax Formaldyde Load Dye</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM8552</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNA Millennium Markers</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM7150</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">10x TBE buffer</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">B52</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T7 endonuclease</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0302S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">pGEM-T EasyVector System I</td>
			<td style="width:111px;">Promega</td>
			<td style="width:119px;">A3600</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">SYBR Green I Nucleic Acid Gel Stain</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">S-7563</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">pregnant mare&#39;s serum gonadotrophin (PMSG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">G4877</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">human chorionic gonadotropin (hCG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">CG5</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M2 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7167</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M16 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7292</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Mineral oil, embryo tested</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M8410</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ketamine</td>
			<td style="width:111px;">CentraVet</td>
			<td style="width:119px;">Ket 201</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Xylazine</td>
			<td style="width:111px;">Sigma Aldrich</td>
			<td style="width:119px;">46995</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Equipment/Tools</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Inverted microscope with Nomarski DIC optics (for example Nikon Eclipse TE200)</td>
			<td style="width:111px;">Nikon</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Micromanipulator units (for example Narishige, NT88NF)</td>
			<td style="width:111px;">&#160;Narishige</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo holding capillaries</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;">B100-75-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo injection capillaries</td>
			<td style="width:111px;">Narishige</td>
			<td style="width:119px;">GD-1</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Capillary puller (for example Sutter P97)</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Microforge (for example Narishige MF-900)</td>
			<td style="width:111px;">Narishige&#160;</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Walton skin scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14077-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14041-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical probe</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">10140-03</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clip system (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12031-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clips (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12032-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dumont fine forceps 5</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11254-20</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria curvrd forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11370-31</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria fine forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11399-80</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dietrich bulldog clamp</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">18038-45</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Animals</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">C57BL/6J mice</td>
			<td style="width:111px;">Jackson labs</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">CD-1 mice</td>
			<td style="width:111px;">Charles river</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
	</tbody>
</table>

mouse genome engineering using designer nucleases

Site özel genom değişiklikler (nakavt, knock-in) taşıyan transgenik fareler karmaşık biyolojik sistemleri diseksiyon yanı sıra insan hastalıklarının modelleme ve tedavi stratejileri test etmek için hayati önem taşımaktadır. Böyle çinko parmak nükleazlardır (ZFNs), transkripsiyon aktivatörü gibi efektör nükleazlardır (Talens) ve kümelenmiş düzenli interspaced kısa yineleyen tekrarlar (CRISPR) / için CRISPR-ilişkili (Cas) 9 sistemi yerinde gibi tasarımcı nükleazların kullanımı son gelişmeler Belirli bir genom mühendislik embriyonik kök (ES) hücre teknolojisi güvenmek gerek kalmadan hemen hemen herhangi bir laboratuvar türlerde hızlı hedef genom modifikasyonu gerçekleştirmek için olasılığını açığa çıkarır. Bir genom düzenleme deney tipik olarak tanımlı bir araştırmacı genomik nükleaz aktivitesi yönlendirmek için özel DNA bağlayıcı etki yapımında ardından ilgi konusu bir gen içinde bir tasarımcı nükleaz hedef siteye belirlenmesi ile başlar. Tasarımcı nükleaz plazmidler in vitro olarak &#39;/ Em&gt; döllenmiş fare oosit mikroenjeksiyon için mRNA oluşturmak için transkripsiyonu. Burada, döllenmiş fare oositlerine TALEN mRNA&#39;nın direkt enjeksiyonu ile hedef genom modifikasyonu elde edilmesi için bir protokol sağlar.

