We would like to thank Monika Tarnowska, Cornelia Albrecht, and Ewa Skoczylas for excellent technical assistance. This study was funded by SNF Sinergia grant CRSI33-125073 to PP.

<ol>
	<li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat. Rev. Genetics. 6, 507-512 (2005).</li><li>Johansson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+zoo+of+mice+for+genetic+analyses:+a+comprehensive+protocol+for+the+rapid+generation+of+BAC+transgenic+mice.">Building a zoo of mice for genetic analyses: a comprehensive protocol for the rapid generation of BAC transgenic mice.</a> Genesis. 48, 264-280 (2010).</li><li>Skarnes, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+knockout+resource+for+the+genome-wide+study+of+mouse+gene+function.">A conditional knockout resource for the genome-wide study of mouse gene function.</a> Nature. 474, 337-342 (2011).</li><li>Carbery, I. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186, 451-459 (2010).</li><li>Meyer, M., de Angelis, M. H., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+by+homologous+recombination+in+mouse+zygotes+mediated+by+zinc-finger+nucleases.">Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 15022-15026 (2010).</li><li>Cui, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+integration+in+rat+and+mouse+embryos+with+zinc-finger+nucleases.">Targeted integration in rat and mouse embryos with zinc-finger nucleases.</a> Nat. Biotechnol. 29, 64-67 (2011).</li><li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat. Biotechnol. 31, 23-24 (2013).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+production+of+mouse+disease+models+by+embryo+microinjection+of+TALENs+and+oligodeoxynucleotides.">Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides.</a> Proc. Natl. Acad. Sci. U.S.A. 110, 3782-3787 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-Step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-Step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153, 910-918 (2013).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genetics. 11, 636-646 (2010).</li><li>ZFN, T. A. L. E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Joung, J. K., Sander, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TALENs:+a+widely+applicable+technology+for+targeted+genome+editing.">TALENs: a widely applicable technology for targeted genome editing.</a> Nat. Rev. Mol. Cell Biol. 14, 49-55 (2013).</li><li>Cermak, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+design+and+assembly+of+custom+TALEN+and+other+TAL+effector-based+constructs+for+DNA+targeting.">Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting.</a> Nucleic Acids Res. 39, (2011).</li><li>Reyon, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH+assembly+of+TALENs+for+high-throughput+genome+editing.">FLASH assembly of TALENs for high-throughput genome editing.</a> Nat. Biotechnol. 30, 460-465 (2012).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcription+activator-like+effector+toolbox+for+genome+engineering.">A transcription activator-like effector toolbox for genome engineering.</a> Nat. Protoc. 7, 171-192 (2012).</li><li>Kim, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+library+of+TAL+effector+nucleases+spanning+the+human+genome.">A library of TAL effector nucleases spanning the human genome.</a> Nat. Biotechnol. 31, 251-258 (2013).</li><li>Schmid-Burgk, J. L., Schmidt, T., Kaiser, V., Honing, K., Hornung, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ligation-independent+cloning+technique+for+high-throughput+assembly+of+transcription+activator-like+effector+genes.">A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes.</a> Nat. Biotechnol. 