Bu memeli hücrelerinde TALENS sentezlenmesini hem de T7 faj promoteri (Şekil 1C) için in vitro mRNA sentezine izin vermek Cermak&#39;ın et al. 13 tarafından yayınlanan Altın GateTALEN düzeneği ile uygun hedef plazmidleri yapılmıştır. Bu plazmidler Fokl homodimerler göre hedef dışı etkileri azaltmak ve Fokl 25,29 heterodimerler ilk nesil ile karşılaştırıldığında bölünme etkinliğini arttırmak için gösterilmiştir heterodimerik Fokl etki (ELD veya KKR mutasyonlar) taşır. Altın kapı montaj reaksiyonlar # 1 ve # 2 genellikle çok verimli ve her beyaz koloni, koloni PCR ile analiz edildiğinde, klonlanmış RVDs (Şekil 1B ve 1D) belirli sayıda için beklenen modelini gösterir. In vitro sentezlenen mRNA Jel analizi (Şekil 2) ile analiz edilir, her bir numune için çok az veya hiç smear ile tek bir bant açığa ayırt edilmelidir. Başarılı poliadenilasyona gösterir örnekleri L1/R1 ve L2/R2, L3/R3 arasında net bir boyut değişim var olmalıdır. Kurucu hayvanların bir enzim kullanılarak, ya T7 endonükleaz sindirimi ve ardından genotipleme PCR (Şekil 3) ya da bir sınırlandırma sindirimi kullanan NHEJ indüklenen mutasyona uğramış aleller için taranabilir nükleaz çiftinin boşluk bölgesi içinde yaran vahşi tip sekans (Şekil 4),. T7 endonükleaz deney bağımsız enjekte nükleaz çiftinin boşluk bölgesi içinde belirli bir genomik sekansın mutasyonu herhangi bir uygulanabilir; Bununla birlikte, bu heterodupleks PCR ürünleri DNA elyaf arasında sadece uyumsuzluklarını bulgulamaktadır. Böylece, kurucu iki aynı mutasyona uğramış allel taşıyan nadir durumlarda, PCR ürünleri herhangi T7 sindirim desen göstermek olmaz. Belirli bir kısıtlama alanı NHEJ tarafından yok edilecek nükleaz boşluk bölgesi içinde yer almaktadır Bu tür bir ayrım her zaman, ancak, mümkünEklemeler / silmeler (Şekil 5) ile indüklenen. Burada, sindirilmemiş bantları mutasyonların varlığını gösterir ve her sindirilmiş ürünlerin yokluğu güçlü (Şekil 4b&#39;de yıldız ile işaretlenmiştir) hedeflenen genin her iki allel içinde mutasyonlar taşıyan bir kurucu göstermektedir. <img alt="Şekil 1" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig1highres.jpg" src="/files/ftp_upload/50930/50930fig1.jpg" width="600" /> Şekil 1. Pfus vektörlere RVD diziler Heterodimerik pCAG-T7-Hedef vektörlere TALEN RVDs Golden Gate klonlama. A) Meclis. İşte bir örnek birey MASALI diziler, sırasıyla, 15 ve 17 RVDs RVDs oluşan bir TALEN çifti için gösterilmiştir (uzun 21 RVDs daha MASALI diziler için, üç pfus-RVDs meclisleri gösterilmez, gerekli). Oklar pfus spesifik koloni PCR reaksiyonları. B) PCR ürünleri belirtmek için primerlerDoğru pfus meclisleri büyütüldü tipik) bir grup klonlanmış tüm RVDs (10 RVDs örneğin yaklaşık 1.1 kb) ve bir bitiş RVD dizilerin tekrarlayan doğa için daha küçük daha az önemli gruplarından &quot;merdiven&quot;. C&#39;nin kombine uzunluğuna tekabül göstermek son montaj pfus-RVD dizileri sırasıyla FokIELD ve FokIKKR varyantları ile heterodimerik TALEN ekspresyon vektörleri içine, son tekrar (plr) ihtiva eden bir plazmid. (N-ve C açıklamalı) TALEN omurga T7 faj promoteri de sağlar iken CAG (CMV erken güçlendirici element / tavuk beta-aktin) promoteri, transfekte memeli hücrelerinde yüksek düzeyde ekspresyon sağlayan Miller et al. 23 tarafından yayınlanan benzer bir mimari nitro mRNA sentezi (nükleaz STOP kodonu alt vektörün doğrusallaştırılması için SacI kullanım). D) C oklarla gösterilen primerler kullanılarak koloni PCR) doğru monte TALENS tanımlanmasını sağlar. Tam lengt&quot;merdiven etkisi&quot; başarılı montaj sağlam bir göstergesini temsil ederken h PCR ürünleri genellikle daha az belirgindir. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig1highres.jpg" target="_blank">resmi büyütmek için buraya tıklayın</a> . <img alt="Şekil 2," fo:content-width="3in" fo:src="/files/ftp_upload/50930/50930fig2highres.jpg" src="/files/ftp_upload/50930/50930fig2.jpg" width="300" /> Şekil 2. . Agaroz jel elektroforezi kullanılarak in vitro sentezi nukleaz mRNA kalite kontrol ZFN mRNAlarının bir örnek olarak gösterilmiştir (L, ZFN sol, R, sağ ZFN). Numuneler önce poliadenilasyonunun mRNA göstermek L1/R1, mRNA ve L3/R3 poliadenillenmiş örnekleri L2/R2 gösteri saflaştırılmış poliadenile mRNA göstermektedir. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig2highres.jpg" target="_blank">resmi büyütmek için buraya tıklayın</a> . <img<html> içerik-genişliği fo = &quot;6in&quot;: src = &quot;/ files/ftp_upload/50930/50930fig3highres.jpg&quot; src = &quot;/ files/ftp_upload/50930/50930fig3.jpg&quot; width = &quot;600&quot; fo alt = &quot;Şekil 3&quot; /&gt; Şekil 3,. Hedef lokusunun nükleaz ile indüklenen mutasyon taşıyan Kurucu hayvanların tanımlanması için kullanılan bir T7 endonükleaz tahlilin örneği. A) TALEN çift fare prion proteini geni (PRNP kodlayıcı bölge içinde bölmek için tasarlanmıştır, TALEN hedef sekansı), istek üzerine temin edilebilir. Bir PCR ürünü, PCR ürünü daha sonra oluşum ve T7 endonükleaz sindirim hetero tabi tutulur, 110 bp yukarı yer alan bir ileri primer (F) ve ters primer (R) TALEN bölünme sitesinin. B alt 250 bp) kullanılarak oluşturulur. ° C) tek kurucu hedeflenen genomik bölge içinde TALEN kaynaklı mutagenez sindirim 250 ürün ve 110 baz ile tam uzunlukta PCR ürününün varlığı ile ortaya çıkar.50930/50930fig3highres.jpg &quot;target =&quot; _blank &quot;&gt; büyük resmi görebilmek için buraya tıklayın. <img alt="Şekil 4," fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig4highres.jpg" src="/files/ftp_upload/50930/50930fig4.jpg" width="600" /> Şekil 4. Hedef lokusunun nükleaz ile indüklenen mutasyon fare Rosa26 lokusu 29 hedef intron 1 içinde bir Xbal kısıtlama alanı için. ZFN özgü taşıma Kurucu hayvanların belirlenmesi için kullanılan PCR ürünleri restriksiyon dijest örneği. A) Kurucular kullanılarak PCR ile taranmıştır genotiplenmesi ileri primer (F) 500 bp üst baş ve ters primer (R) yarılma sitesi. B alt 250 bp) Xbal ile PCR ürünleri sindirim yıldız işareti ile işaretlenmiştir iki alelik mutasyonlarla fareleri () gösteren sindirim desenler ortaya, mono bulunduğu -alelik mutasyon (sindirilmiş ve sindirilmemiş grupları, örneğin, hayvan 2)potansiyel bi-alel değişiklikler ile farelerin ve wt fareler (tam sindirim, örneğin, hayvan 21). C) Dizi 3 (hayvan 24) farklı eklemeler / silmeler kadar gösterir. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig4highres.jpg" target="_blank">resmi büyütmek için buraya tıklayın</a> . <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Primer Adı </td><td> &#39;Ila 3&#39; sekans 5 </td></tr><tr><td> pCR8_F1 </td><td> ttgatgcctggcagttccct </td></tr><tr><td> pCR8_R1 </td><td> cgaaccgaacaggcttatgt </td></tr><tr><td> TAL_F1 </td><td> ttggcgtcggcaaacagtgg </td></tr><tr><td> TAL_R2 </td><td> ggcgacgaggtggtcgttgg </td></tr><tr><td> TAL_Seq_5-1 </td><td> catcgcgcaatgcactgac </td></tr></tbody></table> Tablo 1. Golden Gate TALEN takımı içinde koloni PCR analizleri ve sekanslama için kullanılan primerlerin dizileriprotokolü. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Plazmid / Koleksiyon </td><td> Iştirakçi </td><td> Addgene Kimliği </td><td> Yorumlar </td></tr><tr><td> Golden Gate TALEN ve TAL Efektör Kit 2.0 </td><td> Voytas laboratuvar </td><td> 1000000024 </td><td> Golden Gate TALEN montaj için gerekli tüm plazmidler İçeriyor </td></tr><tr><td> pCAG-T7-TALEN -KKR/ELD hedef vektörleri </td><td> Pelczar laboratuvar </td><td> 40131, 40132 </td><td> Eklenti, memeli hücreleri ve in vitro mRNA sentezindeki TALEN ifadesi için plazmidler </td></tr></tbody></table> Tablo 2. Golden Gate TALEN montaj için gerekli olan plasmidler ve plasmid koleksiyon Addgene (elde edilebilir <a href="http://www.addgene.org">www.addgene.org</a> ). <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> ÇevrimiçiKaynak </td><td> Yorumlar </td></tr><tr><td> http://tale-nt.cac.cornell.edu </td><td> Yeten Tasarımı; TALEN hedef dışı tahmini </td></tr><tr><td> http://zifit.partners.org/ZiFiT/ </td><td> Yeten, AÇIK ZFN, CoDA ZFN, CRISPR/Cas9 Tasarımı </td></tr><tr><td> http://www.genome-engineering.org </td><td> Yeten, CRISPR/Cas9 Tasarımı; CRISPR/Cas9 hedef dışı tahmini </td></tr><tr><td> http://baolab.bme.gatech.edu/Research/BioinformaticTools/assembleTALSequences.html </td><td> Yeten Meclisi sıralama sonuçlarının doğrulanması için dizileri </td></tr><tr><td> http://pgfe.umassmed.edu/ZFPmo dularsearchV2.html </td><td> Modüler montaj ZFN tasarımı </td></tr><tr><td> www.genomecenter.ucdavis.edu/s egallab / segallabsoftware </td><td> Modüler montaj ZFN tasarımı </td></tr></tbody></table> Tablo 3. ZFN, Yeten, ve CRISPR/Cas9 tasarımı için online kaynaklar. </strong&gt;

Watch this Scientific Journal Video about Mouse Genome Engineering Using Designer Nucleases at JoVE.com

Mouse Genome Engineering Using Designer Nucleases

Örneğin çinko parmak nükleazlara (ZFNs) ve transkripsiyon aktivatörü gibi efektör nükleazlara (TALENS) olarak tasarımcı nükleazlar homolog olmayan uç birleştirme (NHEJ) ile homolog yeniden birleştirmeye (HR) yolaklar tetikleyerek fare preimplantasyon embriyoların genomunu değiştirmek için kullanılabilir. Bu gelişmeler kesin genetik değişiklikler farelerde hızlı üretimini sağlar.

Tasarımcı nükleazlar kullanılması Fare Genom Mühendisliği

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

mouse-genome-engineering-using-designer-nucleases

Research

JoVE Journal

Biology

28.7K Görüntüleme.  University of Zurich.  Örneğin çinko parmak nükleazlara (ZFNs) ve transkripsiyon aktivatörü gibi efektör nükleazlara (TALENS) olarak tasarımcı nükleazlar homolog olmayan uç birleştirme (NHEJ) ile homolog yeniden birleştirmeye (HR) yolaklar tetikleyerek fare preimplantasyon embriyoların genomunu değiştirmek için kullanılabilir. Bu gelişmeler kesin genetik değişiklikler farelerde hızlı üretimini sağlar. 

Video: Mouse Genome Engineering Using Designer Nucleases

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the cellular and molecular features of the epithelia, which are mainly composed of two types of cells: hair cells (HCs) and supporting cells (SCs). Here we choose to study the inner ear sensory epithelia in adult zebrafish not only because the epithelial structures are highly conserved in all vertebrates studied, but also because the adult zebrafish is able to regenerate HCs, an ability that mammals lose shortly after birth. We use the inner ear of adult zebrafish as a model system to study the mechanisms of inner ear HC regeneration in adult vertebrates that could be helpful for clinical therapy of hearing/balance deficits in human as a result of HC loss.
Here we demonstrate how to do gross and fine dissections of inner ear sensory epithelia in adult zebrafish. The gross dissection removes the tissues surrounding the inner ear and is helpful for preparing tissue sections, which allows us to examine the detailed structure of the sensory epithelia. The fine dissection cleans up the non-sensory-epithelial tissues of each individual epithelium and enables us to examine the heterogeneity of the whole epithelium easily in whole-mount epithelial samples.

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

The inner ear sensory epithelium of adult zebrafish is a good model system for understanding the mechanisms of hair cell regeneration in adult vertebrates. This protocol demonstrates the fine dissection of the epithelia, through which we can get tissue samples for studying the regenerative events at cellular and subcellular levels.

Yetişkin Zebra balığı İç Kulak Duyu Epiteli Brüt ve Güzel Diseksiyon ( Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Biyoloji

Engineering Cell-permeable Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can make use of the translocating ability of so-called cell penetrating peptides (CPPs), also designated as protein transduction domains (PTDs). The TAT-CPP derived from the human immunodeficiency virus type 1 (HIV-1) Tat (trans-activator of transcription) protein has been widely used. The positively charged TAT promotes cell permeability thereby overcoming the barriers of the cellular membrane by endocytosis or/and direct membrane penetration2. In combination with a nuclear localization signal (NLS) fusion proteins are able to enter the nucleus exhibiting functionality. Our video presentation demonstrates, as an exemplification for the engineering of cell-permeable proteins, the construction, production and application of a cell-permeable version of the DNA-modifying enzyme Cre.
Cre is a site-specific recombinase that is able to recognize and recombine 34 base pair loxP sites in mammalian cells in vitro and in vivo. Therefore the Cre/loxP system is widely used to conditionally induce mutations in the genome of living cells3,4. The delivery of active Cre recombinase to cells, however, represents a limitation.
We describe the pSESAME vector system, which allows a direct insertion of the gene-of-interest and provides a platform to rapidly clone different domains and tags used within the vector in a convenient and standardized manner. Rearranging of the different tags has been shown to modify the biochemical properties of the fusion proteins providing a possibility to achieve higher yield and better solubility. We demonstrate how to express and purify recombinant cell-permeant proteins in and from E. coli. The functionality of the recombinant Cre protein is finally validated in cell culture by assessing its intracellular recombinase activity.

Protein transduction enables the direct delivery of biologically active proteins into cells. In contrast to conventional methods such as DNA transfection or viral transduction this non-invasive paradigm allows highly efficient cellular manipulation in a titratable manner circumventing cellular toxicity and the risk of oncogenic transformation by permanent genetic modification.

Mühendislik Hücre geçirgen Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Genome-wide Analysis of Aminoacylation (Charging) Levels of tRNA Using Microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both prokaryotic and eukaryotic cells lead to translational regulation which is a major cellular mechanism of stress response. Familiar examples are the stringent response in E. coli and the Gcn2 stress response pathway in yeast ([2-6]). Recent work in E. coli and S. cerevisiae have shown that tRNA charging patterns are highly dynamic and depends on the type of stress experienced by cells [1, 6, 7]. The highly dynamic, variable nature of tRNA charging makes it essential to determine changes in tRNA charging levels at the genomic scale, in order to fully elucidate cellular response to environmental variations. In this review we present a method for simultaneously measuring the relative charging levels of all tRNAs in S. cerevisiae . While the protocol presented here is for yeast, this protocol has been successfully applied for determining relative charging levels in a wide variety of organisms including E. coli and human cell cultures[7, 8].

Genome-wide Analysis of Aminoacylation Charging Levels of tRNA Using Microarrays

We describe a method for microarray analysis to determine relative aminoacylation levels of all tRNAs from S. cerivisiae.

Mikroarray&#39;ler kullanarak tRNA Aminoacylation (Şarj) Seviyeler genom Analizi

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both ...

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Izoform özel Gen Hedefler Belirlemek için ChIP kullanarak genom analizi

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Human cancer and response to therapy is better represented in orthotopic animal models. This paper describes the development of an orthotopic mouse model of ovarian cancer, treatment of cancer via oral delivery of drugs, and monitoring of tumor cell behavior in response to drug treatment in real time using in vivo imaging system. In this orthotopic model, ovarian tumor cells expressing luciferase are applied topically by injecting them directly into the mouse bursa where each ovary is enclosed. Upon injection of D-luciferin, a substrate of firefly luciferase, luciferase-expressing cells generate bioluminescence signals. This signal is detected by the in vivo imaging system and allows for a non-invasive means of monitoring tumor growth, distribution, and regression in individual animals. Drug administration via oral gavage allows for a maximum dosing volume of 10 mL/kg body weight to be delivered directly to the stomach and closely resembles delivery of drugs in clinical treatments. Therefore, techniques described here, development of an orthotopic mouse model of ovarian cancer, oral delivery of drugs, and in vivo imaging, are useful for better understanding of human ovarian cancer and treatment and will improve targeting this disease.

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Orthotopic animal models of ovarian cancer replicate better human disease and therefore enhance our understanding of cancer progression and tumor response to therapy. A mouse model receives an intrabursal injection of luciferase-expressing ovarian tumor cells. Treatment is administered via oral gavage. Tumor growth is monitored by in vivo imaging system.

In vivo Görüntüleme ve Yumurtalık Kanseri Ortotopik Fare Modeli Tedavi Tedaviler

Human cancer and response to therapy is better represented in orthotopic animal models.  This paper describes the development of an orthotopic mouse model ...

Flow Cytometry Purification of Mouse Meiotic Cells

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the unique differentiation programs that are manifest during meiosis. Two principal methods have been developed to purify, to varying degrees, various meiotic fractions from both adult and immature animals: elutriation or Staput (sedimentation) using BSA and/or percoll gradients. Both of these methods rely on cell size and density to separate meiotic cells1-5. Overall, except for few cell populations6, these protocols fail to yield sufficient purity of the numerous meiotic cell populations that are necessary for detailed molecular analyses. Moreover, with such methods usually one type of meiotic cells can be purified at a given time, which adds an extra level of complexity regarding the reproducibility and homogeneity when comparing meiotic cell samples.
Here, we describe a refined method that allows one to easily visualize, identify, and purify meiotic cells, from germ cells to round spermatids, using FACS combined with Hoechst 33342 staining7,8. This method provides an overall snapshot of the entire meiotic process and allows one to highly purify viable cells from most stage of meiosis. These purified cells can then be analyzed in detail for molecular changes that accompany progression through meiosis, for example changes in gene expression9,10and the dynamics of nucleosome occupancy at hotspots of meiotic recombination11.

An efficient method to obtain highly purified viable meiotic fractions from mouse testis is described, which combines a refined cell dissociation protocol with fluorescent activated cell sorting (FACS). This method takes advantage of differences in the DNA content and nuclear density of discrete meiotic fractions.

Fare Mayotik Hücreler Sitometrisi Arıtma

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

MİSYON Hedef Kimliği Kütüphane Kullanımı miRNA Hedefler için genom Ekran

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

CompoZr Özel Çinko Parmak Nükleazlar ile Genom Düzenleme (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

Br.rerio kullanarak Morbid İnsan Genomu İn Vivo Modelleme

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Gene-targeting mutagenesis is now possible in a wide range of organisms using genome editing techniques. Here, we demonstrate a protocol for targeted gene mutagenesis using transcription activator like effector nucleases (TALENs) in Astyanax mexicanus, a species of fish that includes surface fish and cavefish.

genom Düzenleme<em&gt; Astyanax mexicanustan</emKullanma&gt; Transkripsiyon Aktivatör benzeri Efektör Nükleazlar (Talens)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs.  Towards this end, much recent ...