31, 76-81 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat. Biotechnol. 31, 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat. Biotechnol. 31, 822-826 (2013).</li><li>Hermann, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+OPEN+zinc+finger+nucleases+for+direct+gene+targeting+of+the+ROSA26+locus+in+mouse+embryos.">Evaluation of OPEN zinc finger nucleases for direct gene targeting of the ROSA26 locus in mouse embryos.</a> PLoS ONE. 7, (2012).</li><li>Meyer, M., Ortiz, O., Hrabe de Angelis, M., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+disease+mutations+by+gene+targeting+in+one-cell+mouse+embryos.">Modeling disease mutations by gene targeting in one-cell mouse embryos.</a> Proc. Natl. Acad. Sci. U.S.A. 109, 9354-9359 (2012).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat. Biotechnol. 29, 143-148 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Doyon, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+zinc-finger-nuclease+activity+with+improved+obligate+heterodimeric+architectures.">Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures.</a> Nat. Methods. 8, 74-79 (2011).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Wefers, B., Wurst, W., K&#252;hn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Haueter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+vasectomy-overexpression+of+Prm1-EGFP+fusion+protein+in+elongating+spermatids+causes+dominant+male+sterility+in+mice.">Genetic vasectomy-overexpression of Prm1-EGFP fusion protein in elongating spermatids causes dominant male sterility in mice.</a> Genesis. 48, 151-160 (2010).</li><li>Perez-Pinera, P., Ousterout, D. G., Brown, M. T., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+to+the+ROSA26+locus+directed+by+engineered+zinc+finger+nucleases.">Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases.</a> Nucleic Acids Res. 40, 3741-3752 (2012).</li><li>Bultmann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+transcriptional+activation+of+silent+oct4+pluripotency+gene+by+combining+designer+TALEs+and+inhibition+of+epigenetic+modifiers.">Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers.</a> Nucleic Acids Res. 40, 5368-5377 (2012).</li><li>Valton, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+TALE+DNA+binding+domain+sensitivity+to+cytosine+methylation.">Overcoming TALE DNA binding domain sensitivity to cytosine methylation.</a> J. Biol. Chem. 287, 38427-38432 (2012).</li><li>Cradick, T. J., Ambrosini, G., Iseli, C., Bucher, P., McCaffrey, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN-Site+searches+genomes+for+zinc+finger+nuclease+target+sites+and+off-target+sites.">ZFN-Site searches genomes for zinc finger nuclease target sites and off-target sites.</a> BMC Bioinform. 12, (2011).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Byers, S. L., Payson, S. J., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+ten+inbred+mouse+strains+following+assisted+reproductive+technologies+(ARTs).">Performance of ten inbred mouse strains following assisted reproductive technologies (ARTs).</a> Theriogenology. 65, 1716-1726 (2006).</li><li>Luo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+strategies+for+6+commonly+used+mouse+strains.">Superovulation strategies for 6 commonly used mouse strains.</a> J. Am. Assoc. Lab. Animal Sci. 50, 471-478 (2011).</li><li>Pease, S., Saunders, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> International Society for Transgenic Technologies. Advanced protocols for animal transgenesis : an ISTT manual. , (2011).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+human+genome+engineering+via+Cas9.">RNA-Guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li></ol>

The authors declare no competing interests.

Designer nuclease-driven genome editing approaches have significantly extended the range of species amenable to targeted modifications of their respective genomes10,12. In mice, gene-targeting in ES cells has been a standard technique for over two decades; however, it has proven difficult to adapt to ES cells from species other than the mouse, although there has been some recent success in rat ES cells. Even with the availability of "off-the-shelf" gene-targeted mouse ES cell clones provided by consortia such as EUCOMM, KOMP, or NorCOMM3 genome editing by ZFN and TALEN provides higher precision and flexibility regarding the spectrum of modifications that can be introduced into the mouse genome. Founder animals carrying nuclease-mediated mutations seem to be highly germ-line competent4-6,20,21, which is not always the case for chimeras originating from blastocyst injections of ES cells. Thus, in certain cases microinjection of designer nucleases can result in significantly faster generation of novel mouse lines with targeted genome modifications.
The successful generation of knockout mice by injection of ZFN and TALEN depends to a great extent on the activity of the injected nuclease pair. TALENs have been shown to have a high success rate in targeting a wide range of genes in a number of organisms; however, recent studies suggest that TALEN binding is sensitive to cytosine methylation30,31.Thus, newly generated nuclease pairs, for example TALENs cloned into pCAG-T7 vectors, can be transfected transiently into a mouse cell line such as NIH-3T3 or Neuro-2a, which mimic the chromatin state of the mouse embryo to some extent. Here, nuclease activity can be estimated using the T7 endonuclease assay or a restriction digest of PCR product as described in section 5 prior to mRNA synthesis and microinjection. We recommend sequencing of the genomic region of interest in the respective cell line and the mouse strain used for microinjection experiments.
In mouse zygotes, different TALEN or ZFN pairs will work optimally at different mRNA concentrations and therefore the optimal working concentration of the microinjected nuclease mRNA may have to be determined experimentally. Depending on the nuclease pair, too low a concentration will result in no cleavage whereas too high can result in embryo lethality. Depending on the nuclease pair, we have had success using total mRNA concentrations as low as 2 ng/&#181;l and as high as 200 &#181;g/ul. These effects are difficult to predict from experiments in cell culture and the nuclease concentration optimal for both embryo survival and modification rate of the target locus needs to be determined empirically.
Highly active ZFN or TALEN can cleave their target sequence beyond the one-cell stage of the microinjected embryo and thus cause complex patterns of mutagenesis and mosaicism in founders. We and others4 have observed three or more distinct mutated alleles in a single founder (Figure 5C). Thus, when establishing a new mouse line from these founders, offspring should be carefully screened by sequencing for the presence of the favorable mutation since digestion assays provide evidence only that an undefined mutation is present.
One of the criticisms frequently voiced against the ZFN and TALEN systems is the possibility that these nucleases are also capable of cleaving sequences present somewhere else in the genome that are similar to the target sites. Such off-target effects have been observed with early generation reagents using the homodimeric FokI domain, and heterodimer constructs were designed to alleviate off-target effects25. Potential off-target sites can be predicted to some extent in silico32,33 and screened by PCR and sequencing. An obvious advantage of using ZFNs and TALENs for generating mice rather than cell lines is the possibility of removing off target mutations unlinked to desired genome modification by performing several backcrosses to a wild-type strain of choice. For the analysis of a large number of founder mice, next-generation deep sequencing of PCR products generated from the nuclease-targeted locus and in silico predicted off-target loci might offer an alternative qualitative and quantitative readout to the digestion assays of PCR products.
The assisted reproductive techniques described in this protocol are optimized for standard mouse strains used for microinjection experiments such as C57Bl/6J or B6D2F1. Mice of different origins, such as outbred strains, can in principle be used for genome editing approaches and might provide a more suitable genetic background for specific research questions. The performance of assisted reproductive techniques such as superovulation can be predicted for a number of strains34-36 but might require further optimization for nonstandard strains in order to obtain a sufficient number of embryos for nuclease microinjection.
Besides ZFN and TALEN, new designer nucleases such as the RNA-guided CRISPR/Cas9 system9,37,38 have now been introduced for genome editing applications. All methods for microinjection and analysis of founder animals described here are also applicable to CRISPR/Cas9 and future modes of genome editing.

Mice are by far the most popular platform for generating transgenic animal models. The versatile toolbox for genetic engineering of the mouse embryo1-3 has been recently extended by genome editing approaches based on designer nucleases such as zinc finger nucleases (ZFN)4-6, transcription activator-like effector nucleases (TALEN)7,8, and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system9. ZFN and TALEN function as pairs of two custom-designed protein-based DNA-binding domains (arrays of zinc finger proteins and repeat-variable di-residues (RVDs), respectively) that are each coupled to the FokI endonuclease10-12. Conversely, the specificity of Cas9-mediated DNA cleavage is provided by transactivating CRISPR RNAs (crRNA and tracrRNA, which can also be combined into a single chimeric RNA molecule termed guide RNA)11 that act in a complex with the CRISPR protein.
TALENs with a defined sequence of RVDs can be rapidly constructed by individual experimenters with a multitude of assembly strategies to choose from13-17. CRISPR/Cas9 promises even less labor-intensive generation of designer nucleases, however the specificity of guide RNA-DNA binding is still not completely resolved18,19. Generation of custom ZFNs has so far been limited to specialized academic laboratories and to commercial suppliers such as Sangamo Biosciences and the Sigma CompoZr service.
In general, genome editing with designer nucleases aims at introducing double strand breaks (DSB) at defined genomic loci, which subsequently attract nonhomologous end joining (NHEJ) or homologous recombination (HR) DNA repair machineries10,12. NHEJ-mediated repair of a DSB often results in the introduction of insertions and deletions in close proximity to the site of repair. Thus NHEJ repair can be exploited for knocking out the function of a target gene by introducing a frame-shift mutation within the genes protein-coding sequence4,7,9. Alternatively, defined addition or replacement of genetic information can be achieved by providing a DNA donor together with the designer nucleases. A DNA donor comprises investigator-designed DNA sequences flanked by regions of homology with the target locus, thus serving as a template for DSB repair by HR. Both plasmids5,6,20 and single-stranded oligonucleotides8,9,21&#160;have been successfully used as donors. Neither NHEJ- nor HR-mediated genome editing require the introduction of a selectable marker into the genome of the mouse embryo, which makes these strategies particularly well suited for creating small alterations in the nucleotide sequence without disturbing the overall genetic architecture.
In this protocol we describe all essential procedures for genome editing in the mouse embryo using TALENs. These include 1) identification of a TALEN target site22, 2) construction of TALENs by golden gate cloning13, 3) in vitro synthesis of TALEN mRNA, 4) microinjection of TALEN mRNA into fertilized mouse oocytes, 5) surgical procedures for embryo transfer, and 6) analysis of TALEN-induced mutagenesis in founder animals. We focus on TALEN mRNA microinjection and screening of founders for NHEJ-induced insertions/deletions. For this purpose we have generated bifunctional TALEN constructs that allow both expression in mammalian cells when transfected as plasmids and in vitro synthesis of TALEN mRNA for microinjection into mouse embryos. These constructs comprise a truncated TALE backbone23 fused to heterodimeric FokI domains24,25 for optimal genome editing in mammalian cells. This protocol can also be adopted for microinjection of other designer nucleases or for combined injections of designer nucleases and donor constructs (design of DNA donors has been described in excellent technical publications by Wefers et al.26,27).
Ethical Statement
All animal experiments were performed in accordance with the guidelines and regulations of the Cantonal Veterinary Office of Canton Zurich.

<table border="0" cellpadding="0" cellspacing="0" width="524">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">BsaI</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">R0535S or L</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Esp3I</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">ER0451</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T4 Ligase</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0202S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Spectinomycin</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">S0692-1ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ampicillin&#160;</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">A0166</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">X-Gal</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">B4252</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">IPTG</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">I6758</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Plasmid-Safe nuclease</td>
			<td style="width:111px;">Epicentre</td>
			<td style="width:119px;">E3101K</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">27106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAGEN Plasmid Midi Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">12143</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAquick PCR Purification Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">28106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">mMESSAGE mMACHINE T7 Ultra Kit</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM1345</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NucAway Spin Columns</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM10070</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNaseZAP</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">R2020-250ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NorthernMax Formaldyde Load Dye</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM8552</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNA Millennium Markers</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM7150</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">10x TBE buffer</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">B52</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T7 endonuclease</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0302S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">pGEM-T EasyVector System I</td>
			<td style="width:111px;">Promega</td>
			<td style="width:119px;">A3600</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">SYBR Green I Nucleic Acid Gel Stain</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">S-7563</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">pregnant mare&#39;s serum gonadotrophin (PMSG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">G4877</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">human chorionic gonadotropin (hCG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">CG5</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M2 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7167</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M16 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7292</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Mineral oil, embryo tested</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M8410</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ketamine</td>
			<td style="width:111px;">CentraVet</td>
			<td style="width:119px;">Ket 201</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Xylazine</td>
			<td style="width:111px;">Sigma Aldrich</td>
			<td style="width:119px;">46995</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Equipment/Tools</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Inverted microscope with Nomarski DIC optics (for example Nikon Eclipse TE200)</td>
			<td style="width:111px;">Nikon</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Micromanipulator units (for example Narishige, NT88NF)</td>
			<td style="width:111px;">&#160;Narishige</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo holding capillaries</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;">B100-75-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo injection capillaries</td>
			<td style="width:111px;">Narishige</td>
			<td style="width:119px;">GD-1</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Capillary puller (for example Sutter P97)</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Microforge (for example Narishige MF-900)</td>
			<td style="width:111px;">Narishige&#160;</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Walton skin scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14077-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14041-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical probe</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">10140-03</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clip system (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12031-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clips (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12032-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dumont fine forceps 5</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11254-20</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria curvrd forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11370-31</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria fine forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11399-80</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dietrich bulldog clamp</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">18038-45</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Animals</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">C57BL/6J mice</td>
			<td style="width:111px;">Jackson labs</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">CD-1 mice</td>
			<td style="width:111px;">Charles river</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
	</tbody>
</table>

mouse genome engineering using designer nucleases

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well as for modeling human diseases and testing therapeutic strategies. Recent advances in the use of designer nucleases such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system for site-specific genome engineering open the possibility to perform rapid targeted genome modification in virtually any laboratory species without the need to rely on embryonic stem (ES) cell technology. A genome editing experiment typically starts with identification of designer nuclease target sites within a gene of interest followed by construction of custom DNA-binding domains to direct nuclease activity to the investigator-defined genomic locus. Designer nuclease plasmids are in vitro transcribed to generate mRNA for microinjection of fertilized mouse oocytes. Here, we provide a protocol for achieving targeted genome modification by direct injection of TALEN mRNA into fertilized mouse oocytes.

We constructed destination plasmids compatible with the Golden GateTALEN assembly published by Cermak et al.13 that allow expression of TALENs in mammalian cells as well as in vitro mRNA synthesis from the T7 phage promoter (Figure 1C). These plasmids carry heterodimeric FokI domains (ELD or KKR mutations) that have been shown to reduce off-target effects relative to FokI homodimers and to enhance cleavage activity as compared to first generation FokI heterodimers25,29. Golden gate assembly reactions #1 and #2 are usually very efficient and every white colony, when analyzed by colony PCR, shows the expected pattern for the particular number of RVDs cloned (Figures 1B and 1D).
Gel analysis of in vitro synthesized mRNA (Figure 2) should reveal a single distinguishable band with little or no smear for every sample analyzed. There should be a clear size shift between samples L1/R1 and L2/R2, L3/R3, which indicates successful polyadenylation.
Founder animals can be screened for NHEJ-induced mutated alleles using genotyping PCR followed by either T7 endonuclease digestion (Figure 3) or a restriction digest using an enzyme that cleaves the wild type sequence within the spacer region of the nuclease pair (Figure 4). The T7 endonuclease assay is applicable to any kind of mutation irrespective of the specific genomic sequence within the spacer region of the nuclease pair injected; however, it detects only mismatches between DNA strands in heteroduplex PCR products. Thus, in the rare event that a founder carries two identically mutated alleles, PCR products would not show any T7 digestion pattern. Such distinction is, however, always possible when a specific restriction site is located within the nuclease spacer region that will be eliminated by NHEJ-induced insertions/deletions (Figure 5). Here, undigested bands indicate the presence of mutations, and the absence of any digested products strongly suggests a founder carrying mutations in both alleles of the targeted gene (marked with asterisks in Figure 4b).
<img alt="Figure 1" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig1highres.jpg" src="/files/ftp_upload/50930/50930fig1.jpg" width="600" /> 
Figure 1. Golden Gate cloning of TALEN RVDs into heterodimeric pCAG-T7-Destination vectors. A) Assembly of RVD arrays into pFUS vectors. Here an example is shown for a TALEN pair with individual TALE arrays comprising 15 RVDs and 17 RVDs, respectively (for TALE arrays longer than 21 RVDs, three pFUS-RVDs assemblies are required, not shown). Arrows indicate primers for pFUS-specific colony PCR reactions. B) PCR products amplified from correct pFUS assemblies typically show a band corresponding to the combined length of all RVDs cloned (e.g. around 1.1 kb for 10 RVDs) and a &#34;ladder&#34; of smaller less prominent bands due to the repetitive nature of RVD arrays. C) Final assembly of pFUS-RVD arrays and a plasmid containing the last repeat (pLR) into heterodimeric TALEN expression vectors with FokIELD and FokIKKR variants, respectively. The TALEN backbone (annotated as N and C) resembles the architecture published by Miller et al.23 The CAG (CMV early enhancer element/ chicken beta-actin) promoter ensures high expression levels in transfected mammalian cells, while the T7 phage promoter allows in vitro mRNA synthesis (use SacI for linearization of the vector downstream of the nuclease STOP codon). D) Colony PCR using primers indicated by arrows in C) allows identification of correctly assembled TALENs. Full-length PCR products are often less prominent while the &#34;ladder effect&#34; represents a robust indicator of successful assembly. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig1highres.jpg" target="_blank">Click here to view larger image</a>.
<img alt="Figure 2" fo:content-width="3in" fo:src="/files/ftp_upload/50930/50930fig2highres.jpg" src="/files/ftp_upload/50930/50930fig2.jpg" width="300" /> 
Figure 2. Quality control of nuclease mRNA in vitro synthesis using agarose gel electrophoresis. ZFN mRNAs are shown as an example (L, left ZFN; R, right ZFN). Samples L1/R1 show mRNA prior to polyadenylation, samples L2/R2 show polyadenylated mRNA and L3/R3 show purified polyadenylated mRNA. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig2highres.jpg" target="_blank">Click here to view larger image</a>.
<img alt="Figure 3" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig3highres.jpg" src="/files/ftp_upload/50930/50930fig3.jpg" width="600" /> 
Figure 3. Example of a T7 endonuclease assay used for identification of founder animals carrying nuclease-induced mutations of the target locus. A) A TALEN pair was designed to cleave within the coding region of the mouse prion protein gene (Prnp, TALEN target sequence can be provided upon request). A PCR product is generated using a forward primer (F) located 110 bp upstream and a reverse primer (R) 250 bp downstream of the TALEN cleavage site. B) The PCR product is subsequently subjected to heteroduplex formation and T7 endonuclease digestion. C) TALEN-induced mutagenesis within the targeted genomic region of single founders is revealed by the presence of a full-length PCR product with digestion products of 250 and 110 bps. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig3highres.jpg" target="_blank">Click here to view larger image</a>.
<img alt="Figure 4" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig4highres.jpg" src="/files/ftp_upload/50930/50930fig4.jpg" width="600" /> 
Figure 4. Example of a restriction digest of PCR products used for identification of founder animals carrying nuclease-induced mutations of the target locus. ZFN specific for the mouse Rosa26 locus29 target a XbaI restriction site within intron 1. A) Founders were screened by genotyping PCR using a forward primer (F) located 500 bp upstream and a reverse primer (R) 250 bp downstream of the cleavage site. B) Digestion of PCR products with XbaI reveals digestion patterns indicating mice with bi-allelic mutations (marked with asterisks), mono-allelic mutations (digested and undigested bands, e.g. animal 2) and wt mice (complete digestion, e.g. animal 21). C) Sequencing of mice with potential bi-allelic modifications shows up to 3 (animal 24) distinct insertions/deletions. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig4highres.jpg" target="_blank">Click here to view larger image</a>.
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Name of Primer</td>
			<td>Sequence 5&#8217; to 3&#8217;</td>
		</tr>
		<tr>
			<td>pCR8_F1</td>
			<td>ttgatgcctggcagttccct</td>
		</tr>
		<tr>
			<td>pCR8_R1</td>
			<td>cgaaccgaacaggcttatgt</td>
		</tr>
		<tr>
			<td>TAL_F1</td>
			<td>ttggcgtcggcaaacagtgg</td>
		</tr>
		<tr>
			<td>TAL_R2</td>
			<td>ggcgacgaggtggtcgttgg</td>
		</tr>
		<tr>
			<td>TAL_Seq_5-1</td>
			<td>catcgcgcaatgcactgac</td>
		</tr>
	</tbody>
</table>
Table 1. Sequences of primers used for colony PCRs and sequencing within the Golden Gate TALEN assembly protocol.
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Plasmid/Collection</td>
			<td>Contributor</td>
			<td>Addgene ID</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Golden Gate TALEN and TAL Effector Kit 2.0</td>
			<td>Voytas lab</td>
			<td>1000000024</td>
			<td>Contains all plasmids necessary for Golden Gate TALEN assembly</td>
		</tr>
		<tr>
			<td>pCAG-T7-TALEN -KKR/ELD destination vectors</td>
			<td>Pelczar lab</td>
			<td>40131, 40132</td>
			<td>Add-on plasmids for TALEN expression in mammalian cells and in vitro mRNA synthesis</td>
		</tr>
	</tbody>
</table>
Table 2. Plasmids and plasmid collections required for Golden Gate TALEN assembly can be obtained from Addgene (<a href="http://www.addgene.org">www.addgene.org</a>).
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Online Resource</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>http://tale-nt.cac.cornell.edu</td>
			<td>Design of TALEN; TALEN off-target prediction</td>
		</tr>
		<tr>
			<td>http://zifit.partners.org/ZiFiT/</td>
			<td>Design of TALEN, OPEN ZFN, CoDA ZFN, CRISPR/Cas9</td>
		</tr>
		<tr>
			<td>http://www.genome-engineering.org</td>
			<td>Design of TALEN, CRISPR/Cas9; CRISPR/Cas9 off-target prediction</td>
		</tr>
		<tr>
			<td>http://baolab.bme.gatech.edu/Research/BioinformaticTools/assembleTALSequences.html</td>
			<td>Assembly of TALEN sequences for confirmation of sequencing results</td>
		</tr>
		<tr>
			<td>http://pgfe.umassmed.edu/ZFPmo dularsearchV2.html</td>
			<td>Design of modular assembly ZFN </td>
		</tr>
		<tr>
			<td>www.genomecenter.ucdavis.edu/s egallab/segallabsoftware</td>
			<td>Design of modular assembly ZFN</td>
		</tr>
	</tbody>
</table>
Table 3. Online resources for designing ZFN, TALEN, and CRISPR/Cas9.

Watch this Scientific Journal Video about Mouse Genome Engineering Using Designer Nucleases at JoVE.com

Mouse Genome Engineering Using Designer Nucleases

Designer nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) can be used to modify the genome of mouse preimplantation embryos by triggering both the nonhomologous end joining (NHEJ) and homologous recombination (HR) pathways. These advances enable the rapid generation of mice with precise genetic modifications.

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

mouse-genome-engineering-using-designer-nucleases

Research

JoVE Journal

Biology

28.5K Görüntüleme.  University of Zurich.  Örneğin çinko parmak nükleazlara (ZFNs) ve transkripsiyon aktivatörü gibi efektör nükleazlara (TALENS) olarak tasarımcı nükleazlar homolog olmayan uç birleştirme (NHEJ) ile homolog yeniden birleştirmeye (HR) yolaklar tetikleyerek fare preimplantasyon embriyoların genomunu değiştirmek için kullanılabilir. Bu gelişmeler kesin genetik değişiklikler farelerde hızlı üretimini sağlar